ID: 1077437771

View in Genome Browser
Species Human (GRCh38)
Location 11:2550982-2551004
Sequence GCTGAGCTCAGTGGGCTTGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 335
Summary {0: 1, 1: 0, 2: 2, 3: 29, 4: 303}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077437759_1077437771 20 Left 1077437759 11:2550939-2550961 CCCAGGCCAGACTCTGGTGGTAG 0: 1
1: 0
2: 0
3: 13
4: 213
Right 1077437771 11:2550982-2551004 GCTGAGCTCAGTGGGCTTGGTGG 0: 1
1: 0
2: 2
3: 29
4: 303
1077437762_1077437771 14 Left 1077437762 11:2550945-2550967 CCAGACTCTGGTGGTAGCAGGAG 0: 1
1: 0
2: 0
3: 15
4: 200
Right 1077437771 11:2550982-2551004 GCTGAGCTCAGTGGGCTTGGTGG 0: 1
1: 0
2: 2
3: 29
4: 303
1077437760_1077437771 19 Left 1077437760 11:2550940-2550962 CCAGGCCAGACTCTGGTGGTAGC 0: 1
1: 0
2: 0
3: 9
4: 148
Right 1077437771 11:2550982-2551004 GCTGAGCTCAGTGGGCTTGGTGG 0: 1
1: 0
2: 2
3: 29
4: 303

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077437771 Original CRISPR GCTGAGCTCAGTGGGCTTGG TGG Intronic