ID: 1077439431

View in Genome Browser
Species Human (GRCh38)
Location 11:2561111-2561133
Sequence AGAATGGTGTGAACCCCAGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 2703
Summary {0: 18, 1: 377, 2: 450, 3: 646, 4: 1212}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077439426_1077439431 3 Left 1077439426 11:2561085-2561107 CCAGCTACTCGGGAGGCTGAGGC 0: 94911
1: 257638
2: 218586
3: 135882
4: 139272
Right 1077439431 11:2561111-2561133 AGAATGGTGTGAACCCCAGGGGG 0: 18
1: 377
2: 450
3: 646
4: 1212
1077439424_1077439431 4 Left 1077439424 11:2561084-2561106 CCCAGCTACTCGGGAGGCTGAGG 0: 99957
1: 284367
2: 226920
3: 125442
4: 164576
Right 1077439431 11:2561111-2561133 AGAATGGTGTGAACCCCAGGGGG 0: 18
1: 377
2: 450
3: 646
4: 1212
1077439422_1077439431 12 Left 1077439422 11:2561076-2561098 CCTGTAGTCCCAGCTACTCGGGA 0: 54379
1: 173656
2: 264604
3: 194654
4: 115454
Right 1077439431 11:2561111-2561133 AGAATGGTGTGAACCCCAGGGGG 0: 18
1: 377
2: 450
3: 646
4: 1212

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077439431 Original CRISPR AGAATGGTGTGAACCCCAGG GGG Intronic
Too many off-targets to display for this crispr