ID: 1077440664

View in Genome Browser
Species Human (GRCh38)
Location 11:2567268-2567290
Sequence CTGCAAATACAGATGAACCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 231
Summary {0: 1, 1: 0, 2: 1, 3: 28, 4: 201}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077440659_1077440664 11 Left 1077440659 11:2567234-2567256 CCCTTTAGTTCACCTTTGGAACT 0: 1
1: 0
2: 1
3: 6
4: 167
Right 1077440664 11:2567268-2567290 CTGCAAATACAGATGAACCCAGG 0: 1
1: 0
2: 1
3: 28
4: 201
1077440660_1077440664 10 Left 1077440660 11:2567235-2567257 CCTTTAGTTCACCTTTGGAACTT 0: 1
1: 0
2: 2
3: 9
4: 135
Right 1077440664 11:2567268-2567290 CTGCAAATACAGATGAACCCAGG 0: 1
1: 0
2: 1
3: 28
4: 201
1077440662_1077440664 -1 Left 1077440662 11:2567246-2567268 CCTTTGGAACTTAGGACCAAGTC 0: 1
1: 0
2: 1
3: 8
4: 98
Right 1077440664 11:2567268-2567290 CTGCAAATACAGATGAACCCAGG 0: 1
1: 0
2: 1
3: 28
4: 201
1077440658_1077440664 12 Left 1077440658 11:2567233-2567255 CCCCTTTAGTTCACCTTTGGAAC 0: 1
1: 0
2: 0
3: 17
4: 83
Right 1077440664 11:2567268-2567290 CTGCAAATACAGATGAACCCAGG 0: 1
1: 0
2: 1
3: 28
4: 201

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077440664 Original CRISPR CTGCAAATACAGATGAACCC AGG Intronic
900985411 1:6070230-6070252 TTGCAAAAACAGATAAAGCCTGG - Intronic
902042419 1:13502475-13502497 CTGCACACACAAATGAACTCTGG + Intronic
904915483 1:33967433-33967455 CTGCACCCACAGGTGAACCCAGG + Intronic
905884462 1:41484373-41484395 CTGCAAATACAGAGGTGCCCAGG - Intronic
908822472 1:68102604-68102626 CAGCAAATACAGATGAATATAGG - Intronic
909141345 1:71869970-71869992 CTGGAAAATCACATGAACCCGGG - Intronic
911324728 1:96456772-96456794 CTGAAAACACTGATGAAGCCTGG - Intergenic
911615752 1:100008985-100009007 CTGTAAGTACAGATGACTCCTGG + Intronic
911709206 1:101049922-101049944 CTGAAAATAGAGATGAGCCAAGG + Intergenic
917576545 1:176327437-176327459 CTACAAATAAAGATGAGCCCTGG + Intergenic
920510402 1:206547315-206547337 CTGTAAATACAGATGAAGCGTGG - Intronic
922287235 1:224181088-224181110 CTGCCAATCCAGATGAAACTTGG + Intronic
922289491 1:224198655-224198677 CTGCCAATCCAGATGAAACTTGG - Intergenic
924240058 1:242031840-242031862 CTGGAAATATTGTTGAACCCAGG + Intergenic
924355602 1:243171971-243171993 CTGCAAATACAGTACAGCCCGGG - Intronic
1065187663 10:23184564-23184586 CTTCAAGCACAGATTAACCCAGG + Intergenic
1067421491 10:46154841-46154863 CTGGTCATATAGATGAACCCTGG + Intergenic
1068634935 10:59338322-59338344 ATGCAAAAAGAGATGAGCCCTGG - Intronic
1068690531 10:59909140-59909162 CTGCAAAAACACATGAACAAAGG + Intergenic
1069482849 10:68799380-68799402 CTGCAGATAAAGATCAACTCAGG + Intergenic
1069759748 10:70800603-70800625 CTGAAAATAGAAAAGAACCCTGG + Intergenic
1069800318 10:71077933-71077955 CTGCAACTCCAGGTGGACCCTGG - Intergenic
1073810841 10:107150936-107150958 CTGCTAATAAAGATATACCCGGG - Intronic
1074161128 10:110837189-110837211 CTGCACATACAGTCAAACCCAGG - Exonic
1075350822 10:121723617-121723639 CTGCAAATGCAGATGACCAGGGG + Intergenic
1077440664 11:2567268-2567290 CTGCAAATACAGATGAACCCAGG + Intronic
1079895092 11:26109101-26109123 CTGCAAACACAGAGGAACCAGGG + Intergenic
1080350273 11:31376277-31376299 CTGCAGATAAAGATATACCCGGG - Intronic
1082181433 11:49124850-49124872 CTGCGGCTACAGATGAGCCCAGG - Intergenic
1083439725 11:62667906-62667928 CTACAAAAACAAATGAGCCCGGG + Exonic
1084455686 11:69266923-69266945 CTGTAAATACAGATGAAGCTTGG - Intergenic
1084631373 11:70353592-70353614 CTGCAAAAACAAAAAAACCCTGG + Intronic
1085636949 11:78166339-78166361 ATGTAAATAGAAATGAACCCTGG + Intergenic
1089039189 11:115429977-115429999 CTGGAAAAAGAAATGAACCCAGG + Intronic
1092480905 12:8858284-8858306 ATGAGAATACAGATGAAGCCTGG + Intronic
1096060326 12:48693087-48693109 CTGGCAATACAGACAAACCCCGG - Exonic
1099043570 12:77686741-77686763 CTGTAAAGTCAGATGAACCTAGG - Intergenic
1100370398 12:93964357-93964379 CTGCAACTTCATATGAAACCTGG - Intergenic
1101353478 12:103955339-103955361 GTGCAAATACAAATGGAGCCAGG + Intronic
1101521903 12:105491602-105491624 GTGAAAACACAGATGAACCTGGG - Intergenic
1103820159 12:123691443-123691465 CTACAAACACGGATGAACCATGG - Intronic
1105285177 13:18997590-18997612 CTGAAAATAGAGATGAACATAGG - Intergenic
1107033923 13:35881024-35881046 CTGAATATACAGATGAACAATGG + Intronic
1107830418 13:44370286-44370308 CTGCCACCATAGATGAACCCAGG + Intergenic
1109997718 13:70151430-70151452 CAGCAAAAATAGATGAACCTGGG - Intergenic
1110337258 13:74346748-74346770 CTGGAAAGACAGCTGAAGCCAGG + Intergenic
1111614164 13:90642943-90642965 CTGCAAATAAAGACATACCCAGG + Intergenic
1113033280 13:106017830-106017852 ATGCAAATACAGATGGTCTCAGG - Intergenic
1113247220 13:108411092-108411114 CTGTAAATACAGATGACCCTTGG + Intergenic
1114438911 14:22730475-22730497 CTGAAAATAGAAAAGAACCCTGG - Intergenic
1114879115 14:26761784-26761806 CTGCAAATACAGACTAAGCTTGG - Intergenic
1115113832 14:29855969-29855991 CTGCTAATAAAGATGTACGCAGG - Intronic
1116691078 14:48106370-48106392 CAGCAAAGATAGAGGAACCCAGG - Intergenic
1116992479 14:51291014-51291036 CTGCAAATACAGATTAACATTGG - Intergenic
1117630951 14:57690884-57690906 CTCTAAATACAGATGAAGCTTGG + Intronic
1123149247 14:106165510-106165532 CTGCAAACACAGAGACACCCTGG + Intergenic
1123154519 14:106211243-106211265 CTGCAAACACAGAGACACCCTGG + Intergenic
1123162211 14:106289333-106289355 CTGCAAACACAGAGACACCCCGG + Intergenic
1123172724 14:106389697-106389719 CTGCAAACACAGAGACACCCTGG + Intergenic
1123180351 14:106463568-106463590 CTGCAAACACAGAGACACCCTGG + Intergenic
1123181070 14:106470572-106470594 CTGCAAACACAGAGACACCCTGG + Intergenic
1123181793 14:106478249-106478271 CTGCAAACACAGAGAAATCCTGG + Intergenic
1123192757 14:106586683-106586705 CTGCAAACACAGAGACACCCTGG + Intergenic
1123202144 14:106676044-106676066 CTGAAAACACACATGAACCATGG - Intergenic
1123214153 14:106791005-106791027 CTGCAAACACAGAGACACCCTGG + Intergenic
1123215216 14:106803005-106803027 CTGCAAACACAGAGACACCCTGG + Intergenic
1123216129 14:106810747-106810769 CTGCAAACACAGAGACACCCTGG + Intergenic
1202847796 14_GL000009v2_random:197156-197178 CTGAAAATAAAGATTAACCAGGG + Intergenic
1202917270 14_GL000194v1_random:187696-187718 CTGAAAATAAAGATTAACCAGGG + Intergenic
1202945111 14_KI270726v1_random:18480-18502 CTGCAAACACAGAGAAATCCTGG - Intergenic
1202945838 14_KI270726v1_random:26207-26229 CTGCAAACACAGAGACACCCTGG - Intergenic
1202946545 14_KI270726v1_random:33084-33106 CTGCAAACACAGAGACACCCTGG - Intergenic
1123401147 15:19987969-19987991 CTGCAAACACAGAGACACCCTGG + Intergenic
1124699914 15:31903908-31903930 CTCCAAATACTGGTGAGCCCGGG + Intergenic
1124967074 15:34441513-34441535 CTCAAAATACTGGTGAACCCTGG + Intergenic
1125135183 15:36333047-36333069 CTGTAAATATAGATGAAACTTGG - Intergenic
1125442850 15:39722048-39722070 CTGCAAATACAGTTGAACTTGGG - Intronic
1126711623 15:51463471-51463493 CTGGAAATGCAGAAGAATCCCGG + Exonic
1127063550 15:55213562-55213584 CTGTAAATACAGATGAAACTTGG - Intronic
1129228500 15:74183613-74183635 CTCCACATGGAGATGAACCCTGG - Intronic
1130684054 15:86021805-86021827 CTGCACACCCAGATGAACGCTGG - Intergenic
1131056869 15:89380027-89380049 CTGCACATACACAGGAACACAGG + Intergenic
1131604370 15:93885547-93885569 CTAAAAATACAGATGGTCCCTGG - Intergenic
1133214236 16:4281651-4281673 CTGTAGATACAGATGAAGCTTGG + Intergenic
1134379043 16:13707402-13707424 CTGTAAATACAGATGAAGCTTGG - Intergenic
1134769229 16:16791723-16791745 CTTCAAATTCAGATGGACCTGGG - Intergenic
1134865459 16:17603098-17603120 AAGCAAATACATTTGAACCCAGG - Intergenic
1135724855 16:24846326-24846348 CTGCAAAGAGAGAGGATCCCGGG + Exonic
1136095404 16:27952064-27952086 CTTAAAATACAGTTCAACCCAGG + Intronic
1138133058 16:54498714-54498736 CTGCCAGTACAGCAGAACCCAGG - Intergenic
1139158214 16:64470415-64470437 CTGGAAATACAGATCTACCTTGG + Intergenic
1141350178 16:83287401-83287423 CTGTAAATACAGATGAAGCTTGG - Intronic
1146471024 17:33125046-33125068 CTGTAAACACAGATGAAGCTTGG + Intronic
1147926146 17:43947204-43947226 CTGCAAACAGGGATGAAGCCAGG - Intergenic
1149159125 17:53668763-53668785 CTGCTAACAAAGATGGACCCAGG - Intergenic
1150455865 17:65305995-65306017 CTGTAAATACAGATGAAGCTTGG + Intergenic
1151600653 17:75104203-75104225 CTGGTCACACAGATGAACCCTGG - Intronic
1153817153 18:8800450-8800472 CTGCATATACCGATCAACCTTGG + Intronic
1154006875 18:10538199-10538221 TTGCAAACTCAGATGAACTCAGG + Intronic
1154048857 18:10934013-10934035 CTGCAAATAAAGACTTACCCTGG - Intronic
1155367005 18:25058719-25058741 CTGTAAATACAGATGAAGCTTGG + Intergenic
1156442750 18:37207968-37207990 CTGCAAATACAGAATTAGCCAGG - Intronic
1161666199 19:5578466-5578488 AAGCAGAAACAGATGAACCCAGG - Intergenic
1162913095 19:13860542-13860564 CTGGAATTACAGATGGAGCCCGG - Intergenic
1163745159 19:19042506-19042528 CTGCAAATACAGAAGAGGCCGGG - Intronic
1166097547 19:40550449-40550471 CAGCAGATACAGATGTATCCAGG + Intronic
1168513525 19:56992444-56992466 CTGCAAACAGTGATGAACACTGG - Intergenic
925701258 2:6640645-6640667 CTGAAAATATAGATGAACTCAGG - Intergenic
927036131 2:19178473-19178495 CTGCAAATACTAATGTACCCTGG + Intergenic
929029160 2:37634872-37634894 CTGAATATCCAGATGAGCCCTGG - Intergenic
930701792 2:54465270-54465292 CTGGAAATACCAAAGAACCCTGG - Intronic
931413218 2:62055014-62055036 CTACAAATACAGATTAACATTGG + Intronic
931740675 2:65239640-65239662 CAGTAAATAAACATGAACCCTGG + Intronic
932716602 2:74104804-74104826 CTGCAGAAACTGATGAACCAAGG - Exonic
933191603 2:79339944-79339966 CTGCAGACTCAGATGACCCCTGG - Intronic
934513895 2:94972019-94972041 CTCCAAACACAGAGAAACCCTGG + Intergenic
935824723 2:106934102-106934124 GTGGAAATACAGATGGACCTTGG - Intergenic
936993289 2:118388151-118388173 CTACAAATACTGATGGCCCCTGG + Intergenic
937279078 2:120705061-120705083 CTCCAAATGCAGGTGAACCTTGG - Intergenic
937620494 2:123979795-123979817 CTGCTAATAAAGACGTACCCAGG - Intergenic
939707826 2:145477536-145477558 CAGCATATCCAGATCAACCCAGG - Intergenic
945916772 2:215712610-215712632 CTGCAAATGCAGTTTGACCCAGG - Intergenic
1169925369 20:10778037-10778059 CTGCACATGGAGATGAACTCAGG + Intergenic
1171979671 20:31618725-31618747 CTGGGACTACAGATGCACCCTGG - Intergenic
1174795298 20:53517306-53517328 CTGTAAACACAGATGAAGCTTGG - Intergenic
1175290509 20:57872061-57872083 CTGCTAATAAAGATATACCCAGG + Intergenic
1175604026 20:60297847-60297869 CTGTAAACACAGATGAAGCATGG + Intergenic
1178475062 21:32930892-32930914 CTGTAAATACAGATGAAGCTTGG + Intergenic
1179227369 21:39466488-39466510 CTGCTAATAAAGACGTACCCAGG + Intronic
1179559052 21:42201201-42201223 CTGCAAATACAGATTAACATTGG - Intronic
1181829582 22:25549258-25549280 CTGTAAATACAGATGAAGCTTGG - Intergenic
1183083709 22:35473759-35473781 CTGCAAATAGCGCTGAACACGGG - Intergenic
949845280 3:8363416-8363438 CTGCAAGAACAAATAAACCCTGG - Intergenic
950612159 3:14133616-14133638 CTGCAAGTCCAGATTAGCCCAGG - Intronic
953533616 3:43759727-43759749 CTGCAAAGCAAAATGAACCCAGG + Intergenic
955035480 3:55263185-55263207 GTGCAAAGACAGATGAATCTTGG + Intergenic
956727625 3:72169400-72169422 ATGACAATACAGTTGAACCCAGG - Intergenic
956770267 3:72520048-72520070 GTGCAAGTACAGAAGCACCCTGG + Intergenic
957845016 3:85721272-85721294 CTGCAAATACATTTGAATCAAGG + Intronic
958579591 3:96000909-96000931 CTTTAAATCAAGATGAACCCTGG + Intergenic
958638004 3:96770278-96770300 CTCTGAATTCAGATGAACCCAGG + Intergenic
960312746 3:116136449-116136471 CAGCAATCACAGATTAACCCAGG - Intronic
960756103 3:121014735-121014757 CTGCAAATACAGATAAGTACTGG - Intronic
962313485 3:134342544-134342566 CTGCACACACACACGAACCCGGG + Intergenic
962366766 3:134791962-134791984 CTGCTAATACAGATATACCTGGG + Intronic
963474029 3:145780745-145780767 CAGCAGAAACACATGAACCCTGG - Intergenic
965634997 3:170771722-170771744 GTGCAAAGACAGATGACCACTGG - Intronic
967546553 3:190736896-190736918 CTGCAAATTCAGATGGATCATGG - Intergenic
968267720 3:197375592-197375614 CTGCAAATGCATTTGAACCAGGG + Intergenic
969324555 4:6433638-6433660 CTGCATGTATAGTTGAACCCAGG - Intronic
970301791 4:14689067-14689089 CTGCAGATACAGATGTACATAGG - Intergenic
971837391 4:31786161-31786183 CTGTAAATACAGATAAAGCTTGG - Intergenic
971863386 4:32138067-32138089 CTGCAAATACAGATTAGCATTGG + Intergenic
972007256 4:34125464-34125486 CTGCAATTATAAAGGAACCCTGG - Intergenic
973992222 4:56421042-56421064 CTGTAAATACAGATGAAGCTTGG - Intronic
974115487 4:57574220-57574242 CTATAAATACGGATAAACCCAGG - Intergenic
975678914 4:76855816-76855838 GTGCAAAAGCAGTTGAACCCAGG + Intergenic
977157073 4:93587935-93587957 CTGCAAAATTAGATAAACCCAGG + Intronic
977910147 4:102524891-102524913 CTGTATATACAGATGAAGCTTGG + Intronic
978316127 4:107439479-107439501 CTGCAAATACAGATTAACATTGG - Intergenic
979232718 4:118364511-118364533 TGGCAAATACAGAAGAACACTGG + Intergenic
979246206 4:118507660-118507682 CTGCAAATACAGTACAGCCCAGG + Intergenic
979623458 4:122821330-122821352 CTGCAAATACAGATTAACATTGG - Intergenic
980042330 4:127953644-127953666 CTAAAAATACACTTGAACCCAGG - Intronic
981048075 4:140283972-140283994 CTTCAAGTACAGATGCACCGAGG - Intronic
981182651 4:141763963-141763985 CTGTAAATACACATGAAGCTGGG + Intergenic
981980094 4:150781474-150781496 CTATAAATACAGATGAAGCTTGG + Intronic
982039959 4:151387556-151387578 CTGCAAATACAGATTAACATTGG - Intergenic
982557279 4:156883372-156883394 CTGAAACTAAAAATGAACCCAGG + Intronic
989153354 5:38321345-38321367 CTGTAAATACAGACGAAGCTTGG + Intronic
989567021 5:42910864-42910886 CTTGAAATACAGAGCAACCCAGG - Intergenic
992325031 5:75652004-75652026 CTTTGAATCCAGATGAACCCTGG - Intronic
994671479 5:102766515-102766537 CTGTAAATACAGATGAAGCTTGG + Intronic
995232175 5:109779471-109779493 CAGCAGATACAGATGAGCTCAGG - Intronic
996967404 5:129322093-129322115 CTGCTGATAAAGATGTACCCAGG + Intergenic
998213820 5:140222410-140222432 TGGCAAATACAGATGGACACTGG - Intronic
999624979 5:153511243-153511265 CCCCAAATAAAGGTGAACCCAGG + Intronic
1000578756 5:163009727-163009749 CTGCTAATAAAGATATACCCAGG + Intergenic
1000640394 5:163695690-163695712 CTTCAAATACAGAGAAAGCCAGG - Intergenic
1002306537 5:178286929-178286951 CTGTGAATACAGAGTAACCCGGG + Intronic
1003110910 6:3251490-3251512 CTGCAATTGCAGATGAAGCACGG - Intronic
1003946711 6:11082815-11082837 CTGAAAATACACCTGAAGCCTGG - Intergenic
1004327268 6:14686698-14686720 CTGTAAAAACAGATGAAGCCTGG + Intergenic
1004952225 6:20686314-20686336 CTGTAAACACAGATGAAGCTTGG - Intronic
1005051251 6:21685874-21685896 CTGTAAACACAGATGAAGCTTGG - Intergenic
1007210956 6:40193068-40193090 CAGGAATTACAGATGTACCCTGG - Intergenic
1008665624 6:53712975-53712997 CTGCAAATCCACATGAAGGCTGG - Intergenic
1008920476 6:56839097-56839119 CTGCAGATAGAGATGGCCCCTGG + Intronic
1010048824 6:71479630-71479652 TTGCAAGTACAGCTGAACCCTGG + Intergenic
1010887075 6:81257148-81257170 CTTCAAAAATTGATGAACCCAGG + Intergenic
1014887127 6:126795489-126795511 CAGCAAATACAGAAGAACTGGGG - Intergenic
1017549923 6:155495269-155495291 CTGCAAATTAAGAAGAATCCTGG + Intergenic
1018319486 6:162592158-162592180 CTGCAAATACAAAATTACCCGGG - Intronic
1018968130 6:168504574-168504596 CTGTAAATACAGATGAATACAGG + Intronic
1020985020 7:15122345-15122367 CTGCAGATACAGAAGTACACAGG - Intergenic
1021967954 7:25940576-25940598 CTACCAATGAAGATGAACCCAGG + Intergenic
1023074924 7:36473075-36473097 CTGCATATACAGCAGCACCCTGG + Intergenic
1024467361 7:49726115-49726137 ATGCAAATACAAATGAATCTAGG - Intergenic
1025793371 7:64715742-64715764 CTGCAAATACATCTGATCCAGGG - Intergenic
1026316025 7:69228396-69228418 CTGCAAATACAGATGAAGCTTGG + Intergenic
1029047641 7:97646575-97646597 CTGTAAATACAGATGATACTTGG + Intergenic
1030025447 7:105319699-105319721 CTGTAAATACAGCTGAGTCCTGG + Intronic
1030156731 7:106462960-106462982 TTGCAAATATAGATAAAACCTGG + Intergenic
1030563582 7:111122431-111122453 CTGCAAATACTGAAGAAGCATGG + Exonic
1031692882 7:124812651-124812673 CTGAAAGCACAGATGAACACAGG - Intergenic
1031828739 7:126600234-126600256 CTGGAAATACAGTTGACCCTTGG + Intronic
1033929489 7:146505520-146505542 CAGGAAATACAGATGTTCCCTGG + Intronic
1035796772 8:2364704-2364726 CTGCTAATAAAGACGTACCCAGG - Intergenic
1038131129 8:24732710-24732732 CTGCAAATTCAGGCCAACCCAGG - Intergenic
1038657330 8:29465761-29465783 CTGTAAATATAGATGAAGCTTGG - Intergenic
1038863630 8:31414846-31414868 CTGTAAATACAGATGATGCTTGG + Intergenic
1042789684 8:72590104-72590126 CTCCAAATGGAGTTGAACCCAGG - Intronic
1044646688 8:94450941-94450963 CTGCAAACTAAAATGAACCCTGG + Intronic
1046630993 8:116623079-116623101 CTGCTAATAAAGATATACCCAGG - Intergenic
1046639421 8:116710364-116710386 CTGAAAATACAGATCAAGCTGGG - Intronic
1050705039 9:8386987-8387009 CTGACAATACACATGAGCCCTGG - Intronic
1051577295 9:18631307-18631329 GTGCAATTACAGATAAACCAGGG + Intronic
1060933130 9:127501275-127501297 CAGGAAATAAAGATGACCCCTGG + Intronic
1061001455 9:127905153-127905175 CTGCAGATTCAGGTGATCCCTGG + Intronic
1061364716 9:130166069-130166091 TAGAAAATACAGATGAGCCCGGG + Intergenic
1061995088 9:134179140-134179162 CTGGAAAGACAGAGGAACACGGG - Intergenic
1186204826 X:7190389-7190411 CTGTAAATACAGATGAAGCTTGG + Intergenic
1188340198 X:28990696-28990718 CTGCAAATATATATGAGACCAGG + Intronic
1188434775 X:30148115-30148137 CTGCAACTGCAGCTGCACCCAGG - Intergenic
1189724274 X:43952850-43952872 CTGGAAATACATGTGAAACCTGG - Intronic
1194806546 X:98335811-98335833 CTGTAACTACAGATGAGACCAGG - Intergenic
1195671421 X:107473372-107473394 CTGCAAATACAAGTGCATCCAGG - Intergenic
1195982519 X:110594651-110594673 CTCCAAATACAGATCTGCCCGGG + Intergenic
1197561268 X:128024853-128024875 CTGCACACACAGAGGGACCCTGG + Intergenic
1198270311 X:135051058-135051080 CTGCAAATTCAGAAGAAAACAGG + Exonic
1201577511 Y:15477023-15477045 CTGTGAATACAGATGAAGCTTGG + Intergenic