ID: 1077441069

View in Genome Browser
Species Human (GRCh38)
Location 11:2569509-2569531
Sequence CTCCCTCAGAAGCCGGGCCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 354
Summary {0: 1, 1: 0, 2: 0, 3: 23, 4: 330}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077441069_1077441076 3 Left 1077441069 11:2569509-2569531 CCAGGGCCCGGCTTCTGAGGGAG 0: 1
1: 0
2: 0
3: 23
4: 330
Right 1077441076 11:2569535-2569557 AGGCAGGAGTCCGCCGGAAGTGG 0: 1
1: 0
2: 0
3: 7
4: 120
1077441069_1077441077 4 Left 1077441069 11:2569509-2569531 CCAGGGCCCGGCTTCTGAGGGAG 0: 1
1: 0
2: 0
3: 23
4: 330
Right 1077441077 11:2569536-2569558 GGCAGGAGTCCGCCGGAAGTGGG 0: 1
1: 0
2: 0
3: 3
4: 65
1077441069_1077441075 -3 Left 1077441069 11:2569509-2569531 CCAGGGCCCGGCTTCTGAGGGAG 0: 1
1: 0
2: 0
3: 23
4: 330
Right 1077441075 11:2569529-2569551 GAGGACAGGCAGGAGTCCGCCGG 0: 1
1: 0
2: 3
3: 25
4: 276
1077441069_1077441081 27 Left 1077441069 11:2569509-2569531 CCAGGGCCCGGCTTCTGAGGGAG 0: 1
1: 0
2: 0
3: 23
4: 330
Right 1077441081 11:2569559-2569581 CCTGAGACGCCGTATGCCTGTGG 0: 1
1: 0
2: 0
3: 4
4: 54

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077441069 Original CRISPR CTCCCTCAGAAGCCGGGCCC TGG (reversed) Intronic
900096981 1:943787-943809 CGCCCTCAAGATCCGGGCCCAGG + Exonic
900162758 1:1232150-1232172 CTTCCGCAGACGCCGAGCCCCGG - Intergenic
900409124 1:2504922-2504944 CCCCCTCCCCAGCCGGGCCCAGG - Exonic
900506552 1:3032310-3032332 CTCTCTGAGCAGCCAGGCCCTGG + Intergenic
901127770 1:6941389-6941411 GTCCCTCAGAGGCCAGGCACTGG + Intronic
901449142 1:9325494-9325516 CTCCCATAGAAGCAGGGCCTAGG - Intronic
902682974 1:18056769-18056791 CTCCCTCCTAATCCTGGCCCAGG - Intergenic
902783573 1:18719331-18719353 CTCCCTCAAAAGCCCCACCCAGG - Intronic
903485676 1:23688222-23688244 CTCCCTCTGATGCCGAGCCGAGG + Intergenic
903757992 1:25676367-25676389 ATCGCTCAGAAGCTGGGCACGGG - Intronic
903961946 1:27063480-27063502 CTCCCTCTGATGCCGAGCCGAGG + Intergenic
904761158 1:32805189-32805211 CTCCCTCTGATGCCGAGCCGAGG - Intronic
904831810 1:33310264-33310286 CTCCCTCTGATGCCGAGCCGAGG - Intronic
905866058 1:41377421-41377443 CTCCTTCAGAACCTGGGCCAGGG - Intronic
906251118 1:44311763-44311785 ATCCCTCAGGAGCCAGGTCCTGG + Intronic
906762078 1:48384297-48384319 CTCCCTCTGATGCCGAGCCAAGG - Intronic
910897055 1:92080393-92080415 CTCCCAGAGAAGCCGGACCGCGG - Exonic
911602198 1:99857773-99857795 CTCCCTCTGATGCCGAGCCAAGG - Intronic
916049895 1:161029002-161029024 CTCCCTCTGATGCCGAGCCGAGG + Intronic
917846769 1:179026233-179026255 CTCCCTGAGGGGCCGGGCACCGG + Intronic
918172319 1:182010261-182010283 CTCCCTCTGATGCCGAGCCGAGG + Intergenic
920671825 1:208009544-208009566 CTCCCACAGAAGCCCAGACCTGG + Intergenic
920946058 1:210529604-210529626 GTCCCTGAGAAGCTGGGCCTGGG - Intronic
921192624 1:212724280-212724302 CTCCCTCTGATGCCGAGCCGAGG + Intergenic
922718024 1:227887124-227887146 CTCCCTCAGAAGCAGCGCTGGGG + Intergenic
923716529 1:236429155-236429177 CTCCCTCTGATGCCGAGCCGAGG - Intronic
1062860122 10:804415-804437 CTCCCTGAGGAGCCAGGGCCGGG - Intergenic
1064602461 10:17007523-17007545 CTTCCTCAGAAGCAGTGCTCAGG + Intronic
1066325211 10:34352380-34352402 CTCCCTCTGATGCCGAGCCGAGG + Intronic
1066802519 10:39207022-39207044 CTGTTTCAGAAGCCTGGCCCAGG + Intergenic
1067091330 10:43267006-43267028 CTCCCTCCGCAGCCGGCGCCGGG + Intergenic
1067114258 10:43422669-43422691 CTCCCTCTGATGCCGAGCCAAGG + Intergenic
1067346557 10:45442535-45442557 ATCACTCAGAAGCCGGGATCGGG + Intronic
1067537446 10:47124182-47124204 CTCCCATAGGAGCAGGGCCCAGG + Intergenic
1067750608 10:48968847-48968869 CACCCACTGTAGCCGGGCCCCGG - Intronic
1068090881 10:52431130-52431152 CTCCCTCAGGTGTCCGGCCCAGG + Intergenic
1069959670 10:72072395-72072417 CTCCTTGAGCAGCCAGGCCCCGG - Intronic
1070367598 10:75751276-75751298 CTCCCTCTGATGCCGAGCCGAGG - Intronic
1071289894 10:84181099-84181121 CTCCCTCTGATGCTGAGCCCAGG - Intronic
1073266597 10:102231474-102231496 CTCCCTCGGACCCCGGACCCCGG - Intronic
1073569960 10:104572488-104572510 CTCCCTCAGAACCAGGGACTAGG + Intergenic
1074148828 10:110740462-110740484 CTCCCTCTGCAGCAGGGCCTTGG - Intronic
1076668174 10:132104619-132104641 CTCCCTCCGGAGCCGTGGCCTGG - Intergenic
1076721716 10:132396142-132396164 CCGGCTCAGAAGCCCGGCCCGGG + Intergenic
1076873334 10:133204148-133204170 CATCCTCAGAAGCCAGGACCAGG + Intronic
1077441069 11:2569509-2569531 CTCCCTCAGAAGCCGGGCCCTGG - Intronic
1077607200 11:3620324-3620346 CTTCCTCAAAGGCCAGGCCCAGG - Intergenic
1078866533 11:15302831-15302853 CTGCCTTAGAGGCCAGGCCCTGG + Intergenic
1079035231 11:17014528-17014550 CTCCCTCAGGAGCCCGCGCCTGG - Intergenic
1080538234 11:33243121-33243143 CTCCCTCTGATGCCGAGCCGAGG + Intergenic
1081745095 11:45467520-45467542 GCCCCACAGAAGCCGGGACCTGG + Intergenic
1082166612 11:48956487-48956509 CTCCCTCTGATGCCGAGCCGAGG - Intergenic
1082983152 11:59142839-59142861 CTCCCTCTCCAGCCCGGCCCAGG + Exonic
1084271522 11:68031740-68031762 CTCCCCCAGGAACCGTGCCCAGG - Intronic
1084476824 11:69394079-69394101 CTCCCTCGGAAGCCGGCTGCTGG + Intergenic
1086495914 11:87404302-87404324 CTTTCTCAGAAGCCAGGCACAGG - Intergenic
1087487145 11:98770716-98770738 CTCCCTCTGATGCCGAGCCGAGG - Intergenic
1087713745 11:101583523-101583545 CTCCCCCGGGAGCGGGGCCCAGG - Exonic
1089514450 11:119023305-119023327 CTCACACCTAAGCCGGGCCCAGG - Exonic
1090332598 11:125943330-125943352 CAAGCTCAGCAGCCGGGCCCTGG - Intergenic
1090670645 11:128942907-128942929 CTCCCTGAGAGGCCGTGCTCGGG - Exonic
1091545701 12:1500206-1500228 CTCCCGCAGCAGCCAGGCCCGGG + Intergenic
1094103086 12:26784385-26784407 CTCCCTCTGATGCCGAGCCAAGG + Intronic
1094839438 12:34336797-34336819 TCCCCTCAGTAGCTGGGCCCCGG + Intergenic
1094842249 12:34347057-34347079 CTCCCGGAGAGGCTGGGCCCCGG - Intergenic
1095943465 12:47740662-47740684 CTTCCTGAGCAGCTGGGCCCGGG + Exonic
1096684116 12:53276658-53276680 CTCCCTCAGCAGGAGGGCCAGGG - Exonic
1097110215 12:56652398-56652420 CTCCCTCTGAAGCCGAGCCGAGG - Intergenic
1097228777 12:57495961-57495983 CTCCCTCTGATGCCGAGCCGAGG - Intronic
1097844474 12:64352331-64352353 CTCCCTCAGAGGCCTGTCTCAGG - Intronic
1098333285 12:69375863-69375885 CTCCCTCTGATGCCGAGCCCAGG - Intronic
1098412438 12:70201165-70201187 CTCCCTCTGATGCCGAGCCAAGG + Intergenic
1098774041 12:74588894-74588916 CTCCCTCTGATGCCGAGCCGAGG - Intergenic
1100048095 12:90410606-90410628 CTCCCTCTGATGCCGAGCCAAGG + Intergenic
1100606746 12:96158139-96158161 CTCCCTCTGATGCCGAGCCGAGG + Intergenic
1101775443 12:107789145-107789167 CTCCCTCAGATGCCTGGCTAAGG + Intergenic
1103325035 12:120114943-120114965 GTCCCTCAGAACCCAGGCCAGGG + Intronic
1103856166 12:123972664-123972686 CTCCCTCGGCGGCCCGGCCCGGG - Exonic
1104955844 12:132465482-132465504 CGCTCTCAGAGGCAGGGCCCCGG + Intergenic
1106115563 13:26814887-26814909 CTCCCACGGGAGCAGGGCCCCGG - Intergenic
1106605409 13:31224038-31224060 ACCCCTCAGAACCCAGGCCCAGG - Intronic
1106799375 13:33241575-33241597 CTCCCTCTGATGCCGAGCCGAGG + Intronic
1107905220 13:45055322-45055344 CACACTCAGAAACCGGGGCCTGG - Intergenic
1108574281 13:51778122-51778144 CTCCCTCTGAACCCTGGCTCTGG + Intronic
1109388747 13:61666860-61666882 CTCCCTCAGAAGCCTATCCAAGG + Intergenic
1111230768 13:85341467-85341489 CTCCCTCAGATGCCGAGCGGAGG - Intergenic
1111388456 13:87561128-87561150 CTCCCTCTGATGCCGAGCCGAGG + Intergenic
1113481540 13:110625508-110625530 CTGCCTCTGGAGCTGGGCCCCGG - Intronic
1114427504 14:22636445-22636467 CTCCCTCTGATGCCGAGCCAAGG + Intergenic
1114578600 14:23736364-23736386 CTCCCTCTGATGCCGAGCCGAGG + Intergenic
1115494054 14:33985049-33985071 CTCCCTCTGATGCCGAGCCGAGG - Intronic
1116959785 14:50957193-50957215 CTCCCTCTGATGCCGAGCCGAGG - Intergenic
1117010782 14:51468252-51468274 CTCCCTCTGATGCCGAGCCGAGG - Intergenic
1119198791 14:72737794-72737816 CTCCCTCTGATGCAGGGGCCTGG + Intronic
1120892714 14:89505309-89505331 CTCCCTCTGATGCCGAGCCGAGG + Intronic
1121659057 14:95621081-95621103 CTCCGTCAGAACCCAGCCCCAGG - Intergenic
1122408180 14:101512602-101512624 CACCATCAGCAGCCAGGCCCGGG - Intergenic
1122987892 14:105221045-105221067 CTCACACAGAGGCCAGGCCCTGG + Intronic
1124607732 15:31184002-31184024 CTCCCTCTGATGCCGAGCCGAGG + Intergenic
1125538585 15:40456997-40457019 CTCACTCAGAACTGGGGCCCAGG + Intronic
1126210866 15:46098761-46098783 CTCCCTCTGATGCCAAGCCCAGG - Intergenic
1126278746 15:46917775-46917797 CTCCCTCAGAAGCAGATCCTGGG - Intergenic
1126328378 15:47506120-47506142 CTCTCTGAGAGGCCTGGCCCTGG - Intronic
1126816684 15:52460607-52460629 CTCCCTCTGATGCCGAGCCGAGG - Intronic
1127384952 15:58459854-58459876 CTCCTTCACAGGCGGGGCCCTGG + Intronic
1128699354 15:69793060-69793082 CACCCTCAGAGGCTGGGCCCAGG + Intergenic
1128843875 15:70872356-70872378 CTCCCTCTGATGCCGAGCCGAGG - Intronic
1131087558 15:89589408-89589430 CTCCCTCCAAAGCCCTGCCCAGG + Intronic
1132087958 15:98923327-98923349 CTTCCTCACAGGCCGGGCTCGGG + Intronic
1132498462 16:274662-274684 CTCCCTCAGGACCTGGGCCTAGG + Intronic
1132719111 16:1307315-1307337 CTCCCCCAGAATCCAGTCCCTGG - Intergenic
1132758988 16:1499912-1499934 CTCCCGCAGAAGCTGCCCCCTGG - Intronic
1132759343 16:1501291-1501313 CTCACTCAGTGGCTGGGCCCTGG - Intronic
1132865393 16:2090548-2090570 CTCCCTCTGGAGCGTGGCCCAGG - Exonic
1133097540 16:3457881-3457903 CTCCGTGCGAAGCCAGGCCCAGG - Intronic
1133384747 16:5360312-5360334 CTCCCTCAGCAGAAGGGCCCTGG - Intergenic
1136165015 16:28447994-28448016 CTCCCTCTGATGCCGAGCCGAGG + Intergenic
1136197950 16:28666986-28667008 CTCCCTCTGATGCCGAGCCGAGG - Intergenic
1136214297 16:28781163-28781185 CTCCCTCTGATGCCGAGCCGAGG - Intergenic
1136259017 16:29061008-29061030 CTCCCTCTGATGCCGAGCCGAGG - Intergenic
1136571963 16:31103665-31103687 CTCCCTCTGATGCCGAGCCAAGG + Intergenic
1136573132 16:31108648-31108670 CACCCTCCCAAGCCGGCCCCAGG + Intronic
1137439207 16:48483807-48483829 CTCCCTCTGATGCCGAGCCGAGG - Intergenic
1139556169 16:67712320-67712342 CTCCCTCTGATGCCGAGCCAAGG + Intronic
1139922582 16:70469276-70469298 CTCCCTCCACAGCTGGGCCCGGG - Exonic
1140218190 16:73024875-73024897 GTCCCCCAGAAGGTGGGCCCAGG + Intronic
1141140464 16:81493809-81493831 CTCACACAGCAGCCGGGACCGGG + Intronic
1141531806 16:84651414-84651436 CTCCCCCAGTAGCCTGGCTCTGG - Intronic
1141705950 16:85664639-85664661 CTGCCTCAGAGGCCAGGCCTGGG + Intronic
1142070074 16:88087049-88087071 CTCCCCCAGCAGCCGGGCTGTGG + Intronic
1142265172 16:89061120-89061142 CTCCTTCAGAAGCAGCCCCCAGG + Intergenic
1142818399 17:2446644-2446666 CTCCCTCTGATGCCGAGCCAAGG + Intronic
1143016235 17:3892616-3892638 CTCCACCAGGAGCCGGGCGCGGG + Intronic
1143490828 17:7284387-7284409 CTCCCGCTGCAGCCTGGCCCAGG + Intronic
1143724436 17:8835746-8835768 CTCTCTCAGCATCCTGGCCCAGG + Intronic
1143773860 17:9185296-9185318 CCCCCTGGGAAGCGGGGCCCGGG + Intronic
1144661449 17:17073398-17073420 TTCCCTCAGAACCCGAGCCCTGG - Intronic
1145066133 17:19762550-19762572 ATCCCTCAAAAGCAGGGCCGGGG + Intergenic
1145799582 17:27674279-27674301 CTCCCTGAGAGGCAGAGCCCAGG - Intergenic
1147720603 17:42537216-42537238 GTGCCTCAGAAGCCCAGCCCCGG + Intronic
1148103167 17:45105048-45105070 CTCCAGCAGAAACCGGGCCATGG + Intronic
1148214382 17:45826479-45826501 CTCCCTGAGCAGTCGGGCCTGGG - Intronic
1148777974 17:50106125-50106147 TCCCCTCAGCAGCCCGGCCCTGG - Intronic
1151567438 17:74907172-74907194 CTCCCTGAGGGGCAGGGCCCGGG - Intergenic
1152201950 17:78952460-78952482 CTCCCTCAGTGGCCAGCCCCTGG + Intergenic
1152578774 17:81156905-81156927 CCAACTCAGAAGCAGGGCCCTGG + Intronic
1154011787 18:10580585-10580607 CTCCCACAGTGGCCTGGCCCAGG - Intergenic
1156533862 18:37844500-37844522 CTCCCTCAGGAGCTAGCCCCCGG + Intergenic
1157123745 18:44936158-44936180 ATCCCTCAGAAGCCCAGCCCAGG + Intronic
1157455741 18:47827515-47827537 CTCCCTCTGATGCCGAGCCAAGG + Exonic
1157857878 18:51118042-51118064 CTCCCTCTGATGCCGAGCCGAGG - Intergenic
1160540564 18:79617949-79617971 CGCCCTCAGCAGCCGCGCCTTGG + Intergenic
1161685609 19:5701366-5701388 CTCCCTCTGATGCCGAGCCGAGG + Intronic
1161965371 19:7544881-7544903 CTCCCAGATAAGCAGGGCCCAGG - Intronic
1162042094 19:7977179-7977201 CACCCACAGAAGCCGGCGCCGGG - Intronic
1162602287 19:11677837-11677859 CTCCCTCTGATGCCGAGCCGAGG - Intergenic
1163267949 19:16232934-16232956 CACCCTCAGGAGCAGGACCCAGG + Intronic
1163613166 19:18311288-18311310 CTCCCTCAGAGGCAGGCCGCAGG - Intronic
1163861633 19:19746029-19746051 CCCCCTCAGATGCCAGGCCAGGG - Intergenic
1165081607 19:33310155-33310177 CTCCTACAGAAGCAGGGCCAGGG - Intergenic
1165312080 19:35034468-35034490 CTCCCTCAGAAAAGGGGTCCAGG - Intronic
1166390672 19:42407294-42407316 CTACCTCAAGAGCTGGGCCCAGG - Exonic
1166502701 19:43353480-43353502 CTCCCTCAGATGGAGGGTCCAGG - Intergenic
1167113171 19:47473727-47473749 CTTTCCCAGAAGCCAGGCCCAGG - Intergenic
1167525134 19:49978958-49978980 CTCCCTGGGAAGCTGGGCCCTGG + Intronic
1167937285 19:52919202-52919224 CTCCCTCTGATGCCGAGCCAAGG + Intergenic
1167971221 19:53188543-53188565 CTCCCTCTGATGCCGAGCCAAGG - Intronic
1168404018 19:56101402-56101424 CTCCCACAGACGCAGGGCCAGGG + Intronic
925403796 2:3592209-3592231 CTCCCTCTGATGCCGAGCCAAGG - Intergenic
925760971 2:7184108-7184130 CTTCCTCACAAGCTGAGCCCTGG + Intergenic
926112421 2:10191821-10191843 CCTCCGCAGCAGCCGGGCCCTGG - Intronic
928005609 2:27558862-27558884 CTCCCTCTGATGCCGAGCCAAGG - Intronic
929066259 2:37978281-37978303 CTCCCTCTGATGCCGAGCCCAGG - Intronic
930665742 2:54096794-54096816 CTCCCTCTGATGCCGAGCCAAGG - Intronic
930727725 2:54698432-54698454 CTCCCTCTGATGCCGAGCCAAGG + Intergenic
931727075 2:65121773-65121795 CTCCCTCTAAAGCGGGGGCCGGG + Intronic
932253953 2:70267750-70267772 CTCCCTCTGATGCCGAGCCAAGG - Intronic
932490252 2:72115716-72115738 CTCCCTTCGAAGCCTGGCCCTGG + Intergenic
932758575 2:74425210-74425232 CCACCTCAGAAGCCAGGTCCAGG - Exonic
934736337 2:96691655-96691677 CTCCCAGAGAAGCCAGGGCCTGG + Intergenic
936158364 2:110064603-110064625 CTCCCTCTGATGCCGAGCCGAGG - Intergenic
936186297 2:110306723-110306745 CTCCCTCTGATGCCGAGCCGAGG + Intergenic
936345464 2:111672111-111672133 CTCCCTCTGATGCCGAGCCGAGG + Intergenic
938105704 2:128528510-128528532 CTCCTTCAGAAGCAGGCCCCAGG - Intergenic
940725279 2:157329638-157329660 CTCCCAAAGAAGCCCGGCCCAGG + Intergenic
940775230 2:157876799-157876821 CGCCCGCAGTCGCCGGGCCCGGG - Intronic
944570692 2:201041991-201042013 CTCCCTCTGATGCCGAGCCGAGG + Intronic
945030062 2:205655084-205655106 CTCCTTATGAAGCCGGGCTCTGG + Intergenic
945232784 2:207609832-207609854 CTCCCTCTGATGCCGAGCCAAGG + Exonic
945864993 2:215164234-215164256 CTCCCTCTGATGCCGAGCCGAGG - Intergenic
946431772 2:219630153-219630175 CTCCCCCAGCCCCCGGGCCCGGG + Exonic
946447507 2:219751960-219751982 CTCCCTCTGATGCCGAGCCGAGG - Intergenic
947564317 2:231184337-231184359 CTCCCTGAGAATCTAGGCCCTGG - Intergenic
949014358 2:241701482-241701504 CTCCCTCAGGGCCTGGGCCCTGG - Intergenic
1168829489 20:837439-837461 CTCCCTCAGGAGCTGGGCACTGG + Intronic
1170603555 20:17859666-17859688 CTCCCTCAGGAGCCTGGGCGCGG - Intergenic
1172272290 20:33661443-33661465 CTAGCTCATAAGCCTGGCCCAGG - Intronic
1172335527 20:34112432-34112454 CTCGCTCAGACGCCGCGCACAGG - Intergenic
1173951321 20:46995672-46995694 ATCCCTTAGAAGCCGGCCCCTGG + Intronic
1174416000 20:50367695-50367717 CTCACTCTGAAGCCGGGGCGAGG + Intergenic
1175192695 20:57222238-57222260 CTCCCTGTGAAGCCAGGCTCGGG + Intronic
1175367771 20:58467420-58467442 CTTCCACAGCCGCCGGGCCCTGG - Exonic
1175910762 20:62404550-62404572 CTCGATCAGCAGCCAGGCCCAGG + Intronic
1175983662 20:62753762-62753784 CTCCATTGGAAGCCGGGCCATGG + Intronic
1176027128 20:62991613-62991635 CTTCCTCAGAAGCCGCGCAGTGG - Intergenic
1176034890 20:63031428-63031450 CAGCCTCAGGAGCCAGGCCCGGG + Intergenic
1176150570 20:63588825-63588847 CTCCCTGAGATGCCTGCCCCAGG + Exonic
1176200689 20:63858951-63858973 GCCCCTCAGAATCCGGTCCCAGG + Intergenic
1176511835 21:7754625-7754647 CTGCCTCAGAAGCAAGGGCCTGG + Intronic
1178639241 21:34332934-34332956 CCCTCTCAGAAGCCAGGCCTGGG + Intergenic
1178645948 21:34385151-34385173 CTGCCTCAGAAGCAAGGGCCTGG + Intronic
1181007870 22:20022680-20022702 CTGGCGCAGAAGCCGGGCACAGG - Intronic
1181029798 22:20144218-20144240 CACCCTGAGTGGCCGGGCCCTGG + Intronic
1181051098 22:20238667-20238689 AACCCTCAGATGTCGGGCCCAGG - Intergenic
1181489159 22:23250914-23250936 ATCCCTCAGAAGCGAGGCTCTGG - Intronic
1181513473 22:23399100-23399122 CTCCCTGGGTGGCCGGGCCCTGG - Intergenic
1181585947 22:23853849-23853871 CTCCCTCTGATGCCGAGCCAAGG + Intergenic
1181756583 22:25028753-25028775 CAGCCTCAGAAGCCAGGCCCCGG + Exonic
1182293839 22:29301547-29301569 CTTCCTCAGAAGCCAGACCAAGG + Intergenic
1182354935 22:29718689-29718711 CTCCCTCCAGAGCAGGGCCCAGG + Intergenic
1182864236 22:33588715-33588737 CTCCCTCTTAAGCCAGGCCATGG - Intronic
1185032158 22:48449814-48449836 CGGCTTCAGAGGCCGGGCCCAGG + Intergenic
1185371434 22:50462704-50462726 CTCCTGCAGAAGCTGAGCCCGGG - Exonic
954035704 3:47849858-47849880 TTCCCTCAGATGACGGGCGCCGG + Exonic
954294372 3:49665990-49666012 CTCCCACAGAGGCAGGGCCAAGG - Intronic
954532331 3:51332027-51332049 CTTTCTCAGAAGCCTGGCCTAGG + Intronic
954567225 3:51608787-51608809 CTCCCTCTGATGCCGAGCCGAGG - Intronic
954786668 3:53098452-53098474 GGCCCTCAGAAGCCTGGCCATGG - Intronic
955219665 3:57013004-57013026 CACCCTCCGCAGCCTGGCCCGGG - Intronic
955631887 3:60983386-60983408 CTGCCTCAGAAGATGGGTCCTGG - Intronic
960577341 3:119242000-119242022 CTCCCTCTGATGCCGAGCCGAGG + Intergenic
960844468 3:121993651-121993673 CTCCCTCAGATCCCAGGGCCTGG + Exonic
961013046 3:123448576-123448598 CTCCCCCGGAAGCCGGGCCGGGG + Exonic
961324697 3:126103270-126103292 CTCCCTCAGCAGATGGGGCCGGG - Intergenic
961349153 3:126287891-126287913 CTCCCTCAGGCGCCGCGCCGCGG + Intergenic
961403301 3:126662350-126662372 CTCCCACACAAGCAGTGCCCTGG + Intergenic
961484722 3:127208735-127208757 CACGCTCAGGAGCCAGGCCCGGG + Intergenic
961488356 3:127233301-127233323 CTCCCTCATAAGCCCTTCCCAGG + Intergenic
963852382 3:150221576-150221598 CTAACTCAGAAGCCGGCCCCAGG + Intergenic
963911780 3:150821798-150821820 CTCCCTCTGATGCCGAGCCAAGG - Intergenic
963971041 3:151429764-151429786 CACCCTCAGAGCCCGGGCCTGGG - Intronic
965006629 3:163034784-163034806 CTCCCTCAGAAGCAAGGCTGTGG + Intergenic
966967088 3:185004441-185004463 CTCCCTCTGAGGCCGAGCCGAGG - Intronic
967388119 3:188929878-188929900 CTCCCCCAGAAGATGGGCCCAGG + Intergenic
967878441 3:194282185-194282207 CTCCCTCAGAAACCATTCCCTGG + Intergenic
968852965 4:3095487-3095509 CTCCCTCTGATGCCGAGCCAAGG - Intronic
968890221 4:3364849-3364871 CTCCTGCAGCAGCCAGGCCCTGG - Intronic
968971757 4:3799381-3799403 CTGCCTGACAGGCCGGGCCCAGG + Intergenic
972939585 4:44181280-44181302 CTCCCTCTGATGCCGAGCCGAGG + Intronic
973334146 4:48938749-48938771 CTCCCTGAAAAGCTTGGCCCAGG - Intergenic
973832911 4:54779778-54779800 ATCTCTCAGAAGCTGGGCCATGG - Intergenic
975685420 4:76916114-76916136 CTCCCTCTGATGCCGAGCCAAGG + Intergenic
976463202 4:85336744-85336766 CTCCCCCAAAAGGCTGGCCCTGG - Intergenic
977908474 4:102502465-102502487 CTCTCTCAAATGCCAGGCCCCGG - Intronic
978224759 4:106320781-106320803 CTCCCTCTGATGCCGAGCCGAGG + Intronic
979473754 4:121130569-121130591 CTCCTTGAGAGGCCAGGCCCAGG - Intergenic
979475881 4:121157097-121157119 CTCCCGCTGCAGCCGGTCCCGGG + Exonic
979941616 4:126770640-126770662 CTCCCTCTGATGCCGAGCCGAGG + Intergenic
981993532 4:150953399-150953421 CTCCCTCTGATGCCGAGCCAAGG + Intronic
981994679 4:150963220-150963242 CTCCCTCTGATGCCGAGCCGAGG + Intronic
983664615 4:170167041-170167063 CTCCCTCTGATGCCGAGCCGAGG - Intergenic
983792237 4:171813047-171813069 CTCCCGCAGCCGCCGCGCCCCGG + Intronic
983906186 4:173184559-173184581 CTCCCTCTGATGCCGAGCCGAGG - Intronic
984830296 4:183966534-183966556 CTCCCCCAGAAGCCGTTCCCAGG + Intronic
985726307 5:1517582-1517604 CTGCTTCAGGAGCCGGGCACGGG - Intronic
986493579 5:8319051-8319073 CTCACACAGAACCTGGGCCCAGG + Intergenic
992256569 5:74927349-74927371 CTCCCTCAGAAGAGGGGGCATGG + Intergenic
995456698 5:112360308-112360330 CTCCCTCTGATGCTGAGCCCAGG + Intronic
996057569 5:118998526-118998548 CTCCCTCTGATGCCGAGCCGAGG + Intergenic
997305348 5:132831762-132831784 CACTCTCAGAAGTCGGGCTCAGG - Intergenic
999431818 5:151531392-151531414 CTCCCACATAAGCTGGCCCCAGG + Intronic
1001170759 5:169416966-169416988 CCTCATCAGAGGCCGGGCCCTGG + Intergenic
1003319627 6:5038838-5038860 CTCCCTCTGATGCCGAGCCAAGG - Intergenic
1005710719 6:28501590-28501612 CTACCTCTGATGCCGGGCCGAGG + Intergenic
1006225207 6:32531578-32531600 CTCCCTCTGATGCCGAGCCAAGG + Intergenic
1007545143 6:42687445-42687467 CTCCCTCTGATGCCGAGCCGAGG - Intronic
1008480534 6:51981380-51981402 CTCCCTCTGATGCCGAGCCAAGG + Intronic
1010400764 6:75442715-75442737 CTCCCTCTGATGCCGAGCCAAGG - Intronic
1011443125 6:87408358-87408380 CTACCCCAGAAGCCGGACCTCGG + Intronic
1012470529 6:99568450-99568472 CTCCCCCAAAAACCGGCCCCAGG + Intronic
1014463807 6:121730419-121730441 CTCCCTCTGATGCCGAGCCGAGG - Intergenic
1015656096 6:135520894-135520916 CTCTCTCAGCAGCTGGGACCCGG + Intergenic
1016480029 6:144470987-144471009 CTCCCTCTGATGCCGAGCCAAGG - Intronic
1016958313 6:149648404-149648426 GTCCCTCACCAGCCCGGCCCTGG + Intronic
1017063329 6:150507002-150507024 CTCCCTCTGATGCCGAGCCGAGG + Intergenic
1018243538 6:161801208-161801230 CATCCGCAGAGGCCGGGCCCTGG - Intronic
1019459300 7:1147923-1147945 CTCCCTCTGATGCCGAGCCAAGG - Intergenic
1019563012 7:1667254-1667276 CTCCCTGGGCAGCCTGGCCCCGG - Intergenic
1019651391 7:2161141-2161163 CTCCCTCTGATGCCGAGCCGAGG + Intronic
1020119680 7:5496018-5496040 CTTCCTCAGGAGCAGGGCCATGG - Intronic
1022317924 7:29263063-29263085 CTCCCTCTGATGCCGAGCCGAGG + Intronic
1023042401 7:36183093-36183115 CTGCCTCAGGAGCCGGGCTTAGG - Intronic
1023850533 7:44147613-44147635 CTCCCCCACAACCCAGGCCCTGG - Intronic
1025254596 7:57375045-57375067 CTCACTCTGAAGCCGGGGCGAGG - Intergenic
1026863635 7:73809802-73809824 CTCCCAGTGAAACCGGGCCCTGG - Intronic
1026904761 7:74056625-74056647 GACCCTCAGAAGCCGTGCCTGGG - Intronic
1026976715 7:74503188-74503210 CTCCCTGGGCAGCGGGGCCCTGG - Intronic
1031923807 7:127619975-127619997 GTCCCTCATTAGCTGGGCCCAGG + Intergenic
1032125325 7:129189019-129189041 CGCCCAGAGAATCCGGGCCCGGG - Exonic
1034202909 7:149293594-149293616 TTCCCTCAGGAGCCTCGCCCAGG - Intronic
1034317253 7:150143933-150143955 GGCCCTAAGAAGCCTGGCCCAGG - Intergenic
1034426817 7:151018346-151018368 CTCCCGGAGGAGCCCGGCCCCGG - Exonic
1034639019 7:152587194-152587216 CTCCCTCTGATGCCGAGCCGAGG - Intergenic
1034775499 7:153823284-153823306 AGCCCTAAGAAGCCTGGCCCAGG + Intergenic
1035933599 8:3811606-3811628 CTCCTTCAGAACCCAGGACCAGG + Intronic
1037134742 8:15446688-15446710 CTCCCTCTGATGCCGAGCCGAGG - Intronic
1037473853 8:19237497-19237519 CCACCTCAGCAGCCGGGCCGGGG - Intergenic
1039377140 8:37045735-37045757 CTGCCTAGGAAGCAGGGCCCAGG + Intergenic
1039753322 8:40497188-40497210 CTCCCTCTGATGCCGAGCCGAGG - Intergenic
1039968463 8:42300703-42300725 CCTCCTCAGAAGCCGTGCCCCGG - Intronic
1040041493 8:42919903-42919925 CTCCCTCTGATGCCGAGCCAAGG - Intronic
1040043676 8:42940443-42940465 CTCCCTCTGATGCCGAGCCGAGG - Intronic
1040070177 8:43181054-43181076 CTCCCTCTGATGCCGAGCCAAGG - Intronic
1040864331 8:52032922-52032944 CTCCCTCAGTTGCCTTGCCCAGG + Intergenic
1044969280 8:97604389-97604411 CTCCCTCTGATGCCGAGCCGAGG + Intergenic
1045509885 8:102806291-102806313 CTCCCTCAGAAACTTGGCCCAGG + Intergenic
1048935956 8:139357269-139357291 TTACCTCAGGAGCCAGGCCCTGG - Intergenic
1048982397 8:139709823-139709845 CTCCCTTAGATGCCAAGCCCTGG + Intergenic
1049177577 8:141203111-141203133 CTCCCTCTGATGCCGAGCCGAGG - Intergenic
1049552813 8:143268203-143268225 CTGGCCCAGAAGCCGGGCACTGG + Intronic
1049564407 8:143330773-143330795 CACCCTCAGAGGCAGGACCCGGG - Intronic
1049575647 8:143388590-143388612 CACCCTCATAAGCCGTGCTCTGG - Intergenic
1049689445 8:143952338-143952360 CTCCCTCTGAAGCCAGCCCCAGG + Intronic
1049740491 8:144238753-144238775 CAGCCTGAGAAGCCAGGCCCCGG + Exonic
1052855691 9:33404850-33404872 CTTCCCCAGAATCCTGGCCCTGG - Intergenic
1052941751 9:34136873-34136895 CTCCCTCTGATGCCGAGCCGAGG + Intergenic
1052959572 9:34283531-34283553 ATCCCTCAGGAGTGGGGCCCAGG - Intronic
1053277516 9:36794544-36794566 ATTCCTCAGAAGCCGGCTCCTGG + Intergenic
1057229069 9:93308090-93308112 CCACCTCAGAAGCCAGGCCAGGG - Intronic
1059341680 9:113601006-113601028 CTCCATCTGAAGTCGGGTCCTGG + Intergenic
1060369821 9:123058014-123058036 CTCCCTCTGATGCCGAGCCGAGG - Intronic
1062015232 9:134287945-134287967 CTCCTCCTGCAGCCGGGCCCAGG + Intergenic
1062032191 9:134366691-134366713 CTGCCTCAGAAGCTGAACCCCGG + Intronic
1062137044 9:134934717-134934739 CTCCCCCAGCACCCAGGCCCAGG + Intergenic
1062344434 9:136108376-136108398 CTGCCTCAGAAGCCAGGCAGTGG - Intergenic
1062396088 9:136353452-136353474 GCCCCTCAGAAGCAGGACCCTGG - Intronic
1062554582 9:137108146-137108168 CTCCCCCAGAACCTGGGCTCAGG - Intronic
1062567050 9:137168077-137168099 CTCCGGCAGAGGCAGGGCCCTGG + Exonic
1062596640 9:137302610-137302632 CTCCCTCAGCAGCCAGACCCAGG + Intergenic
1185696167 X:2196340-2196362 CTAGTTCAGAGGCCGGGCCCAGG + Intergenic
1186864140 X:13702191-13702213 CTGCCAAAGAAGCCTGGCCCTGG - Intronic
1188003180 X:25001049-25001071 CTCCCACAGAGGCCTGTCCCAGG + Intergenic
1189450404 X:41123673-41123695 GTCCATCAGGAGCCTGGCCCTGG - Exonic
1190848380 X:54215225-54215247 CTCCCTCTGATGCCCAGCCCAGG + Intronic
1191679509 X:63826279-63826301 CTCCCTCTGATGCCGAGCCGAGG - Intergenic
1192567534 X:72177977-72177999 CTCCCTCTGATGCCGAGCCAAGG + Intergenic
1194254958 X:91624135-91624157 CTCCCCCAGAAGCGGGGACATGG - Intergenic
1195710570 X:107770324-107770346 CCACCTCAGAAGCCAGGTCCAGG + Intronic
1196778373 X:119361430-119361452 CTCCCTCTGATGCCGAGCCGAGG + Intergenic
1198312539 X:135436183-135436205 CTCCCGCCGAAGCCGGTCGCGGG - Intergenic
1200226163 X:154419066-154419088 CTCCCTCCCCAGCCAGGCCCTGG - Intronic
1200324736 X:155224563-155224585 CTCCCTCTGATGCCGAGCCGAGG - Intronic
1200573744 Y:4863738-4863760 CTCCCCCAGAAGCGGGGACATGG - Intergenic
1201283427 Y:12360072-12360094 CTAGCTTAGAAGCCTGGCCCAGG + Intergenic