ID: 1077442999

View in Genome Browser
Species Human (GRCh38)
Location 11:2577448-2577470
Sequence CCCAGGCCGCGTCTTCCCCG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 182
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 170}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077442999_1077443014 29 Left 1077442999 11:2577448-2577470 CCTCGGGGAAGACGCGGCCTGGG 0: 1
1: 0
2: 0
3: 11
4: 170
Right 1077443014 11:2577500-2577522 TCACCACCAGCCCGTGTGTGGGG 0: 1
1: 0
2: 2
3: 7
4: 117
1077442999_1077443012 27 Left 1077442999 11:2577448-2577470 CCTCGGGGAAGACGCGGCCTGGG 0: 1
1: 0
2: 0
3: 11
4: 170
Right 1077443012 11:2577498-2577520 TTTCACCACCAGCCCGTGTGTGG 0: 1
1: 0
2: 2
3: 11
4: 97
1077442999_1077443010 4 Left 1077442999 11:2577448-2577470 CCTCGGGGAAGACGCGGCCTGGG 0: 1
1: 0
2: 0
3: 11
4: 170
Right 1077443010 11:2577475-2577497 GGGTGCCATGGGGGTGTTGACGG 0: 1
1: 0
2: 2
3: 23
4: 250
1077442999_1077443007 -6 Left 1077442999 11:2577448-2577470 CCTCGGGGAAGACGCGGCCTGGG 0: 1
1: 0
2: 0
3: 11
4: 170
Right 1077443007 11:2577465-2577487 CCTGGGGCCTGGGTGCCATGGGG 0: 1
1: 1
2: 7
3: 52
4: 564
1077442999_1077443004 -8 Left 1077442999 11:2577448-2577470 CCTCGGGGAAGACGCGGCCTGGG 0: 1
1: 0
2: 0
3: 11
4: 170
Right 1077443004 11:2577463-2577485 GGCCTGGGGCCTGGGTGCCATGG 0: 1
1: 0
2: 12
3: 94
4: 881
1077442999_1077443008 -5 Left 1077442999 11:2577448-2577470 CCTCGGGGAAGACGCGGCCTGGG 0: 1
1: 0
2: 0
3: 11
4: 170
Right 1077443008 11:2577466-2577488 CTGGGGCCTGGGTGCCATGGGGG 0: 1
1: 0
2: 6
3: 55
4: 522
1077442999_1077443013 28 Left 1077442999 11:2577448-2577470 CCTCGGGGAAGACGCGGCCTGGG 0: 1
1: 0
2: 0
3: 11
4: 170
Right 1077443013 11:2577499-2577521 TTCACCACCAGCCCGTGTGTGGG 0: 1
1: 0
2: 2
3: 7
4: 77
1077442999_1077443005 -7 Left 1077442999 11:2577448-2577470 CCTCGGGGAAGACGCGGCCTGGG 0: 1
1: 0
2: 0
3: 11
4: 170
Right 1077443005 11:2577464-2577486 GCCTGGGGCCTGGGTGCCATGGG 0: 1
1: 1
2: 4
3: 41
4: 456

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077442999 Original CRISPR CCCAGGCCGCGTCTTCCCCG AGG (reversed) Intronic