ID: 1077444076

View in Genome Browser
Species Human (GRCh38)
Location 11:2582250-2582272
Sequence CCTGCCCGGGGGTGGCCATG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 316
Summary {0: 1, 1: 0, 2: 1, 3: 27, 4: 287}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077444063_1077444076 7 Left 1077444063 11:2582220-2582242 CCTCTCTGTCCGCGTGTGCGCCT 0: 1
1: 0
2: 0
3: 4
4: 53
Right 1077444076 11:2582250-2582272 CCTGCCCGGGGGTGGCCATGGGG 0: 1
1: 0
2: 1
3: 27
4: 287
1077444064_1077444076 -2 Left 1077444064 11:2582229-2582251 CCGCGTGTGCGCCTGTGCACCCC 0: 1
1: 0
2: 1
3: 14
4: 152
Right 1077444076 11:2582250-2582272 CCTGCCCGGGGGTGGCCATGGGG 0: 1
1: 0
2: 1
3: 27
4: 287
1077444061_1077444076 20 Left 1077444061 11:2582207-2582229 CCGTGTGCACCTGCCTCTCTGTC 0: 1
1: 2
2: 8
3: 45
4: 533
Right 1077444076 11:2582250-2582272 CCTGCCCGGGGGTGGCCATGGGG 0: 1
1: 0
2: 1
3: 27
4: 287
1077444062_1077444076 11 Left 1077444062 11:2582216-2582238 CCTGCCTCTCTGTCCGCGTGTGC 0: 1
1: 0
2: 1
3: 9
4: 187
Right 1077444076 11:2582250-2582272 CCTGCCCGGGGGTGGCCATGGGG 0: 1
1: 0
2: 1
3: 27
4: 287

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077444076 Original CRISPR CCTGCCCGGGGGTGGCCATG GGG Intronic