ID: 1077444645

View in Genome Browser
Species Human (GRCh38)
Location 11:2585316-2585338
Sequence GACAGTGACCAGGGCCTTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 273
Summary {0: 1, 1: 1, 2: 1, 3: 18, 4: 252}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077444645_1077444649 15 Left 1077444645 11:2585316-2585338 CCTGCAAGGCCCTGGTCACTGTC 0: 1
1: 1
2: 1
3: 18
4: 252
Right 1077444649 11:2585354-2585376 ATTGTTGCATCCAGCCCTCACGG 0: 1
1: 0
2: 1
3: 15
4: 111

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077444645 Original CRISPR GACAGTGACCAGGGCCTTGC AGG (reversed) Intronic
900380547 1:2381875-2381897 CACACTGGCCCGGGCCTTGCTGG - Intronic
900397268 1:2458219-2458241 GGCACTGAGCAGGGCCTTACGGG - Intronic
900851867 1:5150162-5150184 GACAGAGAGAAGGGCCTTTCTGG + Intergenic
901637284 1:10676211-10676233 GACAGACACCAAGGCCCTGCTGG + Intronic
902153017 1:14460295-14460317 GACAATGCCCAGTGCCTTGGGGG - Intergenic
903785670 1:25859505-25859527 GAAGGGGGCCAGGGCCTTGCCGG - Intergenic
904471807 1:30740894-30740916 GACAGGGGCCTGGCCCTTGCAGG - Intronic
904624793 1:31796378-31796400 GACAGTGACAAGGCGCTGGCAGG + Intronic
904886615 1:33743158-33743180 GGCAGTTCCCAGGGCATTGCAGG - Intronic
906218118 1:44056294-44056316 CACAGAGATCTGGGCCTTGCTGG - Intergenic
907944303 1:59119961-59119983 GACAGTGACCAGGGAGTTTATGG - Intergenic
911250258 1:95568385-95568407 GTCAGTGGCCAGGGACTTGGGGG + Intergenic
915105541 1:153533277-153533299 GACAGAGAGCAGGGCGCTGCGGG - Intergenic
915324969 1:155077107-155077129 GATAGTGAACAGGAACTTGCTGG - Intergenic
915902774 1:159858094-159858116 GACAGTGACAATGACCTTCCGGG + Exonic
918209752 1:182340229-182340251 GACAGTTCCCATGGGCTTGCTGG + Intergenic
918650618 1:186957692-186957714 GAAAGTGACAAGGTTCTTGCTGG - Intronic
920092012 1:203461270-203461292 GGCAGTGACCAGGGGCTGGATGG + Intergenic
922717309 1:227884388-227884410 GCAAGTGACCAGAGCCTTGGTGG + Intergenic
924062957 1:240195584-240195606 AAATGTGACCAGGGGCTTGCAGG + Intronic
924128841 1:240884326-240884348 AAATGTGACCAGGGGCTTGCAGG + Intronic
924329528 1:242927967-242927989 TCCCATGACCAGGGCCTTGCTGG - Intergenic
1063084919 10:2808047-2808069 GGCAGTTACCAGGGCCTAGGTGG + Intergenic
1063179588 10:3585662-3585684 GACAGTGGCCTTGGCCTTGCTGG - Intergenic
1064674600 10:17748537-17748559 GCCAGTGACCAGGGCATTCCAGG + Intergenic
1065617688 10:27545751-27545773 GACACTGATCAGGGCTTTCCTGG + Intergenic
1066157628 10:32695592-32695614 GAGAGTGACCTAGCCCTTGCCGG + Intronic
1066656245 10:37701725-37701747 GTCAGTGGCCCGGGCCTTCCAGG + Intergenic
1067440395 10:46306037-46306059 GACAGGGGGCAGGGCCTTGTGGG - Intronic
1067693648 10:48520238-48520260 CACAGTCATCAGGGCCTTGAGGG + Intronic
1069426746 10:68295066-68295088 GACAAAGATCAGGGCCTTGTGGG - Intronic
1070174327 10:73957326-73957348 AACAGTGAGCAGGGCTTGGCTGG - Intergenic
1070592464 10:77810767-77810789 GCCAGAGCCCAGGGCCTGGCCGG + Intronic
1070742468 10:78912026-78912048 GACGGTGTCCAGGGTCATGCTGG + Intergenic
1074711749 10:116183637-116183659 GCCAGAGCCCAGGGCCTTTCTGG - Intronic
1076253389 10:129000403-129000425 GGCAATGACAAGGGCCCTGCAGG - Intergenic
1077444645 11:2585316-2585338 GACAGTGACCAGGGCCTTGCAGG - Intronic
1077501838 11:2912878-2912900 GGCAGCCACCAGGGCCATGCCGG + Intronic
1077791174 11:5441696-5441718 GATAGTGAGCAGGGCCCTGGTGG - Intronic
1079051743 11:17166914-17166936 AGCAGTGACCTGGGCCCTGCAGG + Intronic
1080305018 11:30826619-30826641 GACCGTGACTCGGGCCTTGTTGG - Intergenic
1081605596 11:44525407-44525429 GACAGTGACCCTGATCTTGCAGG + Intergenic
1083210694 11:61183584-61183606 GACAGTAACAAGGGCTATGCGGG - Intergenic
1083296063 11:61716259-61716281 CAGTGTGACCAGGGCCATGCTGG + Intronic
1083365109 11:62137729-62137751 AGCAGTGGCCAGGCCCTTGCTGG + Intronic
1083615192 11:64022699-64022721 GACAGTGACCTTGGCCTGGGGGG - Intronic
1083712670 11:64558847-64558869 GACAGGCAGCAGGGCCTTGAAGG - Intronic
1084196577 11:67526109-67526131 GACAGTGGCCAGGGAAGTGCAGG + Intergenic
1084560570 11:69903378-69903400 GGCAGTGAGCAGGGCCTCGAGGG - Intergenic
1084607222 11:70179420-70179442 CACAGCGCCCAGGGCCATGCTGG - Intronic
1084754239 11:71224642-71224664 GACAGTGGCCACTGGCTTGCAGG + Intronic
1086941381 11:92801727-92801749 GACAGAGACCAAGGCCGTGGAGG - Exonic
1088378683 11:109169684-109169706 GAAAGTGACCAGGGCTTTGGGGG - Intergenic
1091220882 11:133929502-133929524 GACAGTGATGAGGTCCTTGTGGG - Intronic
1091703128 12:2677249-2677271 GGCAATGACCAGGACCTTCCTGG - Intronic
1092166899 12:6347980-6348002 GAGAGGGAGCAGGGCCTGGCTGG + Exonic
1093912895 12:24767562-24767584 TACTGTGACCAGAGGCTTGCAGG + Intergenic
1094545431 12:31400093-31400115 GACAGTGACTTGTGCCTTGAAGG + Intronic
1096801391 12:54112768-54112790 GCCAGGGACCAGGGCCTTATAGG + Intergenic
1101876024 12:108597395-108597417 GACAGGGACCTGGGCCCTGGAGG + Intronic
1102918458 12:116773440-116773462 GGCAGGGACCAGGGACTTCCTGG + Intronic
1104366969 12:128186883-128186905 GAGACTGACCAGGGCCCTGAGGG + Intergenic
1104763406 12:131311659-131311681 GCCAGTGTCCTGGGCCCTGCAGG - Intergenic
1106205621 13:27591124-27591146 GGCAGGGACCAGAGCCTTGTTGG + Intronic
1107881562 13:44836773-44836795 GCCAGAGCCCAGGGCCTTGGGGG - Intergenic
1107987079 13:45784880-45784902 TGCTGTGGCCAGGGCCTTGCAGG + Intronic
1111460470 13:88535212-88535234 GAAAGTGACCAGGTACTTGAGGG - Intergenic
1112024148 13:95397173-95397195 GACACAGAGCAGGGCCTTGGTGG - Intergenic
1115259663 14:31438315-31438337 GATAGTTACCAGGGCCTGGAGGG - Intronic
1118983237 14:70732720-70732742 GACATTGACCAGGGGGTTGTGGG + Exonic
1119460660 14:74799606-74799628 GACTCTGACCAAGGCCTTGGAGG + Exonic
1120358389 14:83462941-83462963 GACAGTGAACAGGCCTCTGCAGG + Intergenic
1121013748 14:90536069-90536091 GACCTTGACCAGAGCCATGCTGG - Exonic
1122293684 14:100693289-100693311 CCGAGTGCCCAGGGCCTTGCTGG + Intergenic
1122825745 14:104369608-104369630 GACAGTGACCAGTAACTTGCAGG - Intergenic
1124587515 15:31023368-31023390 GAGAGAGGGCAGGGCCTTGCAGG + Intronic
1124609784 15:31200554-31200576 GTCAGTGACCAGCTCCTTACTGG - Intergenic
1127739171 15:61882269-61882291 GACAGAGAGCAGAGCTTTGCTGG - Intronic
1128455861 15:67830988-67831010 GACACTCACCAAGGCCTTGGGGG + Intronic
1129026540 15:72580100-72580122 GACGGTTACCAGAGGCTTGCGGG - Intronic
1129061103 15:72861027-72861049 GGGATTGACCAGGGCCTTGGAGG + Intergenic
1129109481 15:73329248-73329270 GACAGTCACCACGCCCTTCCTGG - Intronic
1129638292 15:77346421-77346443 GACAGTGATCAGTCCCTTGGGGG + Intronic
1130316361 15:82800204-82800226 GGCAGTGAGCAGAGCCTGGCTGG - Intronic
1130672031 15:85921130-85921152 GATAATGAACTGGGCCTTGCAGG + Intergenic
1132645962 16:999410-999432 GACAGTGACCATGGCCTTGAAGG - Intergenic
1133295286 16:4748934-4748956 GCCAGTGACCACGGCCAAGCAGG - Exonic
1134025154 16:10947537-10947559 CACTGTGACCAGGACCCTGCGGG + Intronic
1134418103 16:14062007-14062029 GAGAGTGGCCAGGGCTTTGTGGG + Intergenic
1134693368 16:16205476-16205498 GACAGAGACCTTGGCCTTGAAGG - Intronic
1134978484 16:18589224-18589246 GACAGAGACCTTGGCCTTGAAGG + Intergenic
1136234660 16:28906052-28906074 GACAGTGGCCAGGGCCAGCCTGG - Exonic
1136555703 16:31006641-31006663 GACAGTTAGCAGGGCTTTTCTGG + Intronic
1137814480 16:51385525-51385547 GACAGTGACTGGGGTCTTGTAGG + Intergenic
1138432530 16:56978107-56978129 GACGGTGACTTGGGCCTGGCTGG - Exonic
1140892720 16:79298782-79298804 GACACCCAGCAGGGCCTTGCAGG + Intergenic
1140999550 16:80295668-80295690 GACAGTGACCAGCAGATTGCAGG - Intergenic
1141637157 16:85320216-85320238 GAGGGCGACCAGGGCCCTGCTGG - Intergenic
1143167525 17:4904579-4904601 GACAGTGATCATTGCTTTGCTGG - Intergenic
1143385545 17:6527944-6527966 GAAAGTGGCCTGGGCCATGCAGG - Intronic
1143780031 17:9224527-9224549 GGCAGTGACACGGGCCTGGCTGG + Intronic
1144174385 17:12690852-12690874 GACAGCTCCCAGAGCCTTGCTGG - Intronic
1145772599 17:27504434-27504456 GACAGTGAGCAGTGCCATGATGG + Intronic
1146953091 17:36920264-36920286 GACTGTGTCCACGGCCATGCAGG - Intergenic
1148071291 17:44910393-44910415 AAGAGGGACCAGGGCCTAGCAGG + Exonic
1148194320 17:45702324-45702346 CCCCCTGACCAGGGCCTTGCAGG + Intergenic
1148201170 17:45750952-45750974 GACAGTGGCAAGGGCCCAGCCGG - Intergenic
1148960101 17:51385490-51385512 GACGGTGACTCGGGCCATGCTGG - Intergenic
1149581303 17:57752198-57752220 GACAGACACCAGGGCCTGCCTGG + Intergenic
1150469029 17:65420275-65420297 GCCAGTGACCGGGACCTTTCTGG + Intergenic
1150620031 17:66801289-66801311 GGCAGTGTCCTGGGCCTTGCAGG + Intronic
1152203730 17:78962387-78962409 AGCAGCGACCTGGGCCTTGCAGG - Intergenic
1152626360 17:81389531-81389553 GACAGTGACCAGGGGGCTGGAGG + Intergenic
1152659184 17:81534595-81534617 GACAGGGACCAGCCCCTGGCTGG + Intronic
1155341565 18:24819006-24819028 GACAGTGTCCATGTCCTAGCAGG - Intergenic
1157300664 18:46476786-46476808 GCCAGTGACCAGGCTGTTGCAGG + Intergenic
1157408623 18:47445141-47445163 GAAGGTGAGCTGGGCCTTGCAGG - Intergenic
1160024151 18:75204915-75204937 GACCGTGACCTTGGCCTCGCAGG + Intronic
1160105988 18:75976609-75976631 CCCAGTGACCATGGCCTTTCAGG - Intergenic
1160630642 18:80244974-80244996 CACACTGACCTGGGCCTTACTGG - Intronic
1161029612 19:2051539-2051561 GACACGGCCCAGGGCCTCGCAGG - Intergenic
1161124936 19:2550579-2550601 GAGAGTGACCATGGCCCTGCTGG + Intronic
1161821866 19:6534629-6534651 TACAGTGACCCAGGCCTGGCAGG + Exonic
1161888843 19:7019193-7019215 GAGACTGGCCAAGGCCTTGCAGG - Intergenic
1161890525 19:7032828-7032850 GAGACTGGCCAAGGCCTTGCAGG + Exonic
1161890923 19:7037905-7037927 GAGACTGGCCAAGGCCTTGCAGG - Exonic
1161892611 19:7051556-7051578 GAGACTGGCCAAGGCCTTGCAGG + Exonic
1161893006 19:7056366-7056388 GAGACTGGCCAAGGCCTTGCAGG - Exonic
1162241090 19:9354928-9354950 CACAATGTCCAGGGCCTAGCTGG - Intronic
1163441252 19:17323703-17323725 GGCAGCGGCCAGGGCCTGGCGGG + Exonic
1163471630 19:17500641-17500663 GCCAGTCACCGGGGCCTAGCAGG - Intronic
1163545998 19:17941899-17941921 GTCCGAGACCAGGGCCCTGCAGG + Intronic
1164926604 19:32135559-32135581 GGCAGTTGCCAGGGGCTTGCTGG + Intergenic
1165991565 19:39818147-39818169 GACAGTGACCAGGGCTGGGATGG - Intergenic
1166337490 19:42117147-42117169 GAGAGTGGCCATGGCCTTGGTGG + Intronic
1167037100 19:47001035-47001057 GACAGTGCCCTGGCCTTTGCCGG + Exonic
1167437730 19:49489525-49489547 GTCAGTGGGCAGAGCCTTGCTGG + Intronic
1167724129 19:51199475-51199497 GACAGAGACCCAGGCCCTGCAGG - Intergenic
925034087 2:672769-672791 GCCTGTGACCAGGTCCCTGCAGG - Intronic
926357486 2:12054945-12054967 AACAGTGACCCGGGCCATTCTGG + Intergenic
929923789 2:46192931-46192953 GACAGGGACCTGGGACTTGATGG + Intergenic
930030892 2:47057392-47057414 TCCAGAGGCCAGGGCCTTGCTGG - Intronic
933986155 2:87593956-87593978 AGCAGAGGCCAGGGCCTTGCAGG + Intergenic
934654327 2:96109346-96109368 GACAGTGAGCAGAGCCTGGGAGG + Intergenic
934847216 2:97669597-97669619 GACAGTGACGGGGGCTATGCTGG - Intergenic
936140150 2:109932466-109932488 TACTGTGACCAGAGACTTGCAGG + Intergenic
936176839 2:110230411-110230433 TACTGTGACCAGAGACTTGCAGG + Intergenic
936204546 2:110439020-110439042 TACTGTGACCAGAGACTTGCAGG - Intronic
936307680 2:111356847-111356869 GGCAGAGGCCAGGGCCTTGCAGG - Intergenic
937906142 2:127053797-127053819 GGCAGTGACCCAGGCCTAGCTGG + Intronic
939630618 2:144523362-144523384 GACAGGCACCAGGTCCTGGCTGG - Intronic
941383562 2:164825178-164825200 AACAGTGACCAGTGGCTTACAGG - Intronic
941701567 2:168609526-168609548 GAGGGTGACCAGGCCCTTTCTGG - Intronic
946246462 2:218390590-218390612 GGCAGTGCCCAGGTCCTTGGAGG - Intronic
946249000 2:218401849-218401871 CACAGTGGGCAGGGCCTGGCAGG - Intronic
946280311 2:218661492-218661514 GTCAGTGCCCAGGGCCGTGAAGG - Exonic
947872095 2:233444881-233444903 CAGAGTGACCAGGGCCATGAAGG - Intronic
948229301 2:236337924-236337946 GACAGTGACAAAAGCCTTGTGGG - Intronic
948626958 2:239275278-239275300 GGCAGTGAGCAGCGCTTTGCCGG - Intronic
948944173 2:241211106-241211128 AGCAGTGAGCAGGGCCTTCCTGG + Intronic
1169680956 20:8213330-8213352 GGCAGTGACCAGGGTCTTCAGGG + Intronic
1170495450 20:16919731-16919753 GACATTGGCCAGGGCCATTCAGG - Intergenic
1171780452 20:29411807-29411829 CACAGGGACCAGGGCCTTGTGGG + Intergenic
1173191676 20:40881636-40881658 GACAGTGAGTAGGGCCTGGCTGG + Intergenic
1175759747 20:61553958-61553980 GACAGGGACCTGGCCCCTGCAGG - Intronic
1175865695 20:62175203-62175225 AACAGTGAGCAGGGCTTTGAAGG + Intronic
1175944549 20:62552608-62552630 GACAGGGGCCAGGGCCCAGCTGG + Intronic
1175985731 20:62763373-62763395 GAGAATGACCCGGGCCTTGGCGG - Intergenic
1178271426 21:31193414-31193436 GTCAGTGCCCAGGGCTTTTCTGG - Intronic
1179635620 21:42706799-42706821 GACAGAGAACAGGGCCTGCCAGG - Intronic
1179719276 21:43306234-43306256 GACAGGGACCCGGGCACTGCAGG - Intergenic
1180009532 21:45040463-45040485 GACAGTGCCCAGGGACAGGCGGG - Intergenic
1180693948 22:17739972-17739994 GAGATTCTCCAGGGCCTTGCCGG - Intronic
1184334988 22:43847756-43847778 GACAGTGTCCAGGGCTCTGTGGG - Intronic
1184451288 22:44584234-44584256 GACACTGAGCAGAGACTTGCAGG - Intergenic
1184518301 22:44976847-44976869 GAAAGTGGCCAGGGCCGGGCGGG + Intronic
1184604113 22:45562548-45562570 GACAGTGGCCAGGGCTACGCAGG - Intronic
1184693333 22:46127289-46127311 GACAGTGGCCAGGGCTGTGCTGG - Intergenic
1184871139 22:47239196-47239218 GAGAGTGGCCAGAGTCTTGCTGG + Intergenic
1185318057 22:50187221-50187243 GACTGTGACCAGGTCCTGGGAGG + Intronic
949166960 3:954414-954436 GAAGCTGCCCAGGGCCTTGCTGG - Intergenic
950134440 3:10570843-10570865 GGCAGTGAGGAGGGCCTTTCAGG - Intronic
954124250 3:48519334-48519356 GAGAGTCACCAGGTCCATGCTGG + Exonic
955746159 3:62142346-62142368 GAGAGTGACAAGGGGCTGGCTGG + Intronic
957084627 3:75668704-75668726 CACAGGGACCAGGGCCTTGTGGG - Intergenic
957665310 3:83218406-83218428 GACAGTGTCCAGGGCTTTTAGGG + Intergenic
959919656 3:111856989-111857011 GACATTGAACAGGGTCTTGAAGG + Intronic
960135021 3:114096138-114096160 GACAGTGACTATAGCCTTTCTGG + Intergenic
962245837 3:133791455-133791477 GACAGAGACCAGAGTCTGGCTGG - Intronic
962957458 3:140279317-140279339 GACAGTGTCCAAGTCCATGCTGG + Intronic
965653367 3:170956934-170956956 GACAGTTACCAGGGGCTTTAGGG - Intergenic
967147066 3:186615488-186615510 GACAATGACCAGGGCTTGTCTGG - Intronic
969675042 4:8609958-8609980 GACAGTGTTCAAGGCCCTGCAGG + Intronic
972319540 4:37960613-37960635 GACAGTGCCCAAAGCCTTTCTGG - Exonic
975723137 4:77267531-77267553 TACAGCGACCATGGCCTGGCAGG - Intronic
975734739 4:77370366-77370388 GACACTTGCCAGGGCATTGCTGG - Intronic
982028634 4:151277164-151277186 GACAGAGACATGGGCCCTGCTGG + Exonic
985446345 4:190022869-190022891 CACAGGGACCAGGGCCTTGTGGG + Intergenic
986233242 5:5885745-5885767 GACAGTGACCAGGGCCTTGGTGG + Intergenic
987269814 5:16295125-16295147 AACAGTGACCAGCACCTTGGAGG + Intergenic
987338982 5:16922611-16922633 GACGGTGACCATGGACCTGCTGG - Intronic
988864289 5:35317706-35317728 GACAATGGACAGGGCCTGGCAGG + Intergenic
990330169 5:54718014-54718036 GACGGTTACCAGGGGCTGGCGGG + Intergenic
991270160 5:64769557-64769579 TACAGTGCCCAGTGCCTCGCAGG - Intronic
991295014 5:65071345-65071367 GACAGTGCCCATAGCGTTGCAGG + Intergenic
992636025 5:78726719-78726741 GACTTTGACCAGGGCCTGGTGGG + Intronic
995452573 5:112318622-112318644 GACAGTGAGCAAGGCTTGGCTGG - Intronic
996404378 5:123090932-123090954 GACAGTGCCCGGGGCCAGGCGGG + Intronic
999318881 5:150601208-150601230 GAAAGAGAACAGGGCCTTCCAGG + Intronic
1001784096 5:174396820-174396842 GTAACTGACCAGGGCCTTGAAGG + Intergenic
1002830764 6:818435-818457 TACAGGGAACAGGGCCTGGCTGG - Intergenic
1006192755 6:32219763-32219785 CACAGGGACTTGGGCCTTGCTGG + Exonic
1006301625 6:33196465-33196487 AAGAGTGACCAGGGCGTTGAGGG - Exonic
1006409980 6:33867617-33867639 CACAGGGACCAGGACCTTTCCGG - Intergenic
1007243205 6:40441965-40441987 TCCAGTCACCAGGGCCTTGCCGG + Intronic
1008055551 6:46942094-46942116 GACCTTGACCTGGGCCTTGAAGG - Intronic
1013354415 6:109334782-109334804 GACAGTGCCCTGGGCCTTCCAGG + Intergenic
1017009885 6:150056281-150056303 GAAAGAGAGCAGGGCCGTGCTGG - Intergenic
1018248465 6:161844433-161844455 GACCCTGACCATGGCCTTTCAGG - Intronic
1018380689 6:163255551-163255573 GAAAGAGACCTGGGCCTTGGGGG + Intronic
1021279798 7:18703773-18703795 GACACTGCCCAGGGCCCTGGGGG - Intronic
1023848249 7:44135457-44135479 CACAGTGAGCAGGGCCCTGCAGG + Intergenic
1024563643 7:50664411-50664433 GACAGTCACCAGGCCGTGGCGGG + Intronic
1024586980 7:50850261-50850283 GACTGTGACCTGGGCTTTGAAGG - Intergenic
1024608566 7:51043452-51043474 TGCAGTGACCAGGACCTCGCTGG - Exonic
1029113103 7:98223362-98223384 GACAGAGAACGGGGCCTGGCTGG - Intronic
1029220186 7:98982650-98982672 GATTGTGGCCAGGGCCTTCCAGG + Intronic
1029226775 7:99034196-99034218 CAGAGTGGCCAGGGCCCTGCAGG - Intronic
1030818223 7:114063196-114063218 ATCAGTGTCCAGAGCCTTGCAGG - Intronic
1031080661 7:117253970-117253992 GTCAGTTACCAGGGCTGTGCAGG - Intergenic
1033167716 7:139055266-139055288 GACACTGACGAGGTCTTTGCTGG + Exonic
1033216307 7:139495963-139495985 GACACGCACCAGGGCCTGGCTGG - Intergenic
1033596739 7:142864456-142864478 GACAGCGACCAGGGCCAGGCAGG - Exonic
1034057138 7:148047268-148047290 TACTGTGACCAGAGGCTTGCAGG - Intronic
1035112171 7:156492284-156492306 GACAGTGAGCAGGGCTGTGAAGG - Intergenic
1035766840 8:2113282-2113304 GACATTGAGCAGGGTCTTGACGG - Intronic
1036233749 8:7020928-7020950 GACAGTGACCAGGTTTCTGCAGG - Intergenic
1037068217 8:14610072-14610094 GTCAATGACCTGGGCCCTGCTGG + Intronic
1040415974 8:47196434-47196456 GACAGAGTGCAGGGCCTGGCTGG + Intergenic
1041434218 8:57819819-57819841 GGCTGGGCCCAGGGCCTTGCTGG - Intergenic
1043656616 8:82674863-82674885 GACTGTGCACATGGCCTTGCTGG - Intergenic
1045966324 8:108028895-108028917 CACATTGTACAGGGCCTTGCAGG + Intronic
1046595754 8:116259428-116259450 CAGAGTGACTAGGGCCTTCCTGG + Intergenic
1048570393 8:135649883-135649905 GATAGTGATCTGGGCCTTTCTGG - Intronic
1049566876 8:143344852-143344874 GACAGTGAACAAGGCCAGGCAGG + Intronic
1049913482 9:293560-293582 GACACTGACCAGGGACTCGTGGG + Intronic
1052744411 9:32426057-32426079 GACAGGGCCCAGGGCCTTGGCGG + Intronic
1053025132 9:34723273-34723295 GACAGTGACGAGGGCAGTGGCGG + Exonic
1053069848 9:35094852-35094874 GAAAGAGGCCAGGGCCCTGCTGG - Intronic
1053069862 9:35094906-35094928 GAAAGAGGCCAGGGCCCTGCTGG - Intronic
1055552704 9:77446031-77446053 TCCAGTGACCAGGGCCCTGCTGG + Intronic
1056492604 9:87122229-87122251 GACATGGACAAGGGCTTTGCAGG - Intergenic
1057176650 9:93005022-93005044 AGCAGTCTCCAGGGCCTTGCAGG - Intronic
1057871522 9:98721778-98721800 GAAAGTGCTCAGGGCCCTGCAGG - Intergenic
1058575534 9:106396881-106396903 GACAGTTAAGAGGTCCTTGCAGG + Intergenic
1059337221 9:113576700-113576722 GACAGAGCCCAGGGTCTTCCAGG + Intronic
1060145439 9:121248656-121248678 GACATTGAACTGGGCCTTGAAGG + Intronic
1060342516 9:122789735-122789757 GTCAGTGTCCAGGGCATAGCTGG - Exonic
1061204575 9:129155558-129155580 GACACAGCCCAGGGCTTTGCTGG + Intergenic
1061487973 9:130929873-130929895 CACAGTGACCAGGGCGCTGTTGG + Exonic
1061571837 9:131482582-131482604 CACAGTGGCCAGGGCCTGGGTGG + Intronic
1061886539 9:133593814-133593836 GACACTGCCCAGGGGCTGGCAGG + Intergenic
1062024322 9:134333309-134333331 GACTGTGACCAAGGGCTTCCCGG - Intronic
1062273336 9:135719661-135719683 GCCAGTGGGCAGGGCCTTCCTGG - Intronic
1062285988 9:135772716-135772738 GACAGTGGCCATGGACCTGCAGG + Exonic
1189559805 X:42180649-42180671 CATTGTGACCAGGGACTTGCAGG + Intergenic
1190327638 X:49216405-49216427 GACAGTGAACAGGGCCATCATGG + Exonic
1190660864 X:52653292-52653314 GACAAGGACCAGGGTCTTGGGGG - Intronic
1190898323 X:54642753-54642775 AACAGTGACAAGGGCTATGCAGG - Intergenic
1191717633 X:64204506-64204528 GACAATGACAGGGGCCTGGCGGG + Intronic
1197918419 X:131561396-131561418 AACAGTGATAAGGGCCATGCAGG + Intergenic
1198507960 X:137319870-137319892 GACAGAGACCAGGGCCTGTAGGG - Intergenic
1201226889 Y:11827088-11827110 TCCCATGACCAGGGCCTTGCTGG - Intergenic