ID: 1077445393

View in Genome Browser
Species Human (GRCh38)
Location 11:2588296-2588318
Sequence CTGGGGGAACATTCCAGCAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 184
Summary {0: 1, 1: 1, 2: 0, 3: 18, 4: 164}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077445393_1077445399 8 Left 1077445393 11:2588296-2588318 CCTGTGCTGGAATGTTCCCCCAG 0: 1
1: 1
2: 0
3: 18
4: 164
Right 1077445399 11:2588327-2588349 ACAGCCTGCTCCCTCACTTCAGG 0: 1
1: 0
2: 0
3: 24
4: 246
1077445393_1077445403 30 Left 1077445393 11:2588296-2588318 CCTGTGCTGGAATGTTCCCCCAG 0: 1
1: 1
2: 0
3: 18
4: 164
Right 1077445403 11:2588349-2588371 GCGCCCTCTTCATGCCCTGCTGG 0: 1
1: 0
2: 0
3: 17
4: 150

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077445393 Original CRISPR CTGGGGGAACATTCCAGCAC AGG (reversed) Intronic
901110987 1:6795278-6795300 CAGGAGGATCATTTCAGCACAGG - Intronic
901239817 1:7686405-7686427 TGGGGGGAATATTCCAGGACAGG + Intronic
901862795 1:12085650-12085672 GTGGGGGAACATTCCAGAAAGGG - Intronic
903667319 1:25015978-25016000 CTGTGGGAACAGTCCAGAACAGG - Intergenic
903678630 1:25082593-25082615 CTGGGGGCTCCTTCCAGCAGTGG - Intergenic
903849261 1:26296465-26296487 GTGGGGAAACATTTCAGCAGAGG + Intronic
904310274 1:29624905-29624927 CTGGAGGCACAGTCCAGCTCAGG + Intergenic
907609341 1:55852146-55852168 CTGGGGGAACATGCCGACTCAGG + Intergenic
909985258 1:82153989-82154011 TTGGAGGAAGATTCCAGCAATGG - Intergenic
910066446 1:83158261-83158283 CTGCTGGTACAGTCCAGCACTGG + Intergenic
911060005 1:93739562-93739584 CTGTGGGATCCTTCCAGCTCAGG - Intronic
911803980 1:102181572-102181594 CTTGGGAAAAATTCCAACACCGG - Intergenic
914348995 1:146823400-146823422 CTGGGGGCACATTTCCTCACTGG - Intergenic
915842386 1:159224938-159224960 CTAGAGGATCATTCCAGCAGTGG + Intergenic
915955024 1:160213994-160214016 CTCAGGAAACAGTCCAGCACAGG - Exonic
917151493 1:171950100-171950122 CTGGGGGAACATTCATACAATGG + Intronic
922355321 1:224769623-224769645 CTGGAGCAACCCTCCAGCACTGG + Intergenic
924910856 1:248511755-248511777 CAGAGTGAACATTCCAGCACAGG + Intergenic
924913245 1:248536285-248536307 CAGAGTGAACATTCCAGCACAGG - Intergenic
1062976640 10:1688441-1688463 CTGGGGGAATATGGCAGCTCAGG - Intronic
1063381341 10:5588095-5588117 ATGCAGGAACAGTCCAGCACTGG - Intergenic
1066351836 10:34642962-34642984 ATGGGGGAGCATTTCAGCAAAGG - Intronic
1067419772 10:46135162-46135184 CTGGGGGAACATTCCCGGCAGGG + Intergenic
1067426246 10:46214249-46214271 CTGGGGGAACATTCCCGGCAGGG - Intergenic
1067505123 10:46841759-46841781 CTGGGGGAACATTCCTGGCAGGG + Intergenic
1067679882 10:48426762-48426784 CTGGGGGAACATCCTAACTCAGG + Intronic
1068855036 10:61788937-61788959 CAGGAGGAACACTCCAGCACAGG + Intergenic
1070325946 10:75389225-75389247 CTGGAGGAATCTTCCAGCAACGG + Intergenic
1070775672 10:79108440-79108462 CTGGGAGAAGCTTTCAGCACTGG + Intronic
1074554116 10:114472501-114472523 ATGGGGCAACAGTCTAGCACAGG - Intronic
1076374870 10:129976566-129976588 CTGGCGGAACAGCCCAGCATGGG + Intergenic
1077109641 11:856454-856476 CTGGGGGAACAGCCCAGGAGAGG - Intronic
1077445393 11:2588296-2588318 CTGGGGGAACATTCCAGCACAGG - Intronic
1081746732 11:45478385-45478407 CTGGTGGAAAATTCCAGCAAAGG - Intergenic
1089198620 11:116710218-116710240 CTGGGGGAAGTTTGCAGCATCGG - Intergenic
1092459789 12:8676299-8676321 CTGGGGGATCACTCAAGCTCAGG - Intergenic
1092535154 12:9379997-9380019 CAAGGAGAACATTCCAGGACAGG + Intergenic
1095572396 12:43698319-43698341 CTGGGCAAAAATTCCAGCATAGG - Intergenic
1096711991 12:53464386-53464408 CTGTGGGAACAATCCATGACAGG - Intronic
1098652082 12:72984893-72984915 TTGGGGCAATATTACAGCACAGG + Intergenic
1099269129 12:80485464-80485486 GTGGGGGAAAATAACAGCACAGG - Intronic
1103727796 12:123007380-123007402 CTGAATGAACATTCCAGAACAGG + Intronic
1103916567 12:124378794-124378816 CTGGGGGAACAGGCCAGCCTGGG + Intronic
1106756397 13:32826848-32826870 CTGGGGAAACATCCCATAACTGG + Intergenic
1106932626 13:34683224-34683246 CTGGGAAAACATTCCAGCTGAGG + Intergenic
1107458810 13:40580706-40580728 CTTAAGGAACATGCCAGCACTGG - Intronic
1113398915 13:109973801-109973823 CAGTGGGGACATTCCTGCACAGG - Intergenic
1117942646 14:60984971-60984993 GTGGGGGAATATCCAAGCACAGG + Intronic
1120827514 14:88969075-88969097 GTGGGAGAACATTCCAGAAGGGG - Intergenic
1122774073 14:104109526-104109548 CTGAGCGAACAGTCCAGCAAGGG + Intronic
1123951519 15:25282342-25282364 CTGTGGGCTCATTCCAGAACTGG - Intergenic
1125578692 15:40771147-40771169 CTGGGGGAGGATTCCAGGATAGG + Exonic
1125885285 15:43224999-43225021 CTGGGGGATCACTTGAGCACCGG - Intergenic
1126834484 15:52645952-52645974 CTGGGGGAAAAAAACAGCACTGG - Intronic
1128298350 15:66544565-66544587 CAGGGGGAATATTTCAGCTCAGG - Intronic
1129857635 15:78836140-78836162 CTGGGCGCACAGTCCAGTACTGG - Intronic
1132396115 15:101475716-101475738 CTGGAGGATCATTTCAGCCCAGG - Intronic
1132534551 16:471589-471611 CTGGGGGAGGATTCCTGCCCAGG - Intronic
1132767804 16:1543368-1543390 CTCAGGGCACTTTCCAGCACAGG - Intronic
1133488874 16:6247905-6247927 ATGGCAGAACATTCCAACACTGG + Intronic
1136317873 16:29464843-29464865 CTGGAGGATCATTTCAGCCCAGG + Exonic
1136432448 16:30204188-30204210 CTGGAGGATCATTTCAGCCCAGG + Exonic
1139189849 16:64849540-64849562 CTGGGGGAACACAACATCACTGG - Intergenic
1139985038 16:70892155-70892177 CTGGGGGCACATTTCCTCACTGG + Intronic
1140136419 16:72209931-72209953 CTGGGGGAACGGCCCAGCAGTGG - Intergenic
1142031091 16:87838967-87838989 CTGGGGGGACTTCCCAGGACAGG + Intronic
1143096529 17:4481252-4481274 CTGGGGGTGGAATCCAGCACTGG + Intronic
1143526570 17:7476556-7476578 CTGGCAGAACAAGCCAGCACAGG - Intronic
1143621726 17:8084678-8084700 CTGGGGGAAGATTCCAGCACAGG + Intronic
1144268436 17:13594130-13594152 TTGGGGGAAGATTACCGCACAGG + Intronic
1147155889 17:38544333-38544355 CTGGGTGCACATGCCAGCAAGGG + Intronic
1149918781 17:60636766-60636788 CTGGGGGAACACTTGAGCCCAGG - Intronic
1150278243 17:63913536-63913558 GTGGGGGAAGATTTCACCACTGG - Intronic
1150300333 17:64042527-64042549 TTGGGGGATCATTGCAGCTCAGG - Exonic
1151808640 17:76422637-76422659 CTGGGGGAACATTTGAGCCATGG - Intronic
1152625757 17:81387246-81387268 CTGGGAGAAGCCTCCAGCACGGG + Intergenic
1153797746 18:8640430-8640452 CTGAGGGTACAGTCCAGCAGGGG - Intergenic
1156924867 18:42563961-42563983 CTGGCAGAACATTTAAGCACAGG + Intergenic
1157356510 18:46940140-46940162 ATGGGGCAAGATTCCAGCCCTGG + Intronic
1159783648 18:72689069-72689091 CTGGGAGAATTTTCCAGCCCTGG - Intergenic
1162498770 19:11038991-11039013 CGGGGGGATCATTTCAGCTCAGG + Intronic
1163276997 19:16291095-16291117 CTGGGGGAACAGAACAGCAATGG - Intergenic
1163736524 19:18984637-18984659 CTGGAGGATCATTTCAGCCCAGG + Intergenic
1163744747 19:19038980-19039002 CGGGGGGATCACTCAAGCACAGG - Intronic
1163820893 19:19496064-19496086 ATTAGGCAACATTCCAGCACAGG + Exonic
1164021523 19:21311475-21311497 TGGGGGGAATATTCCAGCAGTGG - Intronic
1164624430 19:29716722-29716744 CTGGCGGCACATTGCAGAACTGG + Intergenic
1166361575 19:42254846-42254868 CTGGGGGACCCCTCAAGCACTGG - Intronic
1167123195 19:47531411-47531433 CTGGGGCAACAATCAAGCGCAGG - Intronic
1167208668 19:48119363-48119385 CTGGGAGAACATTCCCACCCGGG - Intronic
925365413 2:3308044-3308066 CAGGAAGAACATTCCAGCGCTGG + Intronic
925809200 2:7682226-7682248 CTCTGGGAAAATTACAGCACTGG + Intergenic
925899325 2:8497039-8497061 GTTGGGGAACAGTCCAACACTGG - Intergenic
929020578 2:37548482-37548504 CTGGGAGAACCTGCCAGAACTGG - Intergenic
931045367 2:58345518-58345540 CTGGAGGATCATTTGAGCACAGG + Intergenic
932597287 2:73101884-73101906 CTTGGGGAACATTGGAGCAGAGG - Intronic
933209047 2:79544816-79544838 CTGGGTGAACTTCCCAGCTCAGG + Intronic
933756224 2:85640698-85640720 CAGGGGGATCATTTCAGCACAGG - Intronic
936072237 2:109378856-109378878 ATGAGGGAACTATCCAGCACTGG - Intronic
937011006 2:118562731-118562753 CTGGGAGAATATTCCAGAAATGG + Intergenic
943949974 2:194121066-194121088 CTGGGGGAACTTTCCTCCACTGG - Intergenic
945036923 2:205711846-205711868 CTTGGTGAATCTTCCAGCACAGG + Intronic
947461113 2:230305915-230305937 CTGGGGGAAACCTCCAGGACCGG - Intronic
1169275268 20:4229564-4229586 GGGGAGGAACATTCCAGCAGAGG + Intronic
1171250145 20:23640370-23640392 CTGGAGTCACATTCCAGCCCAGG - Intergenic
1171256247 20:23690901-23690923 CTGGAGACACATTCCAGCCCAGG - Intergenic
1171263600 20:23752811-23752833 CTGGAGTCACATTCCAGCCCAGG - Intergenic
1171272645 20:23828580-23828602 CTGGAGCCACATTCCAGCACAGG - Intergenic
1171284186 20:23924097-23924119 CTGGAGTCACATTCCAGCCCAGG - Intergenic
1176247634 20:64104955-64104977 CAGGGGGAACACAGCAGCACAGG + Intergenic
1176923267 21:14715674-14715696 CTTGGGCAACATTCCGCCACAGG - Intergenic
1179471856 21:41615799-41615821 CTGGGGGAACATTCTTATACTGG + Intergenic
1179586673 21:42377816-42377838 ATGGGAGAAGATTCCAGGACAGG + Intronic
952009810 3:28887482-28887504 CTTTGGGAAAATACCAGCACTGG - Intergenic
952284201 3:31952691-31952713 TTGGGGGGACATTCTAACACAGG - Intronic
958133281 3:89457153-89457175 CTGGGGGAACACTACAGAAAAGG + Intronic
960498451 3:118405863-118405885 CTTGGGGAAGATTCCATCATAGG + Intergenic
961041834 3:123683301-123683323 GTGGGGGGACTTTCCAGCAGAGG + Intronic
961509271 3:127391147-127391169 CTGCGGGAAGCTCCCAGCACAGG + Intergenic
961825256 3:129595886-129595908 CTGGGGGCACCTTACAGCCCTGG + Intronic
962379188 3:134883467-134883489 CTTGGGGAAGATTCGAGAACTGG + Intronic
966463783 3:180205849-180205871 TTGGGGGAACCTTACAGGACGGG + Intergenic
967578634 3:191125552-191125574 CTGGCGGATCATTCCAGGTCAGG + Intergenic
967721352 3:192819706-192819728 CTTGGGGACCACTCCAGCAGTGG - Intronic
968051167 3:195656039-195656061 CTTGGGGGACATTTCAGCAGTGG - Intergenic
968104657 3:195992299-195992321 CTTGGGGGACATTTCAGCAGTGG + Intergenic
968302947 3:197629882-197629904 CTTGGGGGACATTTCAGCAGTGG + Intergenic
969260870 4:6032594-6032616 CTGTGGCAATATTCCAGCCCAGG - Intronic
969469826 4:7381283-7381305 CTGAGAGAGCATTCCAGCACAGG + Intronic
969966315 4:11000446-11000468 CTGGGGGCACATTCCCCCCCTGG + Intergenic
971297154 4:25406037-25406059 CTGGAAGAAGATTCCATCACTGG - Intronic
972168984 4:36321953-36321975 ATGGAAGAACATTCCAGCAAGGG - Intronic
978373619 4:108052724-108052746 CCTGGGGAACAGCCCAGCACTGG - Intronic
982786750 4:159545235-159545257 CTGTGGCCCCATTCCAGCACAGG - Intergenic
983528487 4:168784980-168785002 TTGTGGGTACATTCCAGCCCAGG + Intronic
984944496 4:184960548-184960570 CTGGGGGCAGAGTCCAGCATTGG + Intergenic
986799748 5:11246800-11246822 TGGAGGGAACATTCCAGAACAGG + Intronic
989254940 5:39356319-39356341 TTGGGGGAAAAAGCCAGCACAGG - Intronic
993792251 5:92222725-92222747 CTGTGGTAACATTCCTGCCCCGG + Intergenic
996644020 5:125793119-125793141 CTGGGGAAACCTTCCTGCCCAGG - Intergenic
997513203 5:134466829-134466851 GTGGGGCGACAATCCAGCACCGG - Intergenic
999082237 5:148855450-148855472 CTGGATTAAAATTCCAGCACTGG + Intergenic
999147896 5:149407819-149407841 CTGGGGGAACTTCCCAACACTGG - Intergenic
999762647 5:154714474-154714496 ATGGGGCCACATTCCAGGACTGG - Intronic
1001004532 5:168038782-168038804 CTGGGGGAACAGGCCAGGAGGGG - Intronic
1001004556 5:168038864-168038886 CTGGGGGAACATGCCAGGAGGGG - Intronic
1001048940 5:168398834-168398856 CTGGGCCCACATTCCAGCATGGG - Intronic
1005813229 6:29531642-29531664 GTGTGGGAACAGTCCAGCCCTGG + Intergenic
1005835468 6:29705546-29705568 CTGGGCCAAAATTCCATCACAGG - Intergenic
1006587742 6:35128614-35128636 CTGAGTGAACATACCAGAACCGG - Intronic
1007725328 6:43912643-43912665 CTGGGTCAAGAGTCCAGCACTGG - Intergenic
1008097427 6:47353128-47353150 CTGTTGGAACTTTCCAGCACTGG - Intergenic
1008562322 6:52735208-52735230 CGGGAGGAAGAATCCAGCACGGG - Intergenic
1012965575 6:105669454-105669476 CTGGGGCAAGATTTCAGCCCTGG + Intergenic
1014375717 6:120670717-120670739 CTGGGGGCTCATTTCAGCTCAGG - Intergenic
1015686343 6:135867027-135867049 GTGGGGGATCTTTCGAGCACAGG + Intronic
1019999835 7:4749450-4749472 CTGGGGGAACCTCCCTGCAGAGG - Intronic
1020097347 7:5376442-5376464 CTGTGGGAACATCCCACCCCGGG - Intronic
1022096549 7:27144969-27144991 CGGGTGGAACATTACAGCCCGGG - Intronic
1022274369 7:28841342-28841364 CTGGGAGAACAATGCAGCAGTGG + Intergenic
1024261068 7:47574063-47574085 CTGAGGGAACGGTCCAGAACTGG - Intronic
1029856707 7:103524853-103524875 CTGGGGGAACATGCCAAAGCTGG - Intronic
1030369244 7:108678414-108678436 CTGGGGTAAGATTCCAGCCTGGG + Intergenic
1032431817 7:131868266-131868288 GTAGGGGAAAATTCCAGCCCTGG + Intergenic
1035521232 8:276236-276258 CTGGGGGAATTTTGCAGCAAAGG - Intergenic
1036174823 8:6527383-6527405 CTTGGAGAAAATTCCTGCACAGG - Intronic
1036217888 8:6896116-6896138 CTGTGCGAACATGCCAGGACAGG - Intergenic
1038706757 8:29901468-29901490 CTGGGGAAACATTTCAGCTCTGG - Intergenic
1048062518 8:130935177-130935199 CTGGATTACCATTCCAGCACAGG - Intronic
1049553683 8:143272057-143272079 CTGGGTAAACCTTCCAGAACCGG - Intronic
1053208262 9:36206262-36206284 TTGTGGGAACCTTGCAGCACAGG + Intronic
1057262710 9:93594358-93594380 CTTTGGGAACATTCCAGGTCGGG + Intronic
1061354873 9:130097032-130097054 TTGGAGGTACATGCCAGCACTGG - Intronic
1185629880 X:1508079-1508101 TTGGGGGAAAAATCCAGCAATGG + Intronic
1187187014 X:16996414-16996436 CTGGGAGAACAGTCAAGAACAGG + Intronic
1187839868 X:23476330-23476352 CTGGGAGAACCTCCCAGCAGGGG - Intergenic
1188174731 X:26975434-26975456 CTGTGGGTACTTTCCAGCATGGG + Intergenic
1190846616 X:54198393-54198415 CTGGGGGACCATTCCAGCCAGGG - Exonic
1195640430 X:107168886-107168908 CTGAGGGAACATTCCTGCTGAGG + Intronic
1196458417 X:115905996-115906018 ATGGTGGACCATCCCAGCACTGG + Intergenic
1201706065 Y:16938416-16938438 CAGGGGGATCACTTCAGCACAGG - Intergenic
1202245038 Y:22811411-22811433 CTGGTGGAACATTCCAGGAATGG - Intergenic
1202398028 Y:24445157-24445179 CTGGTGGAACATTCCAGGAATGG - Intergenic
1202472753 Y:25224930-25224952 CTGGTGGAACATTCCAGGAATGG + Intergenic