ID: 1077447779

View in Genome Browser
Species Human (GRCh38)
Location 11:2607424-2607446
Sequence GAGGTGAGGCCTTTGGGAAG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 695
Summary {0: 1, 1: 0, 2: 36, 3: 125, 4: 533}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077447775_1077447779 -7 Left 1077447775 11:2607408-2607430 CCAATGTTGGTATTAGGAGGTGA 0: 1
1: 0
2: 1
3: 17
4: 107
Right 1077447779 11:2607424-2607446 GAGGTGAGGCCTTTGGGAAGTGG 0: 1
1: 0
2: 36
3: 125
4: 533
1077447767_1077447779 24 Left 1077447767 11:2607377-2607399 CCTCAAAATGTATATGTTGAAAT 0: 11
1: 96
2: 640
3: 1769
4: 3840
Right 1077447779 11:2607424-2607446 GAGGTGAGGCCTTTGGGAAGTGG 0: 1
1: 0
2: 36
3: 125
4: 533
1077447773_1077447779 -5 Left 1077447773 11:2607406-2607428 CCCCAATGTTGGTATTAGGAGGT 0: 1
1: 1
2: 18
3: 156
4: 884
Right 1077447779 11:2607424-2607446 GAGGTGAGGCCTTTGGGAAGTGG 0: 1
1: 0
2: 36
3: 125
4: 533
1077447774_1077447779 -6 Left 1077447774 11:2607407-2607429 CCCAATGTTGGTATTAGGAGGTG 0: 1
1: 1
2: 15
3: 60
4: 229
Right 1077447779 11:2607424-2607446 GAGGTGAGGCCTTTGGGAAGTGG 0: 1
1: 0
2: 36
3: 125
4: 533
1077447769_1077447779 1 Left 1077447769 11:2607400-2607422 CCTAACCCCCAATGTTGGTATTA 0: 1
1: 0
2: 0
3: 15
4: 150
Right 1077447779 11:2607424-2607446 GAGGTGAGGCCTTTGGGAAGTGG 0: 1
1: 0
2: 36
3: 125
4: 533
1077447771_1077447779 -4 Left 1077447771 11:2607405-2607427 CCCCCAATGTTGGTATTAGGAGG 0: 1
1: 0
2: 1
3: 35
4: 244
Right 1077447779 11:2607424-2607446 GAGGTGAGGCCTTTGGGAAGTGG 0: 1
1: 0
2: 36
3: 125
4: 533

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077447779 Original CRISPR GAGGTGAGGCCTTTGGGAAG TGG Intronic
900631301 1:3637089-3637111 AAGGTGATTCCTGTGGGAAGAGG + Exonic
901062486 1:6478477-6478499 GAGGTGAGGCCTCTGTAAAATGG - Intronic
902571962 1:17352681-17352703 GAGGGGAGGACTGTGGGAGGAGG + Intronic
903446712 1:23426992-23427014 GAGGTGAGGAGTGTGGGGAGAGG + Intergenic
904407220 1:30300193-30300215 CAGCTGAGGGCTTTAGGAAGGGG + Intergenic
904678239 1:32211707-32211729 GAGTTGGGGCCTTTGGTTAGGGG - Intronic
904942121 1:34171184-34171206 GAGCTGAGGGATTTGGGAATAGG - Intronic
905141471 1:35848586-35848608 GAGGTGATGCCTTGGAGAAAAGG - Intronic
905424258 1:37870508-37870530 GAGGTAGGGCCTTTGGGAGATGG + Intronic
906225625 1:44119046-44119068 GAGGGGAGGCCTTGGAGGAGAGG + Intronic
906257392 1:44360653-44360675 GAGGCGAGGACATTGGGAATTGG - Intergenic
906560264 1:46751461-46751483 AAGGTGGGGCCTTTGGGGAGGGG - Intergenic
907041941 1:51269187-51269209 AAGGTGAGGGCTTGGGGATGGGG + Intronic
908038431 1:60081376-60081398 GAGATGGGACCTTTGGGAGGAGG + Intergenic
908547732 1:65178480-65178502 GAGGTGTTCCCTTTGGGAAGAGG - Intronic
908727162 1:67188847-67188869 GAGGTGGGGCCTTTAGAAAGTGG - Intronic
909076091 1:71052399-71052421 GAGGTGACGCCTTTAAGAGGTGG + Intergenic
909187244 1:72503332-72503354 GAGATGGGGCCTTTAGGAAGTGG - Intergenic
909657437 1:78046557-78046579 GAGATCTGGCCTTTGGGAAGCGG + Intronic
911136016 1:94441415-94441437 GAGGTGCAGCCTTTGTGGAGGGG + Intronic
911669366 1:100591159-100591181 GAGGTGGGGCCTTTATGAAGTGG - Intergenic
911880756 1:103235922-103235944 GAGATGAGGAACTTGGGAAGTGG + Intergenic
913485315 1:119328062-119328084 AAGGTGAGGCCTGCGGGTAGGGG - Intergenic
913503356 1:119492286-119492308 GAGCTGAGGACTTTAGAAAGAGG - Intergenic
914458661 1:147861502-147861524 GAGATGAGGCCAGTGGGCAGTGG - Intergenic
915109238 1:153552609-153552631 GAGGTGAGGCCTGAGGGGTGGGG + Intergenic
915560405 1:156683763-156683785 GTGGTTAAGCCTTGGGGAAGGGG + Intergenic
916340199 1:163724985-163725007 GAGAAAAGGCCTTTAGGAAGAGG + Intergenic
916891047 1:169112741-169112763 GAGCTGAGGGATTGGGGAAGTGG + Intronic
916961952 1:169897350-169897372 GAGGTGAGGACACTGGGAAGAGG - Intergenic
917615870 1:176743580-176743602 GTGTTGATGGCTTTGGGAAGTGG + Intronic
918190706 1:182171444-182171466 AAGGAGGGGCCTTTGGGCAGAGG - Intergenic
918507929 1:185278244-185278266 AAGATGGGGCCTTTGGGAATTGG + Intronic
918732516 1:188015821-188015843 GAGGTGGAGACTTTGGGAGGTGG - Intergenic
919410611 1:197237460-197237482 GAGGTGGGGCCCTTGTGAATGGG - Intergenic
919743914 1:200996729-200996751 GAGCTGGGGCCTGTGGGAAGGGG + Intronic
919989803 1:202702022-202702044 GAGGTGAGGCAATGGGGAAGGGG - Intronic
920074349 1:203325766-203325788 GAGCTAAGTCCCTTGGGAAGGGG + Intergenic
921727334 1:218538363-218538385 GAGATGGGGCCTTTGGGAGGTGG + Intergenic
922025678 1:221746425-221746447 GAGATGAGGCCTTTTGGAGGTGG + Intergenic
922077960 1:222266595-222266617 GAGGTGAGCACTTCAGGAAGAGG - Intergenic
922708480 1:227806792-227806814 GAGGTGGGGCCTTTGGGAGATGG + Intergenic
922717087 1:227883364-227883386 GAGGTGGGGCCAAGGGGAAGGGG + Intergenic
922743469 1:228029793-228029815 AAGGTGGGGCCTTTGGGAGGTGG + Intronic
922972657 1:229755944-229755966 GAGGTGGGACCTTTGGGAGGTGG - Intergenic
923036546 1:230288546-230288568 GAGGTGGGGTCTTAGGGAGGTGG + Intergenic
923964012 1:239116166-239116188 GAGGTGGGGCCTGGTGGAAGCGG + Intergenic
924485728 1:244481678-244481700 AAGGTCACGCCTTTGGGAAGTGG + Intronic
1063544209 10:6964107-6964129 GAGGTGGGGCCTCTGGGATGTGG + Intergenic
1063945443 10:11171642-11171664 GAGGGTAGGCCCTGGGGAAGAGG + Intronic
1064713792 10:18154410-18154432 GAGATGAGGCCTCTGGGAGTGGG + Intronic
1065441954 10:25762155-25762177 CAGGTGGGACCTTTGGGAAATGG + Intergenic
1065783888 10:29195121-29195143 GAGGTGGGACCTTTAAGAAGTGG + Intergenic
1066309182 10:34179006-34179028 GAGGTGAGGCATTTGGGGCAGGG - Intronic
1066533960 10:36370283-36370305 GAGGTGGGGCCTTTAGCAAGTGG + Intergenic
1066694034 10:38062017-38062039 AAGGTTTGGCCTTTGGGAGGTGG + Intronic
1066998787 10:42587133-42587155 AAGGTTTGGCCTTTGGGAGGTGG - Intronic
1067137512 10:43624451-43624473 AGGGTGAGGCATGTGGGAAGGGG + Intergenic
1067537298 10:47122764-47122786 GAGGTTGGGCTTTTGGGAGGTGG + Intergenic
1067913532 10:50371939-50371961 GAGGTGTGACCTTTAAGAAGTGG - Intronic
1067998925 10:51308876-51308898 GAGCTGAGACCTTTGAGGAGGGG + Intronic
1069030153 10:63587739-63587761 GAGGTGAGGCTTTTGAGAAGTGG - Intronic
1069281438 10:66659613-66659635 GAGATGGGACCTTTGGGAGGTGG + Intronic
1069750819 10:70744034-70744056 GAGGTGAGGTCAGTGGGAGGAGG - Intronic
1069984290 10:72273302-72273324 CAGGTGGGGCCTTGGGGAAGGGG + Intergenic
1069995084 10:72336938-72336960 GACCTGGGGCCTTTGGGGAGAGG + Intronic
1070521720 10:77259675-77259697 CAGGTGAGGCTTCTGGGAGGAGG - Intronic
1070600079 10:77859849-77859871 GAGGAGACCCCTTTGGGGAGAGG - Intronic
1070654080 10:78259109-78259131 GAGGTGGGGCCTTTAGAAGGTGG + Intergenic
1071177247 10:82940813-82940835 GAGGTGGGGCTTTTGGGAAGTGG - Intronic
1072202396 10:93172395-93172417 GAGGTGAGGCCTTTGGTGGGAGG + Intergenic
1072764428 10:98084090-98084112 GAGGTGGAACCTTTGGGAGGTGG - Intergenic
1072764629 10:98085339-98085361 GAGGTGGGACCTTTGGGAGATGG + Intergenic
1073008798 10:100344405-100344427 AAGATGAGCACTTTGGGAAGTGG - Intergenic
1074064732 10:110004014-110004036 GTGCTGAGCACTTTGGGAAGAGG + Intronic
1075003493 10:118814591-118814613 GAGGTGAGACCTTGGGCAAGGGG - Intergenic
1075161820 10:120031039-120031061 GAAGTAGGGCCTTTGGGAAGTGG + Intergenic
1076628906 10:131841175-131841197 GCGGTGAGGCCCTGGGAAAGGGG - Intergenic
1077146379 11:1048078-1048100 GAGGTGGGGACTTGGGGAGGTGG + Intergenic
1077416633 11:2427085-2427107 GAGGTGGGGCATTCTGGAAGGGG - Intergenic
1077447779 11:2607424-2607446 GAGGTGAGGCCTTTGGGAAGTGG + Intronic
1077603067 11:3587257-3587279 GAGGAAAGGACTTTGGGAATAGG + Intergenic
1077805465 11:5587643-5587665 GAGGTGGAGCCTTTGGGAAGTGG - Intronic
1078622731 11:12923822-12923844 GAGGTGAGGCCTTTTGGGATGGG - Intronic
1078640744 11:13093500-13093522 CAGGTGAGTCCTTTGAGAGGTGG + Intergenic
1080659188 11:34282186-34282208 GAAGTGAGACCTTTGGGAAGAGG - Intronic
1081596106 11:44460737-44460759 GAGCTGAGGCCTTTGGTAGAGGG + Intergenic
1081679353 11:44990778-44990800 GAACTGAGGCCTGAGGGAAGAGG + Intergenic
1081870335 11:46380275-46380297 AGGGGGAGGCCTTCGGGAAGAGG + Exonic
1081960885 11:47136369-47136391 GAGGTCAGGCAAGTGGGAAGAGG + Intronic
1083470480 11:62880864-62880886 CAGGCGCGGCCTCTGGGAAGGGG - Intronic
1084185510 11:67468943-67468965 GAGTTGAGGCCTTTGGGGCCCGG + Intronic
1084258950 11:67961795-67961817 GAGGAAAGGACTTTGGGAATAGG + Intergenic
1084568662 11:69945982-69946004 GAGCTGAGGACTTAGAGAAGAGG + Intergenic
1084625100 11:70300156-70300178 GAGTCCAGGCCTATGGGAAGGGG - Intronic
1085402559 11:76243455-76243477 GAGGTGAGGCCAGGGGGAAAGGG + Intergenic
1085681283 11:78577490-78577512 GAGATGAGGCCTAATGGAAGTGG + Intergenic
1085765694 11:79279868-79279890 GAGGTGTGACCTTTGGGAGGTGG + Intronic
1085808873 11:79662107-79662129 GAGGTAAGGCATTTGGGTTGTGG - Intergenic
1086235745 11:84627931-84627953 GAGGTGGGGCCTGTGGGAGGTGG - Intronic
1086630609 11:89014526-89014548 GAAGTGGGGGCTCTGGGAAGTGG + Intronic
1087564369 11:99835437-99835459 GAGGTGAGGCAATAGGGAAAAGG + Intronic
1088743014 11:112782117-112782139 AAGGTGAGGACCTTGGGAACTGG + Intergenic
1088907541 11:114165893-114165915 GAGGTCAAGCCTTTGGCAAATGG + Intronic
1089052982 11:115562032-115562054 GAGGTGAGGCCAAAGGGAAGGGG - Intergenic
1089306635 11:117530432-117530454 GAGGCGAGCCCTTTGGAAATTGG + Intronic
1089532940 11:119143372-119143394 TGGGTGAGGCATGTGGGAAGAGG - Intergenic
1089755520 11:120683383-120683405 GAGGAGAGACCTTGGGGTAGGGG + Intronic
1090053376 11:123400697-123400719 GAGGTGAGTCCTTTGGGAGGAGG - Intergenic
1090380007 11:126319763-126319785 GAGGTTGGGCCTTTGGGATACGG + Intronic
1090446508 11:126769138-126769160 GAGATGGGACCTGTGGGAAGAGG - Intronic
1090777212 11:129975948-129975970 GAGGTGGGGTCATGGGGAAGAGG + Intronic
1091473752 12:752866-752888 GCGGGGAGGCCTCGGGGAAGGGG + Intronic
1091641564 12:2241071-2241093 GAGGTGAGGGGGGTGGGAAGAGG + Intronic
1091809461 12:3383489-3383511 GAGGTGGGGCCTCTGGGAGGCGG + Intronic
1092085126 12:5750730-5750752 AGGGTGAGGGCTTTGGAAAGAGG + Intronic
1092430271 12:8402802-8402824 GAGGAAAGGACTTTGGGAATAGG + Intergenic
1093108451 12:15118579-15118601 GAGGTGAGGCCTGGTGGGAGGGG + Intronic
1093784562 12:23177222-23177244 TAGGAGAGGCCTTGGGGAAGGGG - Intergenic
1095169432 12:39016743-39016765 GAGATGGGGCCTTTGGGAGGTGG + Intergenic
1095200613 12:39379729-39379751 GAGCTGTGGCCTTTGGGAGAGGG - Intronic
1095408502 12:41894808-41894830 GAGGTGGGGCATTTGGGGGGTGG - Intergenic
1095585381 12:43843950-43843972 GAGGAGAGGGATTTGGGCAGAGG + Intronic
1095847117 12:46758360-46758382 GAGGTGAGGAATTTGGGAACTGG + Intergenic
1096243356 12:49971278-49971300 GCGGGGAGGCCTTTGGGGGGCGG - Intronic
1096429966 12:51534814-51534836 CAGGGGAGGCCTTTCGGAAGGGG + Intergenic
1096490313 12:52009386-52009408 GGGGTGAGGGCTGTGTGAAGGGG + Intronic
1097796772 12:63871009-63871031 GAGGTGGGGCCTGTGTCAAGTGG - Intronic
1098157829 12:67618473-67618495 GAGGTGAAGTATGTGGGAAGGGG + Intergenic
1098950844 12:76639168-76639190 GAGGTGGGATCTTTGGGAGGTGG - Intergenic
1099389505 12:82062064-82062086 GAGGTGTGGCCTTTGGAAGGTGG + Intergenic
1099955087 12:89345751-89345773 GGGGTATGGCTTTTGGGAAGGGG - Intergenic
1101049142 12:100842836-100842858 GAGGTGGGGCCTTTAGGAGGTGG - Intronic
1101858320 12:108462736-108462758 GTGTGGAGGCCTTTGGGAAGTGG - Intergenic
1102250041 12:111380620-111380642 GATAAGAGGCCTTGGGGAAGGGG - Intergenic
1102513203 12:113429297-113429319 AAGGTAAGGGCTCTGGGAAGGGG + Exonic
1102559532 12:113752431-113752453 GAGGTGGGGCCTTTAGGGGGTGG + Intergenic
1102772052 12:115486508-115486530 GAGGGGAGGCCATTGAGATGTGG + Intergenic
1102779688 12:115553389-115553411 GGGGTGAGGGCTTTGGGAGGTGG - Intergenic
1102875079 12:116442966-116442988 GAGGTGGAGCCTTTGGGATTAGG + Intergenic
1103795428 12:123499830-123499852 GAAGGGAGGCCTCTGTGAAGAGG - Intronic
1104232401 12:126897949-126897971 GAGGGGAAGCCTGTGGGAAAAGG + Intergenic
1104353951 12:128068720-128068742 GAAGTGGGGCCTTTGGAAGGTGG - Intergenic
1104657340 12:130583193-130583215 GTTGTGTGGCCTTTGGGATGTGG + Intronic
1104964812 12:132504089-132504111 GAGGTGAGGTCTTGGGTAGGTGG + Intronic
1105013926 12:132774418-132774440 GACGTGGGGCCTCTGGGAAGGGG + Intronic
1105662717 13:22516371-22516393 GAGGTGAGCTCATGGGGAAGGGG + Intergenic
1105881352 13:24609003-24609025 AGGGTCAGGCCTTTGGGAAATGG + Intergenic
1105885450 13:24637805-24637827 GAGGTGAGGGCTGAGGGACGAGG + Intergenic
1105929339 13:25037534-25037556 GAGATGAGGGCTTTGGCAGGTGG - Intergenic
1105944742 13:25179675-25179697 GAGGTGAGGTTTTTGGGGAAAGG - Intergenic
1106550277 13:30765146-30765168 GTGGTAGGGCCTTTGGGAAGAGG - Intergenic
1106757448 13:32837136-32837158 GAGGTGGGGCCTTTGGGAGATGG - Intergenic
1106842259 13:33696416-33696438 GAGCTGAGGTCTTTGGGACATGG - Intergenic
1107360577 13:39613351-39613373 GAGGCAGGGCCTTTGGGAGGTGG - Intergenic
1107752206 13:43579985-43580007 GTGGTGAGGGCTGTGGAAAGGGG + Intronic
1107999518 13:45893568-45893590 GAGATGGGGCTTTTGGGAGGTGG - Intergenic
1108091844 13:46857519-46857541 GAGGTGAGTCCTTTGAGAGGTGG - Intronic
1108379467 13:49842315-49842337 GAGGTGAGGCCTACAGGAGGTGG + Intergenic
1109368800 13:61394465-61394487 GAGGAAAGGCATTTGGGCAGAGG + Intergenic
1110299612 13:73910781-73910803 GAGGTAAGGGCTTTATGAAGTGG + Intronic
1111671121 13:91331758-91331780 GAGGGCAGGCCTTTTGGCAGGGG + Intergenic
1113023058 13:105910113-105910135 GAGACGAGGCCTTTGGGAGGTGG - Intergenic
1113374832 13:109755513-109755535 GAGGGAAGGGCTTTGGGAAGGGG - Exonic
1113501078 13:110774726-110774748 GAGGTAGGGCCTTTGGAAGGTGG - Intergenic
1113672758 13:112186089-112186111 GAGGTGGGGCCTTTAGGAGGTGG + Intergenic
1113678594 13:112226041-112226063 GAGGCGAGGCCCTTGGGCAGTGG + Intergenic
1113737211 13:112687617-112687639 GAGGTGGGGGCCTTGGGAGGTGG - Intergenic
1113967667 13:114163610-114163632 GGGGAGAGGACTTTGAGAAGAGG - Intergenic
1115488296 14:33934193-33934215 AAGGAGAGGCCTCTGGGAATGGG - Intronic
1116054056 14:39840676-39840698 GAGGTGGGGCTTTTGGGAATGGG + Intergenic
1116776528 14:49188221-49188243 TGGGTGAGTCCTTTGGGAGGTGG + Intergenic
1116991969 14:51286406-51286428 GAGCTGTGGCCTTTGGTAAAGGG - Intergenic
1117460035 14:55936246-55936268 TAGGTGAGGCATGTGGGAAGGGG + Intergenic
1117652909 14:57925174-57925196 GAGGTGGGGCCTAATGGAAGTGG - Intronic
1117999010 14:61505733-61505755 GAAGTGGGTCCTTTGGGAGGTGG - Intronic
1118089868 14:62462060-62462082 GAGGTGGGACATGTGGGAAGTGG + Intergenic
1118314488 14:64717283-64717305 GAGGCGAGGCCTGAGGGAGGGGG + Intronic
1119119365 14:72059675-72059697 GAGATGAGGCATTTGGGAGGTGG + Intronic
1120893689 14:89510981-89511003 GAGAAGAAGCCTTTGGGAAAAGG - Intronic
1120978340 14:90269144-90269166 GAGATGAGGCCTTTTGGAAAGGG - Exonic
1121465795 14:94114878-94114900 GAGGTGAGTCTGTGGGGAAGGGG + Exonic
1121498806 14:94417196-94417218 GTGGTGAGGTTTTTGGCAAGAGG + Intergenic
1121698049 14:95928765-95928787 TAGGTGAGCTCTTTTGGAAGAGG - Intergenic
1121790423 14:96695503-96695525 GAGGTCAGGCCTGAGGCAAGAGG - Intergenic
1121846044 14:97173249-97173271 GAGGAGAGGCCTTTTTGAAGAGG + Intergenic
1121874832 14:97441799-97441821 TATGTGAGGCCTTTGGGAATAGG + Intergenic
1122165277 14:99818524-99818546 GAGGTGAGGGGTGTGGGAAGAGG + Intronic
1123803716 15:23850348-23850370 GTTGTCAGGCATTTGGGAAGGGG + Intergenic
1124137935 15:27051483-27051505 GAGGTGTGTCCTTTGGGAAGGGG + Intronic
1125154297 15:36568764-36568786 GAGGTGGGACCTTTGGGAGGTGG + Intergenic
1125535745 15:40440704-40440726 GTGGTGGGGCCTTGGGGGAGGGG - Intronic
1126337481 15:47602928-47602950 GAGGTGAAATCTTTGAGAAGTGG - Intronic
1127503436 15:59575913-59575935 GAGGTTGGGCCTTTGTGAGGTGG - Intergenic
1127550209 15:60030092-60030114 GAGATTAGGCCTTTCTGAAGTGG - Intronic
1127706945 15:61556744-61556766 GAAGTGGAGCCTTTGGGAGGTGG + Intergenic
1128405481 15:67333141-67333163 GAGATGGGGCCTTTGGAAGGTGG - Intronic
1129300120 15:74620685-74620707 GACTGGGGGCCTTTGGGAAGGGG - Intronic
1129557933 15:76532826-76532848 GTGATGATGCCTTTGGGAGGTGG + Intronic
1130237634 15:82151631-82151653 GCTCTGAGGCCTTTGAGAAGAGG - Exonic
1130415999 15:83695263-83695285 GTGGTGGGGTCTTTGAGAAGGGG + Intronic
1131070693 15:89463866-89463888 GAGAAGAGGACTTTGGAAAGTGG - Intergenic
1131095445 15:89651816-89651838 GAAGTGAGGGCTTTGGGAAGTGG + Intronic
1131370538 15:91877632-91877654 TAGGGAAGGCCTTTGGGAAGGGG + Intronic
1131808336 15:96146798-96146820 GAGGTAAAGCCTTGTGGAAGAGG + Intergenic
1131812355 15:96185680-96185702 TAGATGAGGCCTTCTGGAAGAGG - Intergenic
1132087550 15:98920865-98920887 GAGCAGAGGGCTTTGGGAAAGGG - Intronic
1132477180 16:146071-146093 GAGGTGGGGCCTTTGGGGTAAGG + Intergenic
1132834012 16:1943387-1943409 GGGGCGGGGCCTTGGGGAAGTGG - Intergenic
1132834047 16:1943479-1943501 GGGGCGGGGCCTTGGGGAAGCGG - Intergenic
1133365913 16:5210070-5210092 GAGGAAAGGACTTTGGGAATAGG - Intergenic
1134096939 16:11424335-11424357 GAGGGGAGTCCTGGGGGAAGAGG + Exonic
1134215298 16:12312555-12312577 GAGGTGAGGCGTGAGGGCAGGGG + Intronic
1134572608 16:15304094-15304116 GAGGAGGGGCCTGGGGGAAGGGG + Intergenic
1134729774 16:16451929-16451951 GAGGAGGGGCCTGGGGGAAGGGG - Intergenic
1134937657 16:18259967-18259989 GAGGAGGGGCCTGGGGGAAGGGG + Intergenic
1135422853 16:22316522-22316544 GACGGGAGGCCTTGGGGGAGGGG + Intronic
1135927974 16:26711875-26711897 GAGGTGGGGCCTTTGGGAGGTGG - Intergenic
1136069358 16:27778744-27778766 GAGGGGAGCCCGCTGGGAAGAGG + Exonic
1136293455 16:29289356-29289378 GAGGTGAGTCCTCTGTGAATCGG + Intergenic
1136779351 16:32886809-32886831 GACCTGAGGCCTTTGGGGAAGGG - Intergenic
1136891266 16:33974709-33974731 GACCTGAGGCCTTTGGGGAAGGG + Intergenic
1137948391 16:52757900-52757922 TAAGTGAGGCGTTTGGGAACTGG + Intergenic
1138104489 16:54280417-54280439 GAGGGGAGGGCTTAGGGAGGAGG + Intergenic
1138725891 16:59138982-59139004 GAGGAAAGGCCTTTGCTAAGGGG - Intergenic
1139130758 16:64141505-64141527 GAGAGGGGTCCTTTGGGAAGTGG + Intergenic
1139430873 16:66910443-66910465 CAGGAGGGGCCTTTAGGAAGTGG + Exonic
1139492769 16:67295438-67295460 GAGGCTAGGTCTTTGCGAAGGGG + Intronic
1139531253 16:67543771-67543793 AAGGTGAGGCCAAGGGGAAGAGG - Intronic
1139659177 16:68409277-68409299 GAGGTGAGGGATGTGGGGAGGGG + Intronic
1139960758 16:70716113-70716135 CAGGTCAGGCCTGTGAGAAGGGG - Intronic
1140886499 16:79249057-79249079 GAGACAGGGCCTTTGGGAAGTGG + Intergenic
1141784188 16:86187539-86187561 GTGGTGAGGGCCATGGGAAGGGG + Intergenic
1142080374 16:88145917-88145939 GCGGTCCGGCCTCTGGGAAGTGG + Intergenic
1142099334 16:88263362-88263384 GAGGTGAGTCCTCTGTGAATCGG + Intergenic
1142226244 16:88878991-88879013 GAGGTCACGGCCTTGGGAAGCGG - Intronic
1203081767 16_KI270728v1_random:1148897-1148919 GACCTGAGGCCTTTGGGGAAGGG - Intergenic
1142997314 17:3768586-3768608 AAGGTGAGGGCTCTGGGAATAGG - Intronic
1143305231 17:5941337-5941359 TGGGCGAGGCCTTTGGGGAGTGG + Intronic
1143731571 17:8885418-8885440 GAGGCGAGGCCATGGGGAGGCGG - Intronic
1143890723 17:10100383-10100405 GAGAGGAGACCTCTGGGAAGTGG - Intronic
1144007087 17:11110566-11110588 GAGGTGGGGTCTTTGGAAGGTGG + Intergenic
1144271720 17:13624066-13624088 AAGGTGAGGCCTTTAAGAGGTGG - Intergenic
1144382726 17:14718726-14718748 GAGGTGGGACCTTTGGGAGGTGG - Intergenic
1144890803 17:18492949-18492971 GAGCTGATGCCTCTGGGATGAGG + Intronic
1145285141 17:21500087-21500109 AGGGTGAGGCATCTGGGAAGGGG + Intergenic
1145392387 17:22465660-22465682 AGGGTGAGGCATCTGGGAAGGGG - Intergenic
1147131028 17:38409085-38409107 GAGGTGAAGACAGTGGGAAGGGG - Intergenic
1147343850 17:39773373-39773395 GACATCAGGCCTTTGGGAAGGGG + Intronic
1147360048 17:39924690-39924712 GAAGTGAGGCCTGTGGGTACAGG + Intronic
1147384932 17:40075475-40075497 GGGGTGAGGCTTTGGGGGAGGGG - Intronic
1147973765 17:44235941-44235963 GAGGTGAGTCCTTCTAGAAGAGG - Intergenic
1149062070 17:52434349-52434371 GAGGTAAAGTCTTTAGGAAGTGG + Intergenic
1149628761 17:58101912-58101934 GAGGTGGGACTTTTGGGAGGAGG - Intergenic
1149840942 17:59964588-59964610 GAGGTTAGGCCTGGGGGAAGCGG - Exonic
1150281190 17:63930602-63930624 GAGGTGGGGCAGTCGGGAAGAGG - Intronic
1151686875 17:75652658-75652680 GAGGAGTGGCTTATGGGAAGTGG + Intronic
1151998918 17:77632496-77632518 GAGATGGGGCCTTTGAGAGGCGG + Intergenic
1152318648 17:79595615-79595637 GCGGGGAGACCTGTGGGAAGTGG + Intergenic
1152638280 17:81439080-81439102 CCGGTGGGGCCTTGGGGAAGAGG + Intronic
1153978035 18:10286687-10286709 CAGGTGACTCCTTTGAGAAGTGG - Intergenic
1154026149 18:10709214-10709236 GAGATGAGGGCTTTAGGCAGTGG - Intronic
1154949908 18:21199892-21199914 GAGGTGAAGGTGTTGGGAAGGGG - Intergenic
1156228473 18:35131597-35131619 GAGGTGGGGCCTTTGGGAGGTGG - Intronic
1157301848 18:46484991-46485013 AAGGGGAGGCCCATGGGAAGTGG - Intronic
1157445147 18:47738854-47738876 GAGGTGGGGACTTTGGGAGGTGG - Intergenic
1157447044 18:47753999-47754021 CAGGAGAGGCCATTGGAAAGAGG - Intergenic
1157560349 18:48641048-48641070 TGGGTGAGTCTTTTGGGAAGAGG - Intronic
1158808808 18:61007286-61007308 GAGGTGAGACCTTTCAGGAGAGG + Intergenic
1158889116 18:61856658-61856680 GAGGTGAGGGGTTGGGGGAGGGG + Intronic
1159595390 18:70378192-70378214 GGGGTGAAGCCTTTGTGAATGGG - Intergenic
1159867958 18:73728459-73728481 GAGATGGAGCCTTTGGGAGGTGG - Intergenic
1159939893 18:74398769-74398791 GAGGTGGGGCCTTCGGGAGGTGG - Intergenic
1160098691 18:75900839-75900861 GAAGTGAGGCCTGAGGGCAGTGG - Intergenic
1160358649 18:78250867-78250889 TAGGAGAGGACTTTGGGAAGTGG + Intergenic
1160367093 18:78335555-78335577 GGGGAGAGGCCTATGGGGAGGGG + Intergenic
1160468407 18:79103489-79103511 GAGGTGACACCTTTGGAAAGAGG + Intronic
1160532757 18:79575178-79575200 CAGGTGGGGCCTCTGGGCAGAGG + Intergenic
1160993882 19:1873026-1873048 GAGGTGGGGCCTCTGGGAGCAGG - Intergenic
1161483035 19:4520161-4520183 GAGGTGAGGGATGTGGGAAAGGG - Intergenic
1161678735 19:5668042-5668064 GAGGGGAGGGCATTAGGAAGGGG + Intronic
1161989991 19:7679087-7679109 GAGGTGAGGACTCTGGGGATGGG - Exonic
1162013411 19:7830978-7831000 GAGCTGAGGGCTGTGGGCAGGGG - Intronic
1162145751 19:8611291-8611313 GAGGTGGGGCCCTTGAGGAGGGG + Intergenic
1162558793 19:11403752-11403774 GAGGTGGGGCTTGTGGGTAGTGG + Intronic
1163717251 19:18879620-18879642 GAGGTGGGGCCTTGGCGAGGTGG - Intronic
1163717298 19:18879745-18879767 GAGGTGGGGCCTTGGTGAGGTGG - Intronic
1164579373 19:29425114-29425136 AAGGTGATGGCTTTAGGAAGCGG - Intergenic
1164909557 19:31994771-31994793 GAGGTGGAGACTTTGGGAGGGGG - Intergenic
1165245427 19:34495811-34495833 GAGGAGAGCCCTGTGGGAGGAGG - Intronic
1165562959 19:36696731-36696753 GGGGTGAGCCCTTGGAGAAGTGG - Intronic
1165674703 19:37711851-37711873 TAGGTGAGGCCCTTGGGTAGTGG - Intronic
1165856429 19:38881347-38881369 CGGGTGTGGCCTTTGGGAGGGGG + Intronic
1166570846 19:43796147-43796169 GAGGTGGGGCCTTTGGGAGGTGG - Exonic
1166879875 19:45922226-45922248 TAGGAGCGGCCTTTTGGAAGAGG + Intergenic
1167270316 19:48502360-48502382 GAGGTGAGGCCTCAGGGGAGGGG - Intronic
1167419153 19:49392991-49393013 TAGGTTTGGCCCTTGGGAAGGGG - Intronic
1167972043 19:53193739-53193761 GAGGTGAGGCATGGGAGAAGGGG - Intergenic
1168065167 19:53915151-53915173 GAGGTGTGGCCTGTGTGAGGGGG + Intronic
1168267962 19:55232466-55232488 GAGGGCAGGCCCTGGGGAAGTGG + Intronic
925991973 2:9261247-9261269 GAAGTGAGGCTGTTGGGAAGTGG + Intronic
926115571 2:10210796-10210818 GAGGTGGAGCCTTTGGGAGGTGG + Exonic
926206756 2:10839464-10839486 GAGGTGGGGTCTTTGAGAAGTGG - Intergenic
926257612 2:11220773-11220795 TAGGTCAGACCTCTGGGAAGAGG - Intronic
926457087 2:13080297-13080319 GAGGTGCGGCCTATGGGAGATGG + Intergenic
926991142 2:18681664-18681686 TAGGTGAGGAAGTTGGGAAGTGG + Intergenic
927095608 2:19745729-19745751 CAGGTGTGGTGTTTGGGAAGTGG + Intergenic
927289782 2:21394058-21394080 GAGGTGAGGCCTTTGGGCCGTGG - Intergenic
927337581 2:21942888-21942910 CACGGGAGGGCTTTGGGAAGTGG + Intergenic
927489832 2:23513770-23513792 GAGGTGTGGACTCTGGCAAGAGG + Intronic
927498322 2:23565173-23565195 CAGGTGAGGCCTATGGGACAAGG + Intronic
927827169 2:26316934-26316956 GAGAAGAGGCCTTGGGGAAGAGG + Exonic
927938951 2:27091892-27091914 AATGTGATACCTTTGGGAAGAGG + Intronic
928096903 2:28410376-28410398 GGTGTGAGGCCTCTGGGAGGAGG - Intronic
928306079 2:30171452-30171474 GAGGTGAGGCCTTTGAGAGGTGG - Intergenic
928983780 2:37160843-37160865 GAGGTGTGGCCTTTGGGTGGTGG + Intergenic
929659997 2:43774468-43774490 GAGGGGAGGCCCCTGGGGAGAGG - Intronic
929815993 2:45232072-45232094 GAGGTGGGGTCTTTGGAAGGTGG - Intergenic
929856516 2:45642703-45642725 GAGGTGAGGGTTGTGGGAAGTGG - Intergenic
929872870 2:45773251-45773273 AGGGTGAGGCCTTTTGGGAGTGG + Intronic
930014870 2:46963396-46963418 GAGGTGAGACCTTGGGCATGTGG - Intronic
930116156 2:47720096-47720118 GAGGCCAGGCCTCTGGAAAGGGG + Intronic
930737833 2:54797660-54797682 CAGCTAAGGTCTTTGGGAAGTGG + Intronic
931183887 2:59930933-59930955 GAGGTGTGCCCTTAAGGAAGGGG + Intergenic
931472619 2:62554253-62554275 GAGCTAGGGCCATTGGGAAGAGG - Intergenic
933713771 2:85345533-85345555 GAAGGGAGGCCGCTGGGAAGAGG - Intronic
933724641 2:85419507-85419529 GAGAAGAGGCCTCTGGAAAGAGG - Intronic
934720768 2:96574630-96574652 GAGGAGAAGCCTATGAGAAGTGG - Intergenic
934937454 2:98475753-98475775 GGGGTGGGGGCTTTGGGAGGAGG + Intronic
935608430 2:104994910-104994932 AAGGTAGGGCCTTTGGGACGTGG - Intergenic
935675975 2:105595304-105595326 GAGGGCAGGCCAGTGGGAAGTGG - Intergenic
935855433 2:107268062-107268084 GAGGTGGGGCTTTTGGGAGGTGG - Intergenic
936082836 2:109446623-109446645 GAGGTGAGGTCTATGGGCAGGGG + Intronic
936277673 2:111114563-111114585 GGGGTGAGACATATGGGAAGAGG + Intronic
937145751 2:119642902-119642924 GAGATGGAGCCTTTGGGAGGTGG - Intronic
937390855 2:121485121-121485143 GAGGTTATGCCTTTGGTAAAAGG - Intronic
938178617 2:129159999-129160021 CAGGTGAAGCCCATGGGAAGAGG + Intergenic
938663755 2:133512883-133512905 GAGGAGGGGCCATGGGGAAGCGG - Intronic
940084645 2:149845246-149845268 GAGATGGGGCCTTTGGGAGGTGG - Intergenic
940809871 2:158230431-158230453 GAGGGGAGTACATTGGGAAGAGG + Intronic
940876707 2:158904870-158904892 GAGGTGAGGACTGGGGGAAGAGG + Intergenic
941168426 2:162108569-162108591 GAGGACAGCCCTTTGGGAAAGGG - Intergenic
941187164 2:162331475-162331497 GAGGTGGGGCCTTTAGGAGGAGG + Intronic
941531710 2:166678632-166678654 GAGGTGGGGCCTTTGGGAGGTGG + Intergenic
941673174 2:168316881-168316903 GAGGTGAGACCTTTGAGAGGTGG - Intergenic
942721529 2:178958499-178958521 GAGGTGAGTGCTTTTGGGAGGGG - Intronic
943650530 2:190453280-190453302 GAGGTGTGGGCTCTGGGTAGGGG + Intronic
944007486 2:194927769-194927791 TAGGTGTGGCCTTTGGGAGGTGG - Intergenic
944021635 2:195112873-195112895 AAGGTGAGGTCTTTGGGAGATGG + Intergenic
944422500 2:199546125-199546147 GAGGTAGAGCCTTTGGGAGGTGG - Intergenic
945258984 2:207826673-207826695 GAGTTGGGGTCTTGGGGAAGCGG + Intergenic
946015485 2:216600820-216600842 GAGGTGAGGACTTTTGGAGATGG + Intergenic
946106634 2:217376050-217376072 CAGGGCAGACCTTTGGGAAGGGG + Intronic
946402394 2:219475449-219475471 GAGGGGAGGCGTCTGTGAAGTGG + Intronic
947385939 2:229590560-229590582 GAGGTGGGGCCTTTGAGAGGTGG + Intronic
947801451 2:232930704-232930726 GTGGTGGGGCCTTTGAGAGGTGG - Intronic
947866372 2:233400523-233400545 GAGGAGAGGCAGTTAGGAAGTGG - Intronic
948364682 2:237447041-237447063 GAGGTGGGGTCTTTGGGAAGGGG - Intergenic
948383660 2:237568300-237568322 GAGGATGGGCCTTGGGGAAGGGG - Intergenic
948387176 2:237588149-237588171 GAGGTGGGGCCTAATGGAAGGGG + Intronic
948524503 2:238562548-238562570 GAGGCGGGGCCTTTAGGAGGCGG + Intergenic
948604104 2:239123759-239123781 GAGGTCAGGGCTGCGGGAAGAGG + Intronic
948723887 2:239920092-239920114 GAGGTGGGGCCTTTGGGAGGTGG + Intronic
949000370 2:241609939-241609961 GAGCTGAACCCTGTGGGAAGCGG + Intronic
1168770183 20:409396-409418 CAGGGGAGGCCTCTGGGAGGGGG - Intronic
1169201539 20:3712612-3712634 GAGCTGAGGCTTTGGGAAAGAGG - Intergenic
1169228804 20:3873235-3873257 GAGGTGGGGCCTTTGGGGCTGGG + Exonic
1169228851 20:3873548-3873570 GATGTGGGGCCTGTGGGAGGTGG + Exonic
1169301519 20:4445684-4445706 CAGGTGAGGGCTTTGGGTGGTGG + Intergenic
1169492377 20:6082132-6082154 GAGGTGAGGCTTTGAGGCAGTGG - Intronic
1169939108 20:10917922-10917944 GAGGTGGGGCTTTTCGGAAGTGG + Intergenic
1170451570 20:16489207-16489229 GAGCTGGGGCCTTGGAGAAGAGG + Intronic
1170601234 20:17843192-17843214 GAGGGCAGGCCATAGGGAAGGGG - Intergenic
1170921054 20:20679746-20679768 TAGATGAGGCTTTGGGGAAGAGG - Intronic
1170968079 20:21094024-21094046 GAGGTGTGGTATTTGGGAAGGGG + Intergenic
1170971692 20:21122858-21122880 AAGGTGAGGTCTGGGGGAAGGGG - Intergenic
1171014038 20:21523639-21523661 GAGGGAAGGATTTTGGGAAGCGG + Intergenic
1171046019 20:21809876-21809898 GAGGTGGGGCCTTTGGACGGAGG - Intergenic
1171048421 20:21833017-21833039 GAGGTGGGGCATTTAGGAGGCGG - Intergenic
1171406489 20:24915357-24915379 GAGGTGTGGCCTGTGGCATGGGG - Intergenic
1172308134 20:33896377-33896399 GAGGAGAAGCCTTTGAGAGGTGG + Intergenic
1172573335 20:35987184-35987206 GAGGGGAGGGCCTTGGGAAAAGG + Intronic
1173182896 20:40818023-40818045 GAGGTGAAGGTTTTGTGAAGTGG + Intergenic
1173497527 20:43530216-43530238 GAGGTGAGGCAGATGGGGAGTGG + Intronic
1174408840 20:50320933-50320955 GGGATGAGGCCTTGGGGAGGAGG - Intergenic
1175107671 20:56626577-56626599 GAGGTGGTGCCTTTGGAAACAGG - Intergenic
1175157735 20:56983547-56983569 GATTTGGGGCCTTTGGCAAGTGG - Intergenic
1175465400 20:59187273-59187295 GAGGTGGGTCCTTTGGGAGGTGG + Intergenic
1175697500 20:61113654-61113676 ATGGTGGGCCCTTTGGGAAGAGG - Intergenic
1175880303 20:62254174-62254196 GATGTGGGGCCTTTGAGAGGTGG - Intronic
1175936624 20:62517237-62517259 GAGGAGTGGGTTTTGGGAAGTGG + Intergenic
1176050130 20:63114607-63114629 GTGGCGAGGCCTGAGGGAAGTGG + Intergenic
1176088885 20:63310246-63310268 GAGCCCAGGCCTGTGGGAAGTGG + Intronic
1176385555 21:6137251-6137273 GAGGTGAGGGCCTTGGCAGGCGG + Intergenic
1177029697 21:15967247-15967269 AAGGTGAGGCATTTGGGAAGGGG - Intergenic
1177403596 21:20637878-20637900 GAGGTGAGGCCTTTAGGAGGTGG - Intergenic
1177612229 21:23466534-23466556 GAGGTGAGTCCTCTAAGAAGTGG + Intergenic
1177669349 21:24206284-24206306 AAGGTGGAGCCTTTGGGAGGTGG + Intergenic
1178694499 21:34781248-34781270 GAAGTGGGGCCTTTAGGAGGTGG - Intergenic
1178815457 21:35925170-35925192 GAGGAGTAGCCTGTGGGAAGGGG - Intronic
1179167189 21:38944327-38944349 GAGGGGAGACCTTGGGGAGGAGG - Intergenic
1179482433 21:41686684-41686706 GAGGCAGGGCCTTTGGGAGGTGG + Intergenic
1179737918 21:43401001-43401023 GAGGTGAGGGCCTTGGCAGGCGG - Intergenic
1181100687 22:20536958-20536980 CAGGAGAGGCATATGGGAAGGGG - Intronic
1181461850 22:23090371-23090393 CAGGTGAGGGCTGGGGGAAGTGG - Intronic
1181643283 22:24216038-24216060 CAGGTGGGGCCTTTGGGATGTGG + Intergenic
1181975212 22:26724064-26724086 GAGATGGGACCTTTGGGAGGTGG - Intergenic
1181986266 22:26801887-26801909 GAGGTGGGGCCTATGAGTAGTGG + Intergenic
1181991780 22:26842414-26842436 GGGCTGAGGGCTGTGGGAAGGGG + Intergenic
1181992725 22:26849787-26849809 CAGGGGAGGCTTCTGGGAAGAGG - Intergenic
1182765677 22:32756569-32756591 GAGGTGAGGCCTGGTTGAAGGGG + Intronic
1182794462 22:32980759-32980781 GGGGTAAGGCCTTTGGGAGAAGG - Intronic
1182990861 22:34766218-34766240 GAGGTGTGGCCTTTGGGAATAGG + Intergenic
1183248837 22:36713912-36713934 GAGGTGAGGACCCAGGGAAGAGG - Intergenic
1183269474 22:36851586-36851608 GAGGAGAGGGCTGTGGAAAGGGG + Intergenic
1183388680 22:37530503-37530525 GAGGTGGGGCTTTGGGGAGGTGG - Intergenic
1183524272 22:38314528-38314550 GAGGTCTGGCCTCTGGGCAGGGG - Intronic
1183661487 22:39224085-39224107 GAGCAGAGGACTTTGGGAAATGG + Exonic
1183705177 22:39471493-39471515 GGGGTGAGGGCAGTGGGAAGGGG - Intronic
1184058191 22:42066459-42066481 GAGAAGAGGCCCTTGTGAAGTGG - Intronic
1184108390 22:42381677-42381699 TAGGTGAGGCCTAGGTGAAGGGG - Exonic
1185068250 22:48642586-48642608 ACTGTGAGGCCTTTGGGGAGGGG - Intronic
949256536 3:2053952-2053974 GAGGTGGGGCCTGTGGGAAGTGG + Intergenic
949406072 3:3716238-3716260 GAGGTGGGGCATTTTGGAGGTGG - Intronic
950478732 3:13231545-13231567 AAGGTGGGGCCGTTGGGAGGTGG - Intergenic
950484869 3:13267081-13267103 GAGGTGGGGCCTCTGGGAGGTGG + Intergenic
950490273 3:13300473-13300495 GAGGTTGGGTCTTTGGGAGGTGG - Intergenic
951291759 3:20879267-20879289 GAGTTGAGGACTTGGGGAAGTGG + Intergenic
951470963 3:23055561-23055583 GAGGTGGGACCCTTGGGAGGTGG - Intergenic
951710538 3:25581667-25581689 GAGGTGGGGTCTTTGGGCGGGGG + Intronic
951967651 3:28405274-28405296 GAGGTAAAGCCTTTGGGAGGTGG + Intronic
952212872 3:31247129-31247151 GAGGTGTGGCCTGAGGGTAGCGG - Intergenic
952236818 3:31488487-31488509 GAGGTGAGGCCTTTTGGAGGTGG + Intergenic
952494647 3:33905067-33905089 TAGGTGAGGAGTTTGGGAAGGGG + Intergenic
952512948 3:34075471-34075493 AAGGTGAGGACTTTTGGAAAGGG + Intergenic
953025425 3:39142260-39142282 AGGCTGTGGCCTTTGGGAAGGGG + Exonic
953561163 3:43995036-43995058 GAGGTGAGGCCTGCCGGCAGCGG + Intergenic
953761503 3:45690759-45690781 GAGGTGAGCACTTTGCAAAGGGG - Intronic
953907129 3:46874022-46874044 GAGGTGAGCCTCTTTGGAAGAGG - Intronic
953911989 3:46897963-46897985 AAGGTGAGGCCTGCTGGAAGGGG + Exonic
954872759 3:53780221-53780243 AAGGGGAGGCCCTGGGGAAGGGG + Intronic
955502813 3:59601925-59601947 TAGGTCAGGCCTTAGGAAAGAGG + Intergenic
955748330 3:62162520-62162542 AAAGTGAGGGCTTTGGGAGGTGG + Intronic
956447674 3:69341686-69341708 GAGGCAAGGCCTTTAGGAGGTGG + Intronic
956887933 3:73579087-73579109 GAGGTGGGGTCTTGGGGAGGTGG + Intronic
956907343 3:73780463-73780485 GAGGAAAGGCCTGTTGGAAGAGG + Intergenic
957561845 3:81832409-81832431 GAGGTGGGGCCTTTGAGAGGTGG + Intergenic
957573119 3:81974252-81974274 GTGGTGAAGCATTTGGAAAGCGG + Intergenic
957987041 3:87585710-87585732 GATGTGAGGACTTTGGGCATAGG - Intergenic
958180104 3:90049088-90049110 AAGGTGGAGCCTTTGGGAGGTGG - Intergenic
958614647 3:96476240-96476262 GAGGTAAAGCTTCTGGGAAGTGG - Intergenic
958703419 3:97621932-97621954 GAGATGATTCCTTTGGGAACAGG + Intronic
959733605 3:109632081-109632103 GAGATGAGGCCTAAGGGAGGAGG - Intergenic
959752941 3:109859599-109859621 GAGGTGAAGCCTTTGGATGGTGG + Intergenic
959877035 3:111395277-111395299 GAGGTGGGGTCTTTGGGAGGTGG + Intronic
960479736 3:118172964-118172986 GAAGTGAGGCTTTGGGGAAGTGG + Intergenic
961280183 3:125760405-125760427 GAGGAAAGGACTTTGGGAATAGG - Intergenic
961361924 3:126373427-126373449 AAGGAAAGGCCTGTGGGAAGGGG + Intergenic
961874220 3:130009142-130009164 GAGGAAAGGACTTTGGGAATAGG + Intergenic
962294200 3:134166160-134166182 GAGTTGGGGCCTTTGGAAGGTGG + Intronic
962404726 3:135091204-135091226 GAGTTGAGGCAGTTGGGATGGGG + Intronic
962447420 3:135479481-135479503 GATGTGATGCCTTGGGGAAGTGG + Intergenic
962714908 3:138117546-138117568 GAGGTGGGGCCTTTGGGGGGTGG - Intergenic
962918648 3:139932079-139932101 GAGGTGAGACATTTGGCAGGGGG - Intergenic
963712990 3:148768735-148768757 GAGGTGGGACCTTTGGGAAATGG + Intergenic
964204178 3:154152487-154152509 GAGGTCATGCCTTTGCCAAGGGG - Intronic
964237171 3:154545230-154545252 GAGCTGAGGCCTTAGGTATGGGG + Intergenic
964359347 3:155878136-155878158 GAGGTGAGGTCTTTGGGAGGTGG - Intronic
964389556 3:156183269-156183291 GAGGTGAGGGCTTTGAGAAGGGG + Intronic
965191793 3:165540017-165540039 CAAGTGAGTCCTTTGGAAAGAGG + Intergenic
965689153 3:171337003-171337025 GAGGTGAGGCTGTGGGGAAGAGG - Intronic
966463388 3:180202763-180202785 GAGGGGAGGACTATTGGAAGTGG - Intergenic
966549587 3:181189740-181189762 GAGGTGAGACATTAGGGAAATGG - Intergenic
966797637 3:183730683-183730705 GAGTTGAGGCTTTTTGGAAAAGG + Intronic
968295056 3:197570067-197570089 GAGATGAGGCACTTGGGAACTGG + Intronic
968460433 4:721951-721973 GGGGAGAGGCCTGTGGGAGGTGG + Intronic
968468322 4:764367-764389 GAGGTAGGGCCTGTGGGGAGAGG + Intronic
968520446 4:1032582-1032604 CAGGTGAGGGCTGTGGGAGGAGG + Intergenic
968619406 4:1597117-1597139 GAGCCCAGGCCTGTGGGAAGAGG - Intergenic
968947444 4:3672794-3672816 GAGGTGAGGACTTTGGGAGGTGG - Intergenic
969017484 4:4113625-4113647 GAGGAAAGGACTTTGGGAATAGG + Intergenic
969064842 4:4470652-4470674 GAGAGAAGGCCTCTGGGAAGAGG + Intronic
969080720 4:4615949-4615971 GAGGGGAAGGCTTTGGGGAGAGG - Intergenic
969106345 4:4809727-4809749 GAGATGGGGCCTTTGGGATTGGG + Intergenic
969121321 4:4913487-4913509 GAGGACAGGCCCTGGGGAAGGGG + Intergenic
969324305 4:6432037-6432059 GAGGTGGGGCCTTTGGGAGGTGG - Intronic
969338782 4:6527758-6527780 GTGGTGGGGCCTGTGGGAAGGGG - Intronic
969535800 4:7755490-7755512 GAGGGAAGGCATTTGGGAACTGG - Intergenic
969676070 4:8615029-8615051 GAAGTGAGGGCTCTGGGCAGTGG + Intronic
969795652 4:9526243-9526265 GAGGAAAGGACTTTGGGAATAGG - Intergenic
970559074 4:17265272-17265294 GAGGAGAAGCCTTTGGGAGTTGG - Intergenic
970644668 4:18106664-18106686 GAGGCTAGGCTTTCGGGAAGAGG + Intergenic
971577338 4:28292182-28292204 GAGGGGAGGACAATGGGAAGAGG + Intergenic
971844618 4:31903498-31903520 GAAGTGATGTCTTTGGAAAGTGG + Intergenic
972362097 4:38336175-38336197 GAGGTGAGGTCTTTAAGAAGTGG + Intergenic
973851462 4:54965444-54965466 AAGGTGGGGCCTTTAGGAGGTGG + Intergenic
973862107 4:55076207-55076229 GAGGTGAGAGCTGTGGGGAGGGG - Intergenic
973972683 4:56229239-56229261 AAGGTGGGGCCTTTCGGAGGTGG + Intronic
975200531 4:71582959-71582981 GAGGTAGGGCCTTTGGGAGGTGG + Intergenic
975486602 4:74940551-74940573 GAGGTGGGGTCTTTAGGAAGTGG - Intronic
975804653 4:78099268-78099290 GATGAGAGAACTTTGGGAAGGGG + Intronic
975895066 4:79079188-79079210 AGGGTGAGGCATGTGGGAAGGGG + Intergenic
977325647 4:95572072-95572094 GAGGTGGTGCCTATAGGAAGAGG - Intergenic
977954675 4:103012932-103012954 GAGGTGAGGCCTTTAGGAAATGG - Intronic
978898455 4:113919648-113919670 ATGGTGTGGGCTTTGGGAAGGGG + Intronic
979870977 4:125821841-125821863 GAGATGAGGCCTTTGGGAGCTGG + Intergenic
980196830 4:129600275-129600297 GTGGTGAGGCCTCTGGGAGATGG + Intergenic
980770380 4:137364453-137364475 CAGGTGAGGCCTTTAAGAGGTGG + Intergenic
981261182 4:142721199-142721221 GGGGAGAAGCCTTTGGGAATTGG - Intronic
981782404 4:148443803-148443825 GAGGAGGGGCCTTTGGGCACAGG - Intronic
983413763 4:167429186-167429208 GAGGTGGGACCTTTAAGAAGTGG - Intergenic
983922913 4:173366402-173366424 GAGGTGGGGCTTTTAGGAGGTGG - Intergenic
985536080 5:466368-466390 GAGGTGGCCCCTTGGGGAAGTGG - Intronic
985649567 5:1101124-1101146 GAGGAGGGGCCTCTGGGGAGAGG - Intronic
986165383 5:5268017-5268039 GCGGTGTGGCCTTGGGGAAGTGG + Intronic
986278631 5:6304385-6304407 GAGGGGAGGCTATTGGGCAGGGG + Intergenic
986339715 5:6778637-6778659 GAAGTGGAGCCTTTGGGAGGTGG + Intergenic
986764351 5:10911354-10911376 GAGGGAGGACCTTTGGGAAGTGG + Intergenic
986984686 5:13487159-13487181 GAGGAAGGGCCTTTGGGAGGAGG + Intergenic
987653142 5:20770828-20770850 GAGGTGGGGTCTTTGGTAGGTGG - Intergenic
987824306 5:23008595-23008617 GAGATGGGACCTTTGGGAATTGG + Intergenic
988522460 5:31958839-31958861 GAGGTCAGGAGTTTGAGAAGAGG - Intronic
989076440 5:37568258-37568280 CAGGTGTGGTGTTTGGGAAGTGG + Intronic
989606182 5:43246403-43246425 CCGGTGAGGCCCTTGAGAAGTGG + Intronic
990700751 5:58472629-58472651 TAGGTGGGGCCTTTAGGAGGTGG - Intergenic
991258664 5:64643144-64643166 GAGATGAGGCCTTTGGTAGGTGG - Intergenic
991311680 5:65249988-65250010 GAGATGAAGCCCTTGGGAGGTGG - Intronic
991943281 5:71875797-71875819 GAAGTAGGGCCTTTGGGAGGAGG + Intergenic
991972126 5:72151323-72151345 GAGGTGAGGCCTAGTGGGAGGGG - Intronic
992501074 5:77344641-77344663 GAGGCAGGGCCTTTGGGAAGTGG - Intronic
992664722 5:78996091-78996113 GAGCTGAGAGCTTTGGGAACTGG + Intergenic
995058371 5:107787486-107787508 AAGGTGGGGTCTTTGGGAGGTGG + Intergenic
997660174 5:135583276-135583298 GAGATGAAGTCTCTGGGAAGAGG + Intergenic
997981889 5:138472747-138472769 GAGGGGAAGCCATTGGGCAGAGG + Intergenic
998501901 5:142640459-142640481 GAGCTGAGGCCTTTGCCAGGTGG + Intronic
998583747 5:143404770-143404792 GAGGTCAGGAGTTTCGGAAGGGG - Intronic
998726263 5:145018287-145018309 GAGGTGTGACCTTTGAGAAGAGG - Intergenic
1000689209 5:164293921-164293943 AAGGTGAGGCCTAAGGGGAGAGG + Intergenic
1000932002 5:167263047-167263069 GAGGTGGGACCTCTGGGACGGGG - Intergenic
1001379459 5:171294139-171294161 GATCTGAGGCCTTTGGGGAAGGG - Intronic
1001557405 5:172646214-172646236 GAGGTCATGCCATTGGGAACTGG - Intronic
1001854169 5:174996294-174996316 GAGTTGAGACCATTGGTAAGAGG + Intergenic
1002281959 5:178136134-178136156 AAGGTCAGGCGTCTGGGAAGTGG - Intronic
1002343796 5:178534336-178534358 GAGGCGGGGCCTTTGGAAGGTGG - Intronic
1003435455 6:6083938-6083960 GAGGTGGGGTCTTTGGGAGGTGG + Intergenic
1003687627 6:8320267-8320289 GAGGTGGGGCCTTTGGGAGGTGG - Intergenic
1003981971 6:11398297-11398319 GAAATGAGGTCTTTGGGAAAGGG + Intergenic
1004171775 6:13300749-13300771 GAGGTGGGGCCTTTGGAAGGTGG + Intronic
1004361229 6:14973003-14973025 GAGGTGAGCCCTTTGGGAGGTGG - Intergenic
1004997727 6:21210320-21210342 GAGCTGGAGCCTTTGGGAGGTGG + Intronic
1005194640 6:23268847-23268869 GAGGTGAGGACTTTAGGAGGTGG + Intergenic
1005380468 6:25229178-25229200 GAGGTGGGGCTTTTGGGAGATGG + Intergenic
1006396426 6:33790324-33790346 GAGGAGGGGCCTGGGGGAAGGGG - Intergenic
1006512364 6:34528583-34528605 GAGGGGGGGCCTCTGGGCAGGGG + Intronic
1007007882 6:38384435-38384457 GAGCTTAGGCCTTTGGCAAATGG + Intronic
1007599193 6:43071379-43071401 GTGGTGAGGGCCTGGGGAAGGGG + Intronic
1007952548 6:45885165-45885187 GAAGTGGGGCCTTTGAGAGGAGG + Intergenic
1008099392 6:47375062-47375084 GAGGTGGGGCATTTGGAAGGTGG - Intergenic
1009344804 6:62600374-62600396 GTGGTGGGGCCTATTGGAAGGGG + Intergenic
1009947400 6:70355817-70355839 GAGGTGGGACCTTTGTGGAGGGG + Intergenic
1010125119 6:72422324-72422346 GAGGTGATGCCTGTGGGTAGAGG - Intergenic
1010671253 6:78689406-78689428 GAGGTGGAGCTTTTGGGAGGTGG + Intergenic
1011350497 6:86417883-86417905 ATGGTGGGGGCTTTGGGAAGGGG - Intergenic
1011706217 6:90003885-90003907 GGGGTGAAGTCTTTGGGAAGTGG - Intronic
1012443216 6:99281574-99281596 GAGGTGGGGCCTTTAAGAGGTGG + Intronic
1012560319 6:100572161-100572183 GAAGTGGGGGCTTTGGGGAGGGG + Intronic
1012853909 6:104478620-104478642 GAAGTGGGACATTTGGGAAGTGG - Intergenic
1014407390 6:121068551-121068573 GAGGTGAGGAACTTGGGAACTGG + Intergenic
1015713486 6:136166690-136166712 GAGGTGAGGCCTGGTGGGAGGGG - Intronic
1017181939 6:151562851-151562873 GTGCTGAGGCCTTAGGGGAGGGG + Intronic
1017607693 6:156150973-156150995 GAGGTGAGGCCTTTTGGAGGTGG - Intergenic
1018442222 6:163823774-163823796 GAGGTGGGGCCTTTGGGAGGTGG + Intergenic
1018494730 6:164337684-164337706 GGGGTGAGGCCTCTGGTGAGCGG - Intergenic
1018605710 6:165595876-165595898 AATGTGGGGCCTTTGGGAGGTGG - Intronic
1018639757 6:165895579-165895601 GGAGTGAGGACTTTGTGAAGAGG - Intronic
1018797076 6:167194433-167194455 GAGATGAGGCCTTTGGGCTGTGG - Intronic
1018819263 6:167360655-167360677 GAGATGAGGCCTTTGGGCTGTGG + Intronic
1018828954 6:167427533-167427555 AAGGTGAGGCCTTTAGGAGGTGG - Intergenic
1019061066 6:169258722-169258744 CAGGTGAGGCCACTGGAAAGAGG + Intergenic
1019061764 6:169262465-169262487 CAGGTGAGGCCACTGGAAAGAGG - Intergenic
1019332543 7:467553-467575 GAGGTGATGGTTTTGGGAGGAGG - Intergenic
1019374064 7:679780-679802 GGAGAGAGGCCTTTGGGAGGTGG + Intronic
1019395456 7:815927-815949 GAGGTGAGCCCCGTCGGAAGTGG + Intergenic
1019415621 7:925446-925468 GAGGGGAGGCCGGAGGGAAGAGG - Intronic
1020007123 7:4788974-4788996 GTTGTGAGGCCTGTGGGAATGGG - Intronic
1021095129 7:16527084-16527106 GAGGTGGGGCCCTGGGGCAGGGG - Intronic
1022059830 7:26782527-26782549 GAGGTGGAGCCTTTGGGAATTGG + Intronic
1022968578 7:35496748-35496770 GAGGTGAGCCTTTTGGGAGGTGG + Intergenic
1023851312 7:44151913-44151935 GAGGGGTGGCCTTTGGAGAGGGG + Intronic
1024614745 7:51101925-51101947 AAGGTGGAGCCTTTGGGAAGTGG + Intronic
1024770912 7:52722453-52722475 GAGGTAGGGCCTTTAGGAGGTGG - Intergenic
1025102094 7:56143891-56143913 GAGGCCAGGCATGTGGGAAGGGG - Intergenic
1026429505 7:70330044-70330066 AAGGTGAGGCCTTCAGGAGGAGG - Intronic
1026430633 7:70343720-70343742 AAGGTGGGGCATTTGTGAAGGGG + Intronic
1028103427 7:86848967-86848989 GAGGAGAGGCTTTTAGGAGGAGG - Intronic
1028313343 7:89367527-89367549 GAGGTGAGTCCTTTAAGAAGGGG - Intergenic
1028939554 7:96505797-96505819 GAGGTGAGGGTTTTGCGAGGTGG - Intronic
1029075977 7:97934455-97934477 GAGGAAAGGACTTTGGGAATAGG + Intergenic
1029489309 7:100861705-100861727 GGGGTGAGGCAGTGGGGAAGTGG - Intronic
1031223390 7:119002236-119002258 GACATGGGGCCTTTGGGAAGTGG - Intergenic
1031562648 7:123256521-123256543 GAGGTGGGGCCTTTAAGAGGTGG + Intergenic
1031735105 7:125349579-125349601 GAAGTGAGCACTTTGGGGAGAGG + Intergenic
1032366471 7:131304868-131304890 GAGTTGAGGCCTTTAGGAGGTGG + Intronic
1032495776 7:132361075-132361097 CAGCTGAGTCCTTGGGGAAGTGG - Intronic
1033243650 7:139701426-139701448 TAGGTGAGGGCTTTGGGAACAGG - Intronic
1033417918 7:141180563-141180585 GAAGGGAGGCCTCTGGGCAGAGG - Intronic
1033811099 7:145012095-145012117 GAGATAGGGCCTTTGGGAAGTGG + Intergenic
1034737139 7:153439873-153439895 GAGGTGGGGCCTTTTGGGAGGGG + Intergenic
1035334266 7:158115522-158115544 GAGGAGGGGCCTATGGGAGGTGG + Intronic
1035568658 8:658472-658494 GGGATGAGGGGTTTGGGAAGAGG - Intronic
1035962628 8:4154576-4154598 GAGGTGAGGTCTTTGGCAATAGG + Intronic
1036241541 8:7085884-7085906 GAGGAAAGGACTTTGGGAATAGG - Intergenic
1036260297 8:7234233-7234255 GAGGAAAGGACTTTGGGAATAGG + Intergenic
1036306320 8:7605290-7605312 GAGGAAAGGACTTTGGGAATAGG - Intergenic
1036312334 8:7692789-7692811 GAGGAAAGGACTTTGGGAATAGG + Intergenic
1036357166 8:8053275-8053297 GAGGAAAGGACTTTGGGAATAGG - Intergenic
1036501986 8:9322498-9322520 GAGGTGAAGCTTTTTAGAAGAGG + Intergenic
1036901403 8:12671978-12672000 GAGGAAAGGACTTTGGGAATAGG + Intergenic
1037297594 8:17417480-17417502 GAGATGGGACCTTTGGGAAGTGG + Intergenic
1037297612 8:17417607-17417629 GAGATGAGACCTTTGGGGGGTGG + Intergenic
1037944068 8:22975445-22975467 GAGGTGAGGCCCTTGGGAGTTGG + Intronic
1038001942 8:23399389-23399411 GAGGTGGGGCCTTTAAGAAGTGG + Intronic
1038405675 8:27320654-27320676 AGGGTGAGGTCTGTGGGAAGGGG + Intronic
1038421217 8:27435318-27435340 GAGGTGGGGCCTTTGGGAGGTGG - Intronic
1038615729 8:29092645-29092667 GAGGTGCGGCCTCTGGGTTGGGG - Intronic
1038680495 8:29662875-29662897 GAGGTGGGGCCTTTGAGAGGTGG - Intergenic
1039035131 8:33351357-33351379 GAGGTGAGGCCTAATGAAAGGGG + Intergenic
1040578058 8:48671591-48671613 GAGGCGAGGCCTTTGGCCTGGGG + Intergenic
1040605529 8:48927721-48927743 AAGGTGTGGCCTTTGGGATTTGG + Intergenic
1040634127 8:49252855-49252877 CAGGGGAGGCCTCTGTGAAGAGG + Intergenic
1043426029 8:80149683-80149705 GAGGTGAGGAACTTGGGAACTGG + Intronic
1044013417 8:87022282-87022304 GGAGTGAGGCATTTGGGAACAGG + Intronic
1047063472 8:121253536-121253558 GAGGAGAGGCCTATATGAAGAGG - Intergenic
1047165386 8:122432649-122432671 GAGGGGAGTCCTTGGGCAAGGGG - Intergenic
1047243955 8:123121613-123121635 GAGGTGAGGGCCTCTGGAAGAGG - Intronic
1047586290 8:126277566-126277588 GTGGTGAGGCCTTTGAGGAAGGG - Intergenic
1048191413 8:132293120-132293142 AAGGTGAGGTCTAGGGGAAGGGG - Intronic
1048230303 8:132633564-132633586 GAGGTGAGGTATTTAGGAAGGGG + Intronic
1048293802 8:133199863-133199885 CAGATGAGACCTGTGGGAAGGGG - Intronic
1048465569 8:134662245-134662267 CAGGTGGGACCTTTGGGAGGTGG - Intronic
1048582357 8:135740310-135740332 GTGGTGGGGCCTTTGGGAAGTGG - Intergenic
1049537179 8:143187874-143187896 GAAGCGAGCCCTTTGGGGAGAGG + Intergenic
1049943270 9:569332-569354 GAGGTGGGGCCTTTAAGAGGTGG + Intronic
1050627995 9:7526360-7526382 GAGGAGAGGCCTTTGGGAGGTGG - Intergenic
1051550986 9:18329064-18329086 GAGGTGGGGCCTTTGGGGAGTGG + Intergenic
1053524903 9:38818674-38818696 GAGGTGAGGAGTTGGTGAAGTGG - Intergenic
1054197135 9:62043090-62043112 GAGGTGAGGAGTTGGTGAAGTGG - Intergenic
1054641273 9:67545604-67545626 GAGGTGAGGAGTTGGTGAAGTGG + Intergenic
1054914808 9:70485890-70485912 GAGGGGATGCCATAGGGAAGAGG - Intergenic
1055336022 9:75234433-75234455 GAGGTGGGGCCTTTCAGAGGTGG + Intergenic
1056275826 9:84993198-84993220 GAGGAAATGGCTTTGGGAAGAGG - Intronic
1057495178 9:95554857-95554879 GAGGTGAGGCCTTTAGGAGGTGG + Intergenic
1057855049 9:98595307-98595329 GAGGTAGGGCCTTTGGGAAGGGG - Intronic
1059183521 9:112243325-112243347 GAGGTGAGGCATTTGAGACCAGG + Intronic
1059713071 9:116887396-116887418 GAGGAGAGGCTTTTGGACAGAGG + Intronic
1060526488 9:124324010-124324032 GAGGTGGGGACTGTGGGAGGGGG - Intronic
1060613589 9:124990763-124990785 GAAGAGCGGCCTCTGGGAAGAGG + Intronic
1060655125 9:125366868-125366890 GAGCTCAGGCCTGTGGGATGCGG - Intronic
1060666348 9:125434236-125434258 GAGGCCAGGCCATTGGAAAGTGG - Intergenic
1061010348 9:127950910-127950932 GAGGGAAGGCCTGTGGGAAGTGG + Intronic
1061615450 9:131775992-131776014 GAGGTTAGGTCTTGGGAAAGTGG - Intergenic
1061724770 9:132576048-132576070 GAGATGGAGCCGTTGGGAAGAGG + Intergenic
1062030224 9:134358843-134358865 GTGGTGAGGGCTGTGGGCAGAGG + Intronic
1062120886 9:134833545-134833567 GAGGAGACGCTTCTGGGAAGGGG + Intronic
1062381301 9:136288131-136288153 GAGGGGCTGCCCTTGGGAAGGGG + Intronic
1062523985 9:136970910-136970932 GGGGTGAAGGCTTTGGGGAGGGG - Intronic
1062656788 9:137607746-137607768 GGCGTGAGTCCTTTGGGATGAGG + Intronic
1185849183 X:3469396-3469418 AAGGTGAAGCCTATGAGAAGGGG + Intergenic
1185938498 X:4285919-4285941 GAGGTGGGGCTTTTTGGAGGTGG + Intergenic
1186134630 X:6505999-6506021 TAGGGCACGCCTTTGGGAAGAGG + Intergenic
1186689013 X:11955201-11955223 GAGGTGAGGATTTTGGGAGGTGG - Intergenic
1187938261 X:24356864-24356886 GAGGTGGGGTCTTTGGGGGGCGG - Intergenic
1188263134 X:28040772-28040794 AAGGACAGGCCTTTGGGGAGAGG - Intergenic
1188563483 X:31497434-31497456 AAGGAGACGCATTTGGGAAGAGG - Intronic
1189486450 X:41436410-41436432 GAGGTGGGGCCTTTAAGAGGTGG + Intergenic
1189540257 X:41980110-41980132 GAGGTGGGGCCTGGTGGAAGGGG - Intergenic
1190213512 X:48466210-48466232 GGGGTGAGGACTCTGGGAGGTGG - Exonic
1190369789 X:49729804-49729826 GAGGTGAGGCCTTTAGGAGGTGG + Intergenic
1190496708 X:51033718-51033740 ATGGTGAGGCCTTGGGTAAGTGG - Intergenic
1190509263 X:51160219-51160241 ATGGTGAGGCCTTGGGTAAGTGG + Intergenic
1190748030 X:53338093-53338115 GGGGCAAGGCCTGTGGGAAGGGG + Intergenic
1190798706 X:53769298-53769320 GGGGCAAGGCCTGTGGGAAGGGG + Intergenic
1191053518 X:56219617-56219639 AAGGTGAGGACATTGGGGAGAGG - Intergenic
1192203568 X:69082105-69082127 GAGGTGAGGCCGATGGGGATTGG + Intergenic
1193977508 X:88140642-88140664 GAGATGGGGCCTTTAGGAGGTGG + Intergenic
1195116822 X:101707530-101707552 GAGATGAGGCCTTTAAGAAGTGG - Intergenic
1196129613 X:112140676-112140698 GAGGTGAAGCCTTTAGGACTTGG - Intergenic
1196580730 X:117376043-117376065 GAGGTGGAGCCTTTGGGAGGTGG + Intergenic
1196799609 X:119530968-119530990 GAGGTCAGGAGTTTGAGAAGCGG - Intergenic
1198084000 X:133265776-133265798 AAGGAGGGGCCTCTGGGAAGGGG + Intergenic
1198534761 X:137574708-137574730 GAGGGGAGGTATGTGGGAAGGGG + Intronic
1199156683 X:144557514-144557536 GAGGTGGGGCCTTTAGGGGGTGG - Intergenic
1199634989 X:149805938-149805960 GAGGAGAGGGCTTTGGTATGAGG + Intergenic
1201250511 Y:12053024-12053046 GAGGTGGTGCTTTTGGGAGGTGG - Intergenic
1201533900 Y:15023971-15023993 GAGGTGAGGCCTGGTGGGAGGGG + Intergenic