ID: 1077453096

View in Genome Browser
Species Human (GRCh38)
Location 11:2662633-2662655
Sequence CAGGGGAATCACACCGTGGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 126
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 118}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077453096_1077453110 27 Left 1077453096 11:2662633-2662655 CCGGCCACGGTGTGATTCCCCTG 0: 1
1: 0
2: 0
3: 7
4: 118
Right 1077453110 11:2662683-2662705 CAGCGGTGACAGCCGTGCAGCGG 0: 1
1: 0
2: 0
3: 14
4: 186
1077453096_1077453112 29 Left 1077453096 11:2662633-2662655 CCGGCCACGGTGTGATTCCCCTG 0: 1
1: 0
2: 0
3: 7
4: 118
Right 1077453112 11:2662685-2662707 GCGGTGACAGCCGTGCAGCGGGG 0: 1
1: 1
2: 0
3: 7
4: 126
1077453096_1077453101 -2 Left 1077453096 11:2662633-2662655 CCGGCCACGGTGTGATTCCCCTG 0: 1
1: 0
2: 0
3: 7
4: 118
Right 1077453101 11:2662654-2662676 TGCGACATGTGACTCCCCGCTGG 0: 1
1: 0
2: 0
3: 0
4: 46
1077453096_1077453103 0 Left 1077453096 11:2662633-2662655 CCGGCCACGGTGTGATTCCCCTG 0: 1
1: 0
2: 0
3: 7
4: 118
Right 1077453103 11:2662656-2662678 CGACATGTGACTCCCCGCTGGGG 0: 1
1: 0
2: 0
3: 2
4: 43
1077453096_1077453104 10 Left 1077453096 11:2662633-2662655 CCGGCCACGGTGTGATTCCCCTG 0: 1
1: 0
2: 0
3: 7
4: 118
Right 1077453104 11:2662666-2662688 CTCCCCGCTGGGGTGCCCAGCGG 0: 1
1: 0
2: 2
3: 14
4: 237
1077453096_1077453111 28 Left 1077453096 11:2662633-2662655 CCGGCCACGGTGTGATTCCCCTG 0: 1
1: 0
2: 0
3: 7
4: 118
Right 1077453111 11:2662684-2662706 AGCGGTGACAGCCGTGCAGCGGG 0: 1
1: 0
2: 1
3: 5
4: 109
1077453096_1077453102 -1 Left 1077453096 11:2662633-2662655 CCGGCCACGGTGTGATTCCCCTG 0: 1
1: 0
2: 0
3: 7
4: 118
Right 1077453102 11:2662655-2662677 GCGACATGTGACTCCCCGCTGGG 0: 1
1: 0
2: 0
3: 0
4: 35

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077453096 Original CRISPR CAGGGGAATCACACCGTGGC CGG (reversed) Intronic
900098390 1:949828-949850 AAGGGGAATCAGAACGTGCCTGG + Intronic
900323865 1:2097914-2097936 CAGGGGAACCACACAGCAGCAGG - Intronic
900663408 1:3797658-3797680 CAGGTGCATGCCACCGTGGCCGG + Intergenic
902221496 1:14968736-14968758 CAGGTGACTCACTCTGTGGCAGG - Intronic
904712662 1:32442483-32442505 TAGGGGAATGACACAGCGGCAGG - Intergenic
904743470 1:32696201-32696223 CAGGGGATCTACACCGTGGTTGG - Intronic
906066487 1:42984761-42984783 CATGGGAGTCCCACCATGGCTGG + Intergenic
908094791 1:60726127-60726149 CAGGTTGATCACATCGTGGCTGG - Intergenic
909085812 1:71169168-71169190 AAGGAGAAGCACACAGTGGCAGG + Intergenic
912176524 1:107164918-107164940 CAGGGGAACCACACAGCGTCAGG - Intronic
912375965 1:109210215-109210237 CAGGGGAATCCAAACATGGCTGG - Intergenic
912462425 1:109844857-109844879 CATGGCAATCACACCGTTGCTGG + Intergenic
918153238 1:181817311-181817333 CAGTGGAATCAAAGTGTGGCAGG + Intergenic
921128189 1:212196475-212196497 CAGGGGAATCACATGGTGAAAGG - Intergenic
922077547 1:222262742-222262764 CAGGGGAATGAGACCATGACGGG + Intergenic
924706822 1:246509027-246509049 CAGGCTAATCACACTGTGGAGGG - Intergenic
924714775 1:246563121-246563143 CAGTGGAAACACACAGCGGCAGG - Intronic
1063323044 10:5070166-5070188 CAGGGGAATCTCTCCTTGGTGGG - Intronic
1065810566 10:29439029-29439051 CAGGGGAATGACACAGCAGCAGG - Intergenic
1069451951 10:68524902-68524924 CAGGGGAATGCCACCATGCCTGG - Intronic
1077453096 11:2662633-2662655 CAGGGGAATCACACCGTGGCCGG - Intronic
1077653386 11:3995381-3995403 CAGAGGATTCACACTGTGGGAGG - Intronic
1079137162 11:17782043-17782065 CAGGGTAATCATACAGTTGCAGG - Exonic
1086371831 11:86162890-86162912 CAGGGGTATACCACCGTGCCAGG + Intergenic
1091472134 12:738211-738233 CAGGTGCATGACACCGTGCCTGG - Intergenic
1093950492 12:25160594-25160616 TAGGGGAATGACACAGTAGCAGG + Intronic
1097011427 12:55956022-55956044 CAGTGGAAGCACACCTTGGGAGG - Intronic
1099481960 12:83178602-83178624 CAGGAGAACCCCACCGTGCCTGG + Intergenic
1100534404 12:95493246-95493268 CAGGGGGATCACTTCGGGGCAGG + Intronic
1104183726 12:126408181-126408203 TAGGGGAATCCCACTGTGGTGGG + Intergenic
1104615820 12:130267678-130267700 CAGGGGCATCACAGAGTGCCTGG - Intergenic
1105555559 13:21444911-21444933 CAGGCGCATAACACCATGGCCGG - Intronic
1109578388 13:64292597-64292619 GAGGGGGAGCACACGGTGGCAGG - Intergenic
1114595797 14:23910677-23910699 CAGAGAAATCACACAGTTGCTGG + Intergenic
1119692039 14:76680991-76681013 CAGGGGAATGACACAGCAGCAGG + Intergenic
1124233726 15:27968781-27968803 CAGGGAAACCACACAGAGGCGGG + Intronic
1131577413 15:93605804-93605826 CAGGGGAATAGCACCATGCCTGG - Intergenic
1136077337 16:27826213-27826235 CTGGGGAAAGACACAGTGGCAGG + Intronic
1137317100 16:47337050-47337072 CAGGAGAATCACAGGGAGGCGGG + Intronic
1139858401 16:69999932-69999954 CAGGTGAGTCCCACCGTGCCCGG + Intergenic
1141297797 16:82785945-82785967 CAGGGGAACCACACAGTAGCAGG - Intronic
1141611282 16:85182415-85182437 CAGGGGAGTGACACCTTGTCTGG - Intronic
1141761520 16:86031885-86031907 CAGGAGCATCCCACCGTGCCTGG + Intergenic
1143003798 17:3813484-3813506 CACGGGATTCTCACCGTGGGGGG + Intronic
1144224475 17:13131647-13131669 CAGCTGAATCACACCATGCCCGG + Intergenic
1147624013 17:41887585-41887607 GAGGGGAAGCTCACAGTGGCAGG + Exonic
1152093264 17:78258418-78258440 CAGGGGTCTCACACCCTGGGGGG - Intergenic
1152353294 17:79795055-79795077 CAGCTGGATCACACTGTGGCCGG + Exonic
1161584106 19:5095875-5095897 CCTGGGAATCAGACCCTGGCAGG + Intronic
925188215 2:1864001-1864023 CAGGAGCATCACAAGGTGGCTGG + Intronic
925226596 2:2188883-2188905 TAGGGAAATCAGACTGTGGCAGG - Intronic
933765393 2:85705085-85705107 CAGAGGCTTCACACTGTGGCAGG - Intergenic
933841850 2:86293276-86293298 CAGGGAAGTCACAACATGGCCGG + Intronic
934133647 2:88972927-88972949 CAGGGAAATCACAGCAGGGCAGG + Intergenic
937281397 2:120719725-120719747 CAGGGAAGGCACACCGTGGGGGG + Intergenic
939304391 2:140391938-140391960 AATGGGAAACACACCATGGCTGG + Intronic
945933925 2:215883912-215883934 CAGGGGAACCACAGTGTGTCAGG - Intergenic
946418978 2:219554321-219554343 CAGGGGGATCACACTCTGGCAGG + Intronic
947556832 2:231100342-231100364 CAGGGGAATGACACAGCAGCAGG - Intronic
948350999 2:237340785-237340807 CAGGGGAATGACACAGTTGCAGG - Exonic
1169180158 20:3557444-3557466 CAGCAGAATGACACCTTGGCTGG - Intronic
1172873309 20:38148966-38148988 CAGAGGGTTCACACCGTGGAAGG - Intronic
1180653702 22:17400891-17400913 CAGGCGCATGCCACCGTGGCTGG + Intronic
1181145531 22:20843345-20843367 CAGGGGCATGCCACCGTGCCTGG - Intronic
1181185713 22:21102272-21102294 TAGGTGCATCACACCGAGGCTGG - Intergenic
1182241103 22:28917099-28917121 CTAGGCAATCACACAGTGGCAGG - Intronic
1183531450 22:38356067-38356089 CAGTGGAAACACACAGCGGCAGG + Intronic
1184032362 22:41902605-41902627 CATGGGAGTCCCACCATGGCTGG - Intronic
950567747 3:13781013-13781035 CAGGGGAATCTCTCAGTGGCTGG + Intergenic
952236386 3:31484737-31484759 CAGGTGCATGCCACCGTGGCCGG - Intergenic
953942176 3:47109706-47109728 CAGGGGTAAGCCACCGTGGCTGG - Intronic
953972262 3:47356433-47356455 CCGGGGGACCACACCGGGGCGGG + Intergenic
954158339 3:48701071-48701093 AAGTGGAATGACAACGTGGCTGG + Intronic
965574210 3:170201913-170201935 CAGGTGCACCCCACCGTGGCTGG + Intergenic
966458456 3:180145627-180145649 CAGGGGCATCCCACCATGCCTGG + Intergenic
974757676 4:66232579-66232601 CGGGGGAAGCACAGCGTGGTTGG - Intergenic
976011373 4:80493354-80493376 TAGGGGAATGACACAGTAGCAGG - Intronic
981617388 4:146655544-146655566 CAGCGGAATGTCACCCTGGCCGG + Intergenic
985877994 5:2614774-2614796 CAGTGGAAGCATGCCGTGGCCGG - Intergenic
985892638 5:2727611-2727633 CAGAGAAATCACACCGTCGCTGG + Intergenic
988227382 5:28429692-28429714 CAGGGGCATGACACCATGTCAGG + Intergenic
991384466 5:66069960-66069982 CATAGGAATCACATGGTGGCAGG - Intronic
994306983 5:98217289-98217311 CAGGGGAATTTCCCCGTGGATGG + Intergenic
997638884 5:135435567-135435589 CAGGGCACTCACACCGTTGCAGG + Intergenic
999504600 5:152181654-152181676 AAGGTGAATCACACATTGGCTGG - Intergenic
1008222058 6:48866695-48866717 CATGGGAATAACAACGTGGTTGG + Intergenic
1008632099 6:53371891-53371913 CAGGTGAACGCCACCGTGGCTGG - Intergenic
1009707749 6:67276649-67276671 CAGGGGACTCAAACCATGCCAGG + Intergenic
1013062684 6:106652298-106652320 CAGGGGAATGAGACCATGACGGG - Exonic
1013747435 6:113362539-113362561 CTGGGGAAAGACAACGTGGCAGG + Intergenic
1014263223 6:119244817-119244839 CAGGGGACTCACAGCCTGGTTGG - Intronic
1014913755 6:127120685-127120707 CAGGTGAATCAAACCTTGTCTGG - Intronic
1015428117 6:133096266-133096288 AAGGTGAATCACACAGTGCCTGG + Intergenic
1017035383 6:150262516-150262538 CAGGGTGAGCACACCGTGCCGGG - Intergenic
1019780997 7:2939655-2939677 TTGGGGACTCACACCCTGGCAGG + Intronic
1020098244 7:5380301-5380323 CAGGGGCATGACACCATGCCTGG - Intronic
1022595411 7:31708930-31708952 GAGGGGAATAAAACTGTGGCCGG + Intergenic
1026502453 7:70954502-70954524 CATGGGAGTGACACCGTGGGAGG + Intergenic
1029423133 7:100481929-100481951 CAGGAGAATCACAACCTGGGAGG - Intergenic
1029470433 7:100751111-100751133 CAGTGGAATCACAGAGTTGCTGG + Intronic
1032552899 7:132802306-132802328 CAGGGGAGTCCCATCGTGTCAGG - Intronic
1033475566 7:141688800-141688822 CAGCAGAATCACCCTGTGGCAGG - Intronic
1034198556 7:149266424-149266446 CACGGAAATCACACTGTGGACGG + Exonic
1034998775 7:155594977-155594999 AAGGGAAATCACACAGAGGCAGG + Intergenic
1037663360 8:20945298-20945320 CAGGGGAAGCACACAGAGCCAGG + Intergenic
1043772870 8:84226516-84226538 CAGGAGAATCACTCAGAGGCAGG - Intronic
1044043985 8:87406753-87406775 CAGGGGAAAGCCACCGTGCCCGG + Intronic
1046819023 8:118616471-118616493 CAAGAGAATCACACAGAGGCAGG + Intronic
1048388287 8:133934523-133934545 CAGGGGAATGACACAGCAGCAGG + Intergenic
1057226944 9:93297424-93297446 CAGGGGAAACAGACAGTGGAAGG - Intronic
1057443654 9:95099148-95099170 CAGGGGAATAACAGCCTGGTTGG + Exonic
1057961756 9:99464099-99464121 CTGGGGAATCACAACCTGGTGGG - Intergenic
1059299974 9:113304484-113304506 CAGGTGCATGCCACCGTGGCTGG + Intergenic
1060548592 9:124474906-124474928 TGAGGGACTCACACCGTGGCTGG - Intronic
1060612332 9:124979001-124979023 CAGGGGAATGCCACTGTGCCTGG + Intronic
1060977895 9:127776104-127776126 CAGGGGTAAGACACCGTGCCTGG + Intronic
1061286829 9:129628339-129628361 CAGGGGAGGCACATCCTGGCCGG - Intronic
1187038086 X:15563763-15563785 GAGGGAAATGACACTGTGGCTGG + Intronic
1189674827 X:43451227-43451249 TAGGGGAATGACACAGTGGTAGG - Intergenic
1189674972 X:43452360-43452382 TAGGGGAATGACACAGTGGTAGG + Intergenic
1190436616 X:50431945-50431967 CAAGGGACTCACAGAGTGGCAGG - Intronic
1190632711 X:52403581-52403603 CAGGTGACTGCCACCGTGGCTGG - Intergenic
1192174755 X:68878681-68878703 CAGGGCCATCACACGGTGCCAGG + Intergenic
1195981629 X:110584417-110584439 GAGGGGAATCAGACACTGGCAGG + Intergenic
1200045186 X:153397252-153397274 CAGGGGAATGCCAGCGAGGCTGG - Intergenic
1201900847 Y:19045162-19045184 CAGGGGAATGACACAGCAGCAGG + Intergenic