ID: 1077453222

View in Genome Browser
Species Human (GRCh38)
Location 11:2663227-2663249
Sequence CCAGCAGATCACTGGAAAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 611
Summary {0: 1, 1: 0, 2: 1, 3: 32, 4: 577}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077453215_1077453222 15 Left 1077453215 11:2663189-2663211 CCTCATGGTGGGTAGGGTGTGAA 0: 1
1: 0
2: 0
3: 8
4: 133
Right 1077453222 11:2663227-2663249 CCAGCAGATCACTGGAAAGCAGG 0: 1
1: 0
2: 1
3: 32
4: 577

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077453222 Original CRISPR CCAGCAGATCACTGGAAAGC AGG Intronic
900998017 1:6133344-6133366 CCCGAAGAATACTGGAAAGCAGG - Intronic
901108698 1:6778175-6778197 CGAGCAGATCACTGGAGGTCAGG - Intergenic
901432881 1:9228388-9228410 CAAGCAGATCACTTGACACCAGG + Intergenic
902058158 1:13619282-13619304 CCAGGAGATGACTGGAAACTGGG + Intergenic
902119283 1:14148104-14148126 CCAGCAGATCACTTGAGCCCAGG + Intergenic
902143548 1:14377354-14377376 CCACCACATCAGTGGAAAGACGG + Intergenic
902163769 1:14553145-14553167 CGGGCAGATCACTGGAAGCCAGG + Intergenic
902857280 1:19217318-19217340 CCAGCAGATCACTTGAGGCCAGG + Exonic
902883814 1:19390665-19390687 CCAGGAGGCCACTGGAAAGACGG + Intronic
903002457 1:20275988-20276010 CCATCAGAGAACTGGTAAGCAGG - Intergenic
903496545 1:23771821-23771843 CCAGCAGATCACTTGAGTCCAGG + Intergenic
903562042 1:24235612-24235634 CAGGCAGATCACTGGAAGCCAGG - Intergenic
904710897 1:32429274-32429296 CCAGCAGATCACTTGAGGTCAGG - Intergenic
905084767 1:35362941-35362963 CCAGCAGATCACTTGAGGTCAGG + Intronic
905221803 1:36452930-36452952 CCAGCAGATCACTTGAGGTCAGG + Intergenic
906058138 1:42931596-42931618 CAAGCAGATCACTGGAGATCAGG + Intronic
906183916 1:43845208-43845230 CCAGTAGATCACTGGAGGCCAGG - Intronic
906464878 1:46069290-46069312 CAGGCAGATCACTTGAAATCAGG + Intronic
906475702 1:46167926-46167948 ACAGCAGATCACTTGAAATCAGG + Intronic
908159634 1:61393768-61393790 CCAGGAGATAACAGCAAAGCTGG + Intronic
909399269 1:75208384-75208406 CCGGCAGATCACTTGAGATCAGG - Intronic
909401342 1:75234681-75234703 CCCACAGATCACTGGGGAGCTGG - Intronic
909407716 1:75311342-75311364 CCAGCAGATCACCTGAAGTCAGG - Intronic
910279887 1:85487954-85487976 CAAGCAGATCACTGGAGGTCAGG + Intronic
910400301 1:86831398-86831420 CGGGCAGATCACTTGAAATCAGG + Intergenic
911216457 1:95200596-95200618 TCAGCAGATCACTTGAGGGCAGG - Intronic
911519750 1:98914512-98914534 CAGGCAGATCACTTGAAACCAGG - Intronic
911635299 1:100228529-100228551 CCAGCAGATCACTTGAGGTCAGG + Intronic
913936318 1:125054079-125054101 CCAGCAGATTCTTGAAAAGCAGG - Intergenic
914253441 1:145940911-145940933 CCAGCAGATCACTTGAGGTCAGG - Intronic
915516779 1:156417937-156417959 CCAGCACCTCAGTGGAAAGGAGG - Intronic
915824232 1:159058124-159058146 CCAGCAGATCACTTGAGGTCAGG + Intergenic
915975144 1:160380819-160380841 CCAGCAGATCACTTGAGGTCAGG - Intergenic
916224581 1:162476530-162476552 CAAGCAGATCACTTGAGATCAGG - Intergenic
916410629 1:164543573-164543595 CAAGCAGATCACTTGAAGTCAGG - Intergenic
916851670 1:168710750-168710772 CCAGGTGACCACTGGAAATCTGG + Intronic
917087436 1:171318086-171318108 CCAGCAGATCACTTGAGGTCAGG + Intronic
917552679 1:176051236-176051258 CCAGCAGATAACTGGCACTCTGG - Intronic
917814293 1:178691845-178691867 CCAGCAGATCACTTGAGGACTGG - Intergenic
919827043 1:201510495-201510517 CCAGCAGATCACTTGAGGTCAGG + Intergenic
919922870 1:202176860-202176882 CCAGGATTCCACTGGAAAGCAGG - Intergenic
920073413 1:203320010-203320032 CCAGCAGATCACTTGAGGTCAGG - Intergenic
920081816 1:203380192-203380214 CCAGCACATCACTGGACTCCAGG - Intergenic
920134436 1:203758209-203758231 CGAGCAGATCACTTGAATTCAGG + Intergenic
920138861 1:203792939-203792961 CCAGCAGATCACTAGAGGTCAGG - Intergenic
920367228 1:205454595-205454617 CCAGTGGAGCAATGGAAAGCCGG + Intronic
920759227 1:208765890-208765912 CCAGCAGATCACCTGATATCAGG + Intergenic
921158718 1:212457954-212457976 CTAGAAGGACACTGGAAAGCTGG + Intergenic
922419581 1:225450505-225450527 CCGGCAGATCACTTGAAGTCAGG - Intergenic
922596263 1:226815818-226815840 CGAGCAGATCACTTGAAGTCAGG + Intergenic
922738025 1:227999972-227999994 CCAGCAGATCTCTTGAACCCAGG - Intergenic
923153742 1:231257770-231257792 CCAGCAGAGAACTGGACAGCTGG - Intronic
923814896 1:237366492-237366514 CCAGAAGATCACTGGAGCCCAGG - Intronic
924361523 1:243246457-243246479 CCAGCAGATCACTTGAGGTCAGG - Intronic
924673449 1:246151826-246151848 CAGGAAGGTCACTGGAAAGCAGG - Intronic
924724913 1:246660496-246660518 CGGGCAGATCACTTGAAATCAGG + Intronic
1063350445 10:5349271-5349293 CCAGCAGATCACTTGAGGTCAGG + Intergenic
1063403969 10:5775058-5775080 CCAGCAGATGGCTTGAACGCAGG + Intronic
1063612826 10:7577162-7577184 CCAGGAGATCACTAGGCAGCAGG + Intronic
1063939887 10:11117471-11117493 GCTGCAGAGCACAGGAAAGCTGG - Intronic
1064180077 10:13107145-13107167 CCAGCAGATCACCTGAAGTCAGG + Intronic
1064509429 10:16073825-16073847 CCAGAAGATCACTTGAGACCAGG - Intergenic
1064536424 10:16362046-16362068 CGAGCAGATCACTGGAGGTCAGG + Intergenic
1065519719 10:26559869-26559891 CGAGCAGATCACTTGAAGTCAGG - Intronic
1065615260 10:27514860-27514882 CAAGCAGATCACTGGAGCCCAGG - Intronic
1065734844 10:28742287-28742309 CCAGCAGATCATTTGAAGTCAGG - Intergenic
1065852972 10:29806006-29806028 CCAGCAGGTCCCTGGAAACAGGG + Intergenic
1067128093 10:43537318-43537340 CCAGCAGATCACTCGAGCTCAGG + Intergenic
1067264136 10:44722472-44722494 CCAGCAGATCACTTGAGGTCAGG - Intergenic
1067457042 10:46426389-46426411 CCGGCAGAGCACTTGAAATCAGG - Intergenic
1067630162 10:47958249-47958271 CCGGCAGAGCACTTGAAATCAGG + Intergenic
1068484549 10:57640634-57640656 CCAGTAGAGCACTTGAAATCAGG - Intergenic
1068829246 10:61473849-61473871 CAAGCAGATCACTTGAAGTCAGG - Intergenic
1069724994 10:70571755-70571777 GCAGCAGATCACTGCAAAATTGG + Intergenic
1070099566 10:73372510-73372532 CCAGCGGATCACTTGAGATCAGG - Intergenic
1071700813 10:87933117-87933139 GCAGCAATTCACTGTAAAGCTGG + Exonic
1072242904 10:93514035-93514057 GTAGCAGATCACTTGAATGCGGG - Intronic
1072667604 10:97405673-97405695 CGAGCAGATCACTTGAAGCCAGG - Intronic
1072675853 10:97465530-97465552 CCAGCAGATCACTTGAGGTCAGG - Intronic
1073112071 10:101068494-101068516 CAGGCAGATCACTGGAGATCAGG - Intergenic
1073551926 10:104411165-104411187 CCAGCAGATCACTTGAGGTCAGG - Intronic
1074279663 10:112038892-112038914 CCAGCAGATCACCTGAGATCGGG + Intergenic
1074318388 10:112379175-112379197 CAGGCAGATCACTTGAAATCAGG + Intronic
1074369814 10:112891169-112891191 CAAGCAGATCACTTGAAGCCAGG - Intergenic
1074556975 10:114500450-114500472 CCAGCAGATCACTTGAGCCCAGG + Intronic
1074935470 10:118175137-118175159 CCAACAAAACACTGGAAAGGGGG - Intergenic
1074939223 10:118218489-118218511 CAGGCGGATCACTGGAAATCAGG - Intergenic
1075106078 10:119541103-119541125 CCAGCACATCACTGAAACGGAGG + Intronic
1075434716 10:122427493-122427515 CCATCAGATCACTGAGCAGCTGG + Intronic
1075645977 10:124096459-124096481 CCACCAGAGCAGAGGAAAGCAGG - Intergenic
1076026764 10:127122117-127122139 CCAGCAGATCACAGGTCACCAGG + Intronic
1077126604 11:941812-941834 CCACCAGATCACTTGAGATCAGG - Intronic
1077453222 11:2663227-2663249 CCAGCAGATCACTGGAAAGCAGG + Intronic
1077617688 11:3689862-3689884 CCAGCAGATCACTTGAGCCCAGG - Intronic
1077646378 11:3929076-3929098 CGAGCAGATCACTTGAGATCAGG - Intronic
1078156328 11:8803155-8803177 CAAGCAGATCACTTGAGGGCAGG + Intronic
1079261920 11:18890762-18890784 CCAGCAGGAGACTGGAAAGCAGG + Intergenic
1079429130 11:20371664-20371686 CAAGCAGATCACTTGAACCCAGG - Intronic
1081486443 11:43533584-43533606 CCAGCAGGAGACTGGAAAGTGGG - Intergenic
1081769882 11:45643408-45643430 CCTCCTGAGCACTGGAAAGCAGG - Intergenic
1081920752 11:46773769-46773791 CAAGCAGATCACTTGAGATCAGG - Intronic
1082092251 11:48099619-48099641 ATAGGAGATCACTGGAGAGCTGG - Intronic
1083184818 11:61011384-61011406 CCAGCAGCTCACAGGAAAGTGGG - Intronic
1083352052 11:62036715-62036737 CCAGCAGATCACTTGAGCCCAGG + Intergenic
1083386790 11:62316966-62316988 CAAGCAGATCACTGGAGGTCAGG + Intergenic
1083800783 11:65045201-65045223 CCAGGACATCTCAGGAAAGCAGG + Exonic
1084350191 11:68591869-68591891 CCAGCAGATCACTGTCACACTGG - Intronic
1084415318 11:69028930-69028952 CAGGCAGATCACTTGAAACCAGG - Intergenic
1085286099 11:75362463-75362485 CAAGCAGATCACTTGAGACCAGG + Intergenic
1085509015 11:77076132-77076154 CAGGCAGATCACTGGAGATCAGG + Intronic
1085551574 11:77378215-77378237 CCTGCAAAACAATGGAAAGCTGG + Intronic
1086331812 11:85761884-85761906 CCGGCAGATCACTTGAAGCCAGG - Intronic
1087183416 11:95160989-95161011 CCAGCAGATCACTTGAGGTCAGG + Intergenic
1087401328 11:97669936-97669958 CCAGCAGATCACTTGAGGTCAGG - Intergenic
1087790628 11:102403235-102403257 CGAGCAGATCACTTGAAGTCAGG - Intronic
1088069318 11:105762249-105762271 CGGGCAGATCACTTGAAATCAGG - Intronic
1088126580 11:106433332-106433354 GCAGCAGATCACTGGAGGTCAGG + Intergenic
1088228025 11:107643112-107643134 CCAGCAGATCACTTGAGGTCAGG + Intronic
1088753827 11:112868606-112868628 CAAGCAGATCACTTGAAGCCAGG - Intergenic
1089738484 11:120565336-120565358 GCAGCAGCTCACTGGAAAGTGGG - Intronic
1089997014 11:122918126-122918148 CAGGCAGATCACTTGAAACCAGG - Intronic
1090015983 11:123086964-123086986 CAAGCAGATCACTTGAAGTCAGG + Intronic
1090170240 11:124595800-124595822 CCAGCAGATCACTTGAGGTCAGG - Intergenic
1090938018 11:131362378-131362400 CCAGAAGATCCCTGGAACCCTGG - Intergenic
1091061040 11:132462439-132462461 ACAGGAGATCACAGGAAAGCTGG + Intronic
1091816988 12:3446155-3446177 CCACCAGATTACTGGCAAGAGGG + Intronic
1092088936 12:5788095-5788117 TCAGCAGAGCACAGGAAAGAAGG - Intronic
1092842267 12:12553968-12553990 CAAGCAGATCACTTGAAGTCAGG + Intronic
1093556068 12:20475499-20475521 CCAGCAGATCACTTGAGGTCAGG + Intronic
1093733135 12:22588600-22588622 CAGGCAGATCACTGGAAGTCAGG - Intergenic
1093783371 12:23163303-23163325 CCGGCGGATCACTTGAAACCAGG - Intergenic
1094014421 12:25847314-25847336 CCAGCAGATCACTGGAGGTCGGG - Intergenic
1094138348 12:27153109-27153131 CCAGCAGATCACTTGAGGTCAGG + Intergenic
1094616140 12:32038054-32038076 CGAGCAGATCACTTGAAGTCAGG - Intergenic
1095091916 12:38115560-38115582 GCGGCAGATCACTTGAAACCAGG + Intergenic
1095957626 12:47815836-47815858 CAGGCAGATCACTTGAAGGCAGG - Intronic
1096278651 12:50232594-50232616 CCAGCAGATCACTTAAACTCAGG - Intronic
1096296528 12:50388823-50388845 CGAGCAGATCACTTGAGATCAGG + Intronic
1097019945 12:56013421-56013443 CAAGCAGATCACTTGAAGTCAGG - Intronic
1097091115 12:56506082-56506104 CCAGCAGATCACTTGAGGACAGG + Intergenic
1097099396 12:56576108-56576130 CGAGCAGATCACTTGAGATCAGG + Intronic
1097463821 12:59897939-59897961 CCAGCAGATCACTTGAGGTCAGG - Intergenic
1098928797 12:76384811-76384833 CCTGTAGATGACTGCAAAGCTGG + Intronic
1099848612 12:88062004-88062026 CGGGCAGATCACTGGAAGTCAGG - Intronic
1099949385 12:89283849-89283871 CAGGCAGATCACTTGAAGGCAGG + Intergenic
1100588935 12:96005973-96005995 CAAGCAGATCACTTGAAGTCAGG - Intronic
1101213682 12:102560164-102560186 TCAGCGGGTCACTGGATAGCAGG + Intergenic
1101713454 12:107289850-107289872 CCAGCAGATCACTTGAGGTCAGG - Intergenic
1102124122 12:110466721-110466743 CCAGCAGATCACTTGAGCCCAGG - Intronic
1102299272 12:111759230-111759252 CAGGCAGATCACTTGAAATCGGG - Intronic
1102306617 12:111809488-111809510 CCTACAGATCACAGGGAAGCAGG + Intronic
1102486448 12:113260963-113260985 CCTGCAGATCACTTGAGATCAGG + Intronic
1102972868 12:117184524-117184546 CCAGCAGATCACGTGACATCAGG + Intronic
1103115478 12:118325905-118325927 CCTGCAGATCACTTGAAGTCAGG - Intronic
1104197770 12:126557323-126557345 CCTGCAGCTCACAGGAGAGCCGG + Intergenic
1105301180 13:19136216-19136238 CCAGCAGATCACTTGAGGTCTGG + Intergenic
1105513157 13:21067917-21067939 CCAGCAGATCACTTGAGGTCAGG - Intergenic
1105792167 13:23812401-23812423 CCAGCAGAGGACAGGAAAGGAGG + Intronic
1106508084 13:30389032-30389054 TCAGAAGAGCACAGGAAAGCAGG - Intergenic
1107765060 13:43725736-43725758 CCAGCAGATCACTTGAGCTCAGG + Intronic
1108279873 13:48850663-48850685 CCAGCAGATCACTTGAGGTCAGG + Intergenic
1108428012 13:50324849-50324871 CAGGCAGATCACTTGAGAGCAGG - Intronic
1108894541 13:55308343-55308365 CCGGCAGATCACTTGAAGTCAGG + Intergenic
1109616877 13:64846994-64847016 CTGGCAGATCACTTGAAATCAGG - Intergenic
1110103448 13:71638635-71638657 CTAGAAGATTAGTGGAAAGCAGG + Intronic
1111003199 13:82212815-82212837 CCAGCAGATCACTTGAGCCCAGG + Intergenic
1112017545 13:95343849-95343871 CGAGCAGATCACTTGAAGCCAGG - Intergenic
1113595421 13:111528426-111528448 CCAGAAGCCCACTGGACAGCAGG - Intergenic
1113645689 13:111993766-111993788 CCAGCTGATCATTAGAAAGGTGG - Intergenic
1115321371 14:32082765-32082787 CCAGCAGATCACTTGAGGTCAGG - Intronic
1115994062 14:39177155-39177177 CCAGCAGATCACTTGAGCCCAGG + Intronic
1117674292 14:58140351-58140373 CCAGCAGATCACTTGAGGTCAGG + Intronic
1118215179 14:63802332-63802354 CGAGCAGATCACCTGAGAGCTGG - Intergenic
1118343871 14:64919653-64919675 CTAGCAGATCACTGGAGGTCAGG + Intronic
1118899027 14:69971243-69971265 CAGGCAGATCACTGGAGATCAGG - Intronic
1119201556 14:72756583-72756605 CCAGCAGATCACTGAAGCCCAGG + Intronic
1119922800 14:78461978-78462000 ACAGCAGTTCAATGCAAAGCTGG - Intronic
1120019226 14:79509277-79509299 CGAGCAGATCACTTGAGATCAGG + Intronic
1120256933 14:82132448-82132470 CCAGCAGGTGATTGGAAAGTGGG + Intergenic
1120417648 14:84240211-84240233 CCAGCAGATCACTTGATGTCAGG + Intergenic
1120962939 14:90141683-90141705 CCAGCAGATCACTTGAGGTCAGG - Intronic
1121151075 14:91635583-91635605 CCAGCAGATCAGTTGAGACCAGG - Intronic
1122035427 14:98945947-98945969 CCAGCAGCTCACTGGGAACGAGG - Intergenic
1123683935 15:22784189-22784211 CCAGCAGATCACTTGAGCCCAGG - Intronic
1124472727 15:30002626-30002648 CCAGCAGATCACTTGAGATCAGG - Intergenic
1125688912 15:41580857-41580879 CAGGCAGATCACTTGAAATCAGG - Exonic
1125871834 15:43109215-43109237 CCAGCGGATCACTGGAGGTCAGG + Intronic
1126013927 15:44331242-44331264 CAAGCAGATCACTGGAGGCCAGG - Intronic
1126842527 15:52731127-52731149 CGGGAAGATCACTTGAAAGCAGG - Intergenic
1126875333 15:53035045-53035067 CCAGCACCTCCCTGAAAAGCAGG + Intergenic
1127232084 15:57007635-57007657 CAAAAAAATCACTGGAAAGCTGG - Intronic
1127497909 15:59529823-59529845 CAAGCAGATCACTTGAACTCAGG + Intergenic
1127974876 15:63989917-63989939 CGGGCAGATCACTGGAGACCAGG - Intronic
1128054981 15:64692658-64692680 CCAGCGGATCACTGGAGGTCAGG - Intronic
1128134272 15:65251109-65251131 CCTGCAGATCACTTGAAGTCAGG - Intronic
1128331010 15:66755738-66755760 CCAGCAGAGCAGTGGAGAGGAGG - Intronic
1128596126 15:68951649-68951671 CCAGCGGATCACTTGAGATCAGG - Intronic
1128757754 15:70195020-70195042 CCAGCAGCTCTCAGGGAAGCAGG - Intergenic
1129071037 15:72952011-72952033 CTTGCTGATCACTGGAGAGCTGG - Intergenic
1129095355 15:73200907-73200929 CCAGCAGATCACTTGAGCTCAGG - Intronic
1129339509 15:74875975-74875997 CGAGCAGATCATTTGAAATCAGG - Intergenic
1129365418 15:75051103-75051125 CCAGCAGATCACTTGAGGTCAGG - Intronic
1129376880 15:75139074-75139096 CCAGCTGAGCTCTGGAAAGTGGG + Intergenic
1129616346 15:77101295-77101317 CCAGGAGATATTTGGAAAGCTGG + Exonic
1130443267 15:83976318-83976340 CCAGCACACCACTGGACAGGAGG + Intronic
1131226165 15:90626004-90626026 CCACCAGGTCACTGCTAAGCAGG - Intronic
1131250646 15:90828037-90828059 CCTCCAGATCACTGCAAAGTGGG + Intergenic
1131474922 15:92730088-92730110 CAAGCAGATCACTGGAAGTTGGG + Intronic
1131991820 15:98100359-98100381 CAAGCAGATCACTTGAGATCAGG + Intergenic
1132187234 15:99811624-99811646 ACAGCTAATCACTGGAAATCGGG + Intergenic
1132663510 16:1071757-1071779 CCAGCAGCTCCCTTGAAGGCCGG - Intergenic
1132732334 16:1368671-1368693 CCAGCAGATCACTTGAGGTCAGG + Intronic
1133299771 16:4775225-4775247 CCAGCAGATCGCTGTAGGGCAGG + Intergenic
1133687610 16:8180961-8180983 CCAGCACATCACTGAAACTCAGG + Intergenic
1133787828 16:8986729-8986751 CCAGCAGATCACTTGAGGTCAGG - Intergenic
1134155712 16:11841587-11841609 CCAGAAGATAACTGAAAAGTCGG + Intronic
1134485456 16:14654720-14654742 CAGGCAGATCACTTGAAATCAGG - Intronic
1134602998 16:15548210-15548232 CCAGCAGATCACTTGAGATCAGG - Intronic
1135626998 16:24004412-24004434 CCAGCAGATCACTTGAGCTCAGG + Intronic
1136466380 16:30446859-30446881 CCAGCAGATCACTTGAGGTCAGG - Intergenic
1137539460 16:49352102-49352124 CCAGCAGATCACTTGAGCCCAGG + Intergenic
1137732693 16:50700219-50700241 CCAGAAGATCACTTGAGCGCAGG - Intronic
1138083588 16:54114675-54114697 GCAGCAGATCACTGGAGGTCAGG + Exonic
1138432670 16:56979052-56979074 CGGGCAGATCACTTGAAACCAGG - Intronic
1138445090 16:57058591-57058613 CCAGCAGGTCACGGGAGAGATGG - Intronic
1138689951 16:58757832-58757854 CCAGTGGATCACTTGAAATCAGG + Intergenic
1138813462 16:60177749-60177771 CCAGCAGAGCAGGGGAAAGTTGG - Intergenic
1138904678 16:61316613-61316635 CAAGCAGATCACTGGAGGTCAGG - Intergenic
1139729694 16:68932555-68932577 CAAGCAGATCACTTGAGATCAGG + Intronic
1140166729 16:72560068-72560090 CCAGCAGATCACTTGAGGTCAGG + Intergenic
1141268365 16:82517245-82517267 CCAGCAGTGCACTGGCATGCAGG + Intergenic
1141296647 16:82775980-82776002 CCAGCAGATCACTTGAGGCCAGG + Intronic
1141565938 16:84902024-84902046 CCGGCAGATCACTTGAGATCAGG - Intronic
1141648982 16:85382536-85382558 ACAGCAGAGCCCTTGAAAGCAGG + Intergenic
1141905056 16:87019185-87019207 CAAGCAGATCACTGGAAGCCAGG + Intergenic
1142529621 17:571083-571105 CCAGCAGATCACTTGAGCCCAGG + Intronic
1143051298 17:4128116-4128138 CCAGCAGATCACTTGAGGCCAGG + Intronic
1144553541 17:16261993-16262015 CCGGCAGATCACTTGAAGCCAGG + Intronic
1146029465 17:29352574-29352596 TAAGCAGATCACTTGAACGCAGG - Intergenic
1146212955 17:30956322-30956344 CGAGGAAATCGCTGGAAAGCCGG + Exonic
1146263020 17:31433886-31433908 CCAGCTGAGCACTGGAAGGCAGG - Intronic
1146684849 17:34834819-34834841 CGGGCAGATCACTGGAGACCAGG - Intergenic
1146969355 17:37060015-37060037 CCAGCAGATCACTTGAGGTCAGG - Intergenic
1147281780 17:39368003-39368025 CCAGCGGATCACTGGAGGCCAGG - Intronic
1147592792 17:41695654-41695676 CCAGCAGATCACTTGAGGTCAGG + Intergenic
1147705840 17:42424150-42424172 CCAGCAGATCACTTGAGCTCAGG - Intergenic
1147913593 17:43873146-43873168 CCGTCAGATCTCTGGAAAGAAGG + Intergenic
1148044546 17:44734874-44734896 CCAGCAGATCACTTGAGGTCAGG + Intronic
1148129324 17:45253630-45253652 CCAGCAGATCACTTGAGGTCAGG - Intergenic
1148383006 17:47213668-47213690 CCAGCAGGCCACTGATAAGCAGG - Intronic
1149716915 17:58799805-58799827 CCAGCAGATCACTTGAGCTCAGG - Intronic
1150067434 17:62123388-62123410 CCAGCAGATCACTTGAGCCCAGG - Intergenic
1150810866 17:68356107-68356129 CCAGCAGATCACTTGAGGTCAGG - Intronic
1150819901 17:68426760-68426782 CCAGCGGATCACTGGAGGCCAGG - Intronic
1151208404 17:72525425-72525447 CAATCAGCTCACTGGAAAGCAGG + Intergenic
1151243841 17:72779214-72779236 CCAGCAGATCACTTGAGGTCAGG + Intronic
1151539564 17:74758180-74758202 CCAGCAGTCACCTGGAAAGCTGG - Intronic
1151675112 17:75593368-75593390 CGAGCAGATCACTTGAAGTCAGG + Intergenic
1152557651 17:81062176-81062198 CAGGCAGATCACTTGAGAGCAGG - Intronic
1152651499 17:81495875-81495897 CCAGCGGATCACTTGAACCCAGG + Intergenic
1152768976 17:82156066-82156088 CAGGCAGATCACTTGAAACCAGG + Intronic
1152859782 17:82689434-82689456 CCAGCCTGTCACTGGAAATCAGG + Intronic
1152969809 18:150605-150627 CGAGCAGATCACTTGAGAACAGG + Intergenic
1153224046 18:2884471-2884493 CCAGCAGATCACTTGAGGCCAGG - Intronic
1153233529 18:2964052-2964074 CAAGCAGATCACTTGAAGTCAGG + Intronic
1153483094 18:5567031-5567053 CCAGCAGATCACTTGATGTCAGG - Intronic
1155266106 18:24095469-24095491 CCAGCAGATCACCTGAGATCAGG + Intronic
1155874552 18:31069485-31069507 CAAGCAGATCACTTGAAATGAGG + Intronic
1156032617 18:32730175-32730197 CCAGCAGATCAAGGTGAAGCAGG - Intronic
1156056772 18:33015026-33015048 CGTGCAGATCACTTGAAATCAGG + Intronic
1157255990 18:46140043-46140065 CAGGCAGATCACTGGAGATCAGG - Intergenic
1157283905 18:46364173-46364195 CTTGCAGATCACTTGAAATCAGG - Intronic
1157448496 18:47767030-47767052 CAAGCAGATCACTTGAGATCGGG + Intergenic
1157665053 18:49479128-49479150 CCCGCAGCTCTCTGGAAAACAGG + Intronic
1159063679 18:63543842-63543864 CCAGCAGATCACTTGAGGTCAGG - Intergenic
1159190392 18:65034467-65034489 CCAGGGGATCATTGGAAAGATGG - Intergenic
1159378417 18:67624954-67624976 CCATCACAACACTGGAAATCTGG + Intergenic
1159728189 18:71990115-71990137 CCAGGAGCTCACAGGAAAGATGG + Intergenic
1160075596 18:75672902-75672924 CCAGCAGATCACTTGAGGTCAGG + Intergenic
1160932496 19:1577290-1577312 CCAGAAGCTCCCTGGAGAGCTGG + Exonic
1161079765 19:2304934-2304956 CAGGCAGATCACTGGAGATCAGG - Intronic
1161172360 19:2819289-2819311 CGGGCAGATCACTGGAAGTCAGG + Intergenic
1161511383 19:4674114-4674136 CCAGCAGATCACTTGAACCCAGG - Intergenic
1162444058 19:10711687-10711709 CAAGCAGATCACTTGAAGTCTGG - Intronic
1162609080 19:11735505-11735527 GCTGCAGAGCACTGGAAAGTTGG - Intronic
1162659980 19:12161308-12161330 GCTGCAGAGCCCTGGAAAGCAGG + Intergenic
1162664633 19:12199863-12199885 GCCACAGAGCACTGGAAAGCTGG + Intergenic
1162696762 19:12482724-12482746 GCTGCTGAGCACTGGAAAGCTGG - Intronic
1162697263 19:12485912-12485934 CCAGCAGATCACTTGAGCCCAGG - Intronic
1162699043 19:12499987-12500009 CCAGCAGATCACTTGAGGCCAGG - Intronic
1162899395 19:13785562-13785584 CCAGCAGATCACTTGAGGTCAGG + Intergenic
1163031703 19:14548800-14548822 TGAGCAGATCACTTGAAATCAGG - Intronic
1163155132 19:15435893-15435915 CAGGCGGATCACTGGAAGGCAGG + Intronic
1163297933 19:16424388-16424410 CCAGAAGATCACTAGAGAGGTGG + Intronic
1163422761 19:17223961-17223983 GCAGGAGATCACTTGAAACCGGG - Intergenic
1163428312 19:17251389-17251411 CCAGCAGATCACTTGAGGTCAGG - Intronic
1163530655 19:17847123-17847145 CCAGCGGATCACTGGAGGTCAGG - Intronic
1163839060 19:19594665-19594687 CCAGCAGCTCACTGGTAGGAAGG + Intronic
1163915039 19:20233787-20233809 ACTGCAGAGCCCTGGAAAGCTGG - Intergenic
1164226624 19:23251683-23251705 CCGGCAGATCACCGGAAGTCGGG - Intergenic
1165087122 19:33358183-33358205 CCAGCAGATCACTTGAGGTCAGG - Intergenic
1165201438 19:34148174-34148196 CCAGCAGATCACTTGAGGTCAGG - Intergenic
1165843899 19:38805842-38805864 CCAGCAGATCACTTGAGGCCAGG + Intronic
1166044887 19:40224180-40224202 CCGGCAGATCACTTGAGATCAGG - Intronic
1166089539 19:40499265-40499287 CAAGCAGATCACTTGAAGTCAGG - Intronic
1166854328 19:45775743-45775765 CAGGCAGATCACTGGAAGTCAGG - Intronic
1167538347 19:50069728-50069750 CCAGCGGATCACTTGAGATCAGG + Intergenic
1167560071 19:50221702-50221724 CCAGCAGATCACCCGAAGTCAGG - Intronic
1168595648 19:57673979-57674001 CGGGCAGATCACTTGAAACCAGG - Intronic
926126307 2:10274180-10274202 CCAGCACATCACAGGAAACAGGG + Intergenic
926650770 2:15342024-15342046 CCAGCACATCACTGGAAGCATGG - Intronic
927995259 2:27480881-27480903 CCAGCACACCAATGGATAGCGGG + Intronic
928396629 2:30947619-30947641 CCAGCAGGTCCCTGGGAACCAGG + Intronic
928612560 2:33004894-33004916 CCAGGAAATCATTGGAAAGCTGG + Intronic
930713021 2:54567034-54567056 ACAGCTGCTCACTGGAAAGCAGG - Intronic
931632223 2:64311538-64311560 CCAGCAGATAACTTGAATGAAGG + Intergenic
931646568 2:64427341-64427363 CCAGCAGATCACTTGAGCTCAGG - Intergenic
932107396 2:68957763-68957785 CCAGCAGATCACTTGAGGTCAGG + Intergenic
932560666 2:72865218-72865240 CCAGCAGATCACTTGAGATCAGG - Intergenic
932733996 2:74241511-74241533 CCGGCAGATCACTTGAAGTCAGG + Intronic
933298543 2:80517471-80517493 CCAGCAGAACAGTGCACAGCTGG - Intronic
935690171 2:105723816-105723838 CCAGCAGATCACTTGAGGTCAGG + Intergenic
936003357 2:108858114-108858136 CGGGCAGATCACTGGAGATCAGG + Intronic
936812937 2:116423709-116423731 CGAGCAGATCACTTGAGACCAGG - Intergenic
939410938 2:141823899-141823921 CAAGCAGATCACTTGAACTCAGG - Intronic
939972073 2:148673811-148673833 CCAGCAGATCACTTGAGGTCAGG - Intronic
940229555 2:151435994-151436016 CCAGCAGATCACTTGAGGTCAGG + Intronic
940239076 2:151543712-151543734 CCAGAGGATCACTGGAGTGCAGG - Intronic
941889127 2:170559825-170559847 TCAGCAAAACACTGGAAAGAGGG - Intronic
942219392 2:173754775-173754797 CCAGCCGTTCACTGGATGGCAGG - Intergenic
943915735 2:193629465-193629487 CAAGCAGATCACTTGAGATCAGG + Intergenic
944240889 2:197483970-197483992 CCAGCAGATCACTTGAGGTCAGG + Intergenic
945574762 2:211516560-211516582 CCAGCAGATCACTTGAGGCCAGG - Intronic
946032361 2:216715385-216715407 CCAGTAGGTCACTGGGAAGAAGG + Intergenic
946259565 2:218475505-218475527 CCAGCAGATCACTTGAGGCCAGG + Intronic
946563816 2:220941382-220941404 CCAGCAGAGAACTGGGAAGTAGG - Intergenic
946601125 2:221361492-221361514 CCAGCAGCTCACCTGAGAGCAGG + Intergenic
946771056 2:223089438-223089460 CCAGGGGAGCACTGGAAGGCAGG + Intronic
946925119 2:224618790-224618812 CAGGCAGATCACTTGAAATCAGG + Intergenic
947662263 2:231878471-231878493 CCGGAAGATCACTGGAACCCAGG - Intergenic
948372942 2:237502102-237502124 CCACCAGATTACAGGAAAACAGG - Intronic
1168798821 20:630761-630783 CCAGGAGCTCACTGGCTAGCAGG - Intergenic
1169441515 20:5637697-5637719 CAAGCAGATCACTTGAAGTCAGG - Intergenic
1169561253 20:6803097-6803119 CCAGCAGATCACTTGAGGTCAGG - Intergenic
1170725373 20:18921393-18921415 CCAGCAGATGACTTGAGATCAGG - Intergenic
1170845498 20:19958639-19958661 CGAGCAGATCACTTGAGATCAGG + Intronic
1170925644 20:20720885-20720907 GCAGAAGATCACTTGAAACCAGG + Intergenic
1171424393 20:25040548-25040570 CCAGCACAGCACTGGGGAGCAGG - Intronic
1172751091 20:37251847-37251869 CCAGGATATCACTGGTGAGCAGG - Intronic
1172806358 20:37614802-37614824 CAAGCAGATCACTTGAAGTCAGG - Intergenic
1173083034 20:39887880-39887902 CAGGCAGATCACTGGAACTCAGG - Intergenic
1173281675 20:41633820-41633842 CAAGCAGATCACTTGAAGTCAGG - Intergenic
1173595350 20:44255599-44255621 CCAGCAAATAAGTGTAAAGCTGG + Intronic
1173919834 20:46735307-46735329 CCAGCACATCACTGGATACAAGG - Exonic
1173996228 20:47340564-47340586 CGAGCAGATCACTTGAGATCAGG + Intronic
1174229307 20:49031454-49031476 CAAGCAGATCACTTGAAGCCAGG - Intronic
1174359009 20:50016226-50016248 CCAGGAGGTCGCTGGAAAGGCGG + Intergenic
1174492178 20:50907823-50907845 CCAGCAGATCACTTGAGCTCAGG - Intronic
1175085376 20:56453951-56453973 CGAGCAGATCACTTGAAGTCAGG + Intronic
1178303615 21:31472297-31472319 CGGGCAGATCACTTGAAGGCAGG + Intronic
1178582407 21:33847848-33847870 CCAGGAGATCAGAGGAAAGATGG - Intronic
1178839724 21:36129132-36129154 CAGGCAGATCACTTGAAACCAGG - Intergenic
1179153879 21:38832765-38832787 TCTGCAGATCACTGGAAGCCAGG + Intergenic
1179523001 21:41957390-41957412 CCAGCAGATGGATGGGAAGCGGG - Intergenic
1179723622 21:43329896-43329918 CCAGCAGATCCCTGGACACACGG - Intergenic
1180751006 22:18124199-18124221 GCAGCTGATCACAGGAAAGGAGG + Exonic
1181358161 22:22314320-22314342 CCAGCAGAGCACAGAAAACCAGG - Intergenic
1182236406 22:28880440-28880462 CAAGCAGATCACTCGGCAGCAGG - Intergenic
1182368578 22:29795152-29795174 CAAGCAGATCACTTGAGACCAGG - Intronic
1182418100 22:30234300-30234322 CCAGCAGATCACTTGAGGTCAGG + Intergenic
1183420569 22:37709316-37709338 CCAGCAGCTCACCTGAGAGCCGG - Intronic
1183567639 22:38627338-38627360 CAGGCAGATCACTTGAAATCAGG + Intronic
1183600600 22:38838082-38838104 CCAGCAGATCACTTGAGGTCAGG - Intronic
1183637262 22:39071846-39071868 CCAGCAGATCACTTGAGGTCAGG + Intronic
1184032982 22:41905609-41905631 CCAGCAGATGATTGTTAAGCTGG + Exonic
1184180115 22:42815883-42815905 CCAGCAGATCACTTGAAGTCAGG + Intronic
1184553002 22:45214988-45215010 CCGGCAGATCACTGGAGGTCAGG + Intronic
949995853 3:9616589-9616611 CAGGCAGATCACTTGAGAGCAGG + Intergenic
950071694 3:10157831-10157853 CGAGCAGATCACTTGAAGTCAGG - Intergenic
952722401 3:36546791-36546813 CCTGGAGAGCACTGGAATGCTGG - Exonic
953313543 3:41904203-41904225 CCAGCAGATCACTTGAGTCCAGG + Intronic
953408937 3:42677592-42677614 CGAGCAGATCACTTGAGATCAGG - Intergenic
954236827 3:49263442-49263464 CAAGCAGATCACTGGAGGTCAGG - Intergenic
954890256 3:53921058-53921080 CCAGCAGATCACTTGAGTCCAGG + Intergenic
954930413 3:54276339-54276361 CGGGCAGATCACTTGAAACCAGG + Intronic
954937101 3:54336430-54336452 CCAGCCTATCAGTGGAATGCAGG + Intronic
955318122 3:57955617-57955639 CCAGCAGATCACTTGAGGTCAGG + Intergenic
955319321 3:57963043-57963065 GCAGCAGATCACTTGAGGGCAGG + Intergenic
956856887 3:73283879-73283901 CGAGCAGATCACTTGAAGCCAGG - Intergenic
959867446 3:111287099-111287121 CCAGCACAACACTGGGAAGGGGG + Intergenic
960319739 3:116220088-116220110 CCAGGAGATCACTTGAACCCAGG + Intronic
960641010 3:119823062-119823084 ACAGCATGTCACTGGAAAGAAGG + Intronic
960665713 3:120106986-120107008 CCAGCAGATCACTTGAGGTCAGG + Intergenic
962556284 3:136555454-136555476 CAAGCAGATCACTGGAGGTCAGG + Intronic
962765559 3:138559503-138559525 CCAGCAGATCACTTGAGGCCAGG + Intronic
964115639 3:153133648-153133670 CAAGCGGATCACTTGAAATCAGG + Intergenic
964628622 3:158784060-158784082 CAAGCAGATCACTGGAGGTCAGG - Intronic
965320996 3:167251059-167251081 CCAGCAGACCACTGACCAGCAGG + Intronic
965429599 3:168569652-168569674 CCAGCAGATCACTTGAGGCCAGG + Intergenic
965559919 3:170051495-170051517 CCAGCAGATCACCTGAGATCAGG + Intronic
966417649 3:179705948-179705970 CCAGCAGATCACTTGAGGTCAGG - Intronic
966697787 3:182810102-182810124 CGAGCAGATCACTTGAGATCAGG + Intronic
967019669 3:185511763-185511785 CCTGCAAGTCACTGGTAAGCTGG + Intronic
968294863 3:197568178-197568200 CCAGCAGAACTCAGCAAAGCAGG - Intronic
968335510 3:197909763-197909785 CCAGCAGATCACTTGAGGGCAGG + Intronic
968760053 4:2438058-2438080 GTAGCAGATCACTAGAAAACAGG - Exonic
969758153 4:9163487-9163509 GCAGCAGATCACTTGAGATCAGG - Intergenic
970048394 4:11882504-11882526 CAAGCAGATCACTTGAGATCAGG - Intergenic
970482697 4:16493762-16493784 CAGGCAGATCACTGGAAATCAGG - Intergenic
971309045 4:25507972-25507994 CCAGCAGATCACTTGAGGCCAGG - Intergenic
971543634 4:27855970-27855992 CCAGCAGATCACTTGAGGCCAGG + Intergenic
971648969 4:29246860-29246882 CCAGCAAATCACTGGAGCCCAGG + Intergenic
972117285 4:35652311-35652333 CCAGCAGATCACTTGAGGTCAGG - Intergenic
972538263 4:40017190-40017212 ACAGCAGATCACTTGAGGGCAGG + Intergenic
972798523 4:42447408-42447430 CCAGCAGATCACTTGAGGCCAGG - Intronic
973286370 4:48421232-48421254 CAAGCAGATCACTTGAACTCAGG - Intronic
975139432 4:70904209-70904231 CAGGCAGATCACTTGAAATCAGG - Intronic
975733078 4:77356454-77356476 CCACCAGATCACTGGATTGAGGG - Intronic
976717888 4:88142717-88142739 CAGGCAGATCACTTGAACGCAGG + Intronic
976791881 4:88887758-88887780 CAAGCAGATCACTGGAGGCCAGG - Intronic
976852052 4:89558803-89558825 CCAGCAGATCACTTGAGGTCAGG - Intergenic
977087859 4:92627345-92627367 TTAGCACATCACTGGAAAACAGG - Intronic
977312668 4:95406257-95406279 GAAGCAGAACACTGAAAAGCAGG - Intronic
977565063 4:98572196-98572218 CCAGCGGATCACTTGAGATCAGG - Intronic
977704833 4:100059757-100059779 CGAGCAGATCACTTGAATTCAGG + Intergenic
978367400 4:107996664-107996686 CGAGCAGATCACTTGAAGTCAGG + Intronic
979983345 4:127284239-127284261 CCAGCAGATCACTTGAGGTCAGG - Intergenic
980090889 4:128441823-128441845 CCAGCAGATCACTTGAGGCCAGG - Intergenic
980268323 4:130549223-130549245 CGAGCAGATCACTTGAGATCAGG - Intergenic
981331130 4:143511946-143511968 CGAGCAGATCACTTGAGACCAGG + Intergenic
981902306 4:149880827-149880849 CCAGCAGATCACTTGAGGTCAGG + Intergenic
982292064 4:153790671-153790693 CCAGCAGAGCACCCGGAAGCTGG - Intergenic
982539875 4:156655088-156655110 CCAGCAGACATCTGCAAAGCAGG - Intergenic
982839758 4:160168773-160168795 CAGGCAGATCACTTGAAATCAGG - Intergenic
983951779 4:173650557-173650579 CCAGCAGATGACTAAAAAGTTGG + Intergenic
984379410 4:178971298-178971320 CGGGCAGATCACTTGAAGGCAGG + Intergenic
984513482 4:180709049-180709071 CCAGCAGATCACTTGAGGTCAGG + Intergenic
984588829 4:181593754-181593776 CCATCAGATCATGTGAAAGCTGG + Intergenic
985745993 5:1648017-1648039 CGAGCAGATCACTTGAGATCAGG + Intergenic
986840615 5:11692827-11692849 CCGGCAGATCACTTGAGATCAGG - Intronic
986851579 5:11819204-11819226 CCGGCGGATCACTGGAAGTCAGG + Intronic
986915621 5:12616139-12616161 CAAACAGATCACAGGAAAGGTGG + Intergenic
987325095 5:16805233-16805255 CCAGCAGATTACTTGAAGTCAGG + Intronic
988543592 5:32135945-32135967 CAAGCAGATCACTTGAAGCCAGG + Intronic
989038711 5:37203743-37203765 CCAGCAGATCACTTGAGCCCAGG - Intronic
989304588 5:39938590-39938612 CCAGCAGATCACCTGAGATCAGG + Intergenic
989664088 5:43832581-43832603 TCAGCAGAGCACTGGCAAGAGGG - Intergenic
990401034 5:55437680-55437702 CCAGAAGAACACTGGAAAGCAGG + Intronic
990460361 5:56025914-56025936 CCAGCAGATCACTTGAGCCCAGG - Intergenic
990478133 5:56181820-56181842 CAAGCAGATCACTTGAGATCAGG - Intronic
990530274 5:56666761-56666783 CCAGCAGATAATTGGAAGGAGGG - Intergenic
991578834 5:68133158-68133180 CCAGCAGATCACTTGAGGTCAGG - Intergenic
992417350 5:76564788-76564810 CCATCAGATCCCTGGAAGGCCGG + Intronic
992735904 5:79720661-79720683 CCAGCAGATCACTTGAGGTCAGG - Intronic
993139218 5:84009037-84009059 CAGGCAGATCACTGGAAACCAGG - Intronic
993593588 5:89825882-89825904 CCAGCAGATCACTTGAGGTCAGG - Intergenic
993724924 5:91356176-91356198 CCAGCAGATCACTTGAGGTCAGG - Intergenic
994189128 5:96848276-96848298 CCAGCAGATCACTTGAGGTCAGG - Intronic
996357327 5:122611030-122611052 CAGGCAGATCACTTGAAATCAGG + Intergenic
996861801 5:128075616-128075638 CCGGCAGATCACTTGAAGTCAGG + Intergenic
997032927 5:130153001-130153023 CGGGCAGATCACTTGAAATCAGG + Intronic
997241818 5:132313295-132313317 CCAGCACATTTCTGGAAAGTGGG - Intronic
998042003 5:138956514-138956536 CGGGCAGATCACTTGAAATCAGG + Intronic
998109960 5:139493756-139493778 CCAGCAGATCACTTGAGGCCAGG + Intergenic
998249863 5:140545193-140545215 CAGGCAGATCACTGGAGATCAGG + Intronic
998456169 5:142275193-142275215 TTAGCAGATCACTGGAAGTCAGG + Intergenic
998766935 5:145498771-145498793 CCAGCAGATCACTTGAGGTCAGG - Intronic
999641366 5:153676565-153676587 CCAGCTGATGACTGTAATGCCGG + Intronic
1000625867 5:163537576-163537598 CAAGCAGATCACTTGAGATCAGG - Intergenic
1000859500 5:166439242-166439264 CGGGCAGATCACTGGAAGTCAGG + Intergenic
1001387735 5:171353702-171353724 CAGGCAGATCACTGGAGATCAGG + Intergenic
1002150907 5:177229969-177229991 CCAGCAGATCACTTGAAGTCGGG - Intronic
1002313934 5:178331361-178331383 GCAGCAGGTGACTGGAGAGCTGG - Intronic
1002502228 5:179654458-179654480 CCAGCAGATCACTTGAGGCCAGG - Intergenic
1003130600 6:3392242-3392264 CCAGCAGAGCAGTGGAAAAGAGG - Intronic
1003212729 6:4081537-4081559 CCAGCAGATCACCTGAAGTCAGG - Intronic
1003283479 6:4713813-4713835 CAGGCAGATCACTGGAGATCTGG - Intronic
1003587909 6:7409696-7409718 CCAGCAGATCACCTGAGATCAGG - Intronic
1005052478 6:21697676-21697698 CCAGCAGATCACTTGAGGTCAGG + Intergenic
1005636595 6:27758720-27758742 CAGGCAGATCACTGGAACTCAGG - Intergenic
1006457594 6:34140840-34140862 CCAGCACTGCCCTGGAAAGCAGG + Intronic
1006488587 6:34366137-34366159 CCAGCAGATCACTTGAGCCCAGG + Intronic
1006549058 6:34805363-34805385 CAAGCAGATCACTTGAAGTCAGG + Intronic
1006553414 6:34844500-34844522 CGGGCAGATCACTTGAAACCAGG - Intronic
1006865256 6:37204654-37204676 CCAGCAGATCACTTGAGGTCAGG + Intergenic
1008622113 6:53280820-53280842 CAAGCAGATCACTGGAGCTCAGG - Intronic
1008641008 6:53462777-53462799 CCAGCAGATCACTTGAGCTCAGG + Intergenic
1009716181 6:67399289-67399311 CCAGCTGCTCACTGAATAGCTGG + Intergenic
1009745648 6:67811498-67811520 CCAGCAGATCAAAGGGAAGAAGG + Intergenic
1010261208 6:73819060-73819082 CCAGAAGATCACTTGAAGTCAGG - Intronic
1010438000 6:75858376-75858398 CCAGCAGATCACTTGAGGCCAGG + Intronic
1010524184 6:76880270-76880292 CCGGCAGATCACTGGAGGTCAGG - Intergenic
1012948890 6:105496413-105496435 CCAGCAGATCAGGGCAAAGGAGG + Intergenic
1012952871 6:105537806-105537828 CCAGCAGATCACCTGAGATCAGG + Intergenic
1013248930 6:108315104-108315126 CCAGCAGATCACTTGAGGCCAGG - Intronic
1013872204 6:114778458-114778480 CCAGCAGATCACCGGAGGTCAGG - Intergenic
1014527633 6:122519928-122519950 CCAACAGTTCAGTGAAAAGCTGG - Intronic
1015062315 6:128981513-128981535 CCAGCAGATCACTTGAGCTCAGG + Intronic
1015079437 6:129205795-129205817 CAGGCAGATCACTGGAGACCAGG + Intronic
1016871847 6:148825622-148825644 CCAGCAGATCCGTGGAAAGATGG - Intronic
1017205846 6:151803938-151803960 CCAGCAGACCGCTGGAAAAGTGG + Intronic
1017257260 6:152347915-152347937 CCAGCAGATCACTTGAGGTCAGG - Intronic
1018003282 6:159598209-159598231 CCAGCAGATCACTTGAGGCCAGG + Intergenic
1018025166 6:159800153-159800175 CCAGCAGCACACGGGGAAGCTGG + Intergenic
1018779590 6:167050547-167050569 CCAGCAGATCACTTGAGGTCAGG + Exonic
1018799681 6:167212315-167212337 CCAGAAGGTGGCTGGAAAGCGGG + Intergenic
1021620093 7:22542727-22542749 CGAGGACATCACTGGAAAGGTGG + Intronic
1021920092 7:25476134-25476156 GCACCAGATCACAGGGAAGCAGG + Intergenic
1023963472 7:44947525-44947547 CCAGCAGATCACTTGAGGTCAGG - Intergenic
1025084186 7:56009402-56009424 CGAGCAGATCACTTGAGATCAGG - Intergenic
1025804807 7:64820789-64820811 CAAGCAGATCACTTGAGATCAGG - Intronic
1027628698 7:80575606-80575628 CCAGCCAATCACAGGTAAGCTGG + Intronic
1027802765 7:82776363-82776385 CCAGCAGATCACTTGATGTCAGG + Intronic
1028263334 7:88691109-88691131 CCAGCAGATCACTTGAGGTCAGG - Intergenic
1028891497 7:95992840-95992862 CCAGCAGATCACTTGAGGTCAGG - Intronic
1029031620 7:97474108-97474130 CCAGCAGATCACCTGAAGTCAGG + Intergenic
1029347013 7:99986062-99986084 CCAGCTTAGCACTGGATAGCAGG - Intergenic
1029588932 7:101494352-101494374 CCAGCAGATCACTTGAGGTCAGG - Intronic
1029956052 7:104641244-104641266 CCAGCAATGCACTTGAAAGCTGG + Intronic
1030406560 7:109122070-109122092 CCAGCACATCCGTGGAATGCTGG - Intergenic
1030617326 7:111751843-111751865 CCAGAAGATCACTGGAGCCCAGG - Intronic
1030689585 7:112518738-112518760 CCAGCAGATCACTAGAGGTCAGG + Intergenic
1030932108 7:115537202-115537224 CTAGCAGATCACTTGAAGTCAGG - Intergenic
1032130473 7:129223898-129223920 CCGGCAGATCACTTGAGATCAGG - Intergenic
1032965150 7:137088155-137088177 CCGGCAGATCACTTGAAATCAGG + Intergenic
1033533657 7:142291571-142291593 CCAGCAGCTCCCAGGAGAGCAGG + Intergenic
1033561761 7:142538561-142538583 GCAGCAGAGAAATGGAAAGCAGG + Intergenic
1034159115 7:148979622-148979644 CAAGCAGATCACTGGAGGTCAGG + Intergenic
1034702795 7:153111007-153111029 CCAGCAGCTCCAAGGAAAGCAGG - Intergenic
1035844503 8:2848357-2848379 CCAGCAGATCACTTGAGGTCAGG - Intergenic
1036418043 8:8568804-8568826 CCTGCAGATCACTGCAAACCTGG + Intergenic
1036441136 8:8782040-8782062 CCAACAGAACAGAGGAAAGCAGG - Intergenic
1037589447 8:20300890-20300912 CCAGCAGATCACTTGAGGTCAGG + Intronic
1037860475 8:22401761-22401783 CCAGCAGATCACTTGAGCTCAGG - Intronic
1038740488 8:30212566-30212588 CTAGCAGATCACTTGAACCCAGG + Intergenic
1038880120 8:31601038-31601060 CAGGCAGATCACTTGAAACCAGG - Intergenic
1038939792 8:32291770-32291792 CCAGCAGATCACTTGAGGTCAGG - Intronic
1039107987 8:34010021-34010043 ACAGCCGATCACTGGGAAGAAGG - Intergenic
1040981200 8:53247766-53247788 CCGGCAGATCACTTGAGATCAGG + Intronic
1041912017 8:63098990-63099012 CGAGCAGATCACTTGAGACCAGG + Intergenic
1042283290 8:67078741-67078763 CCAGCAGATCACTTGAGATCAGG + Intronic
1043768203 8:84163898-84163920 CCAGCAGATCACTTGAGCCCAGG - Intergenic
1044686815 8:94833997-94834019 CGGGCAGATCACTGGAAGTCGGG - Intronic
1044917154 8:97127458-97127480 CCAGCAGATCACTTGAGGTCAGG + Intronic
1045081142 8:98627149-98627171 CCAGCAGATCACTTGAACTCAGG + Intronic
1045265748 8:100617375-100617397 CCAGGAGATCTCTGGAAAATTGG + Intronic
1045569544 8:103354817-103354839 CCAGCAGATCACCTGAGATCAGG + Intergenic
1046297926 8:112246185-112246207 CCAGCAGCTTACTTTAAAGCAGG - Intronic
1046443838 8:114289275-114289297 CCAGCAGATCACTTGAGGTCAGG - Intergenic
1046648394 8:116810387-116810409 CAGGCAGATCACTGGAACTCAGG - Intronic
1046672733 8:117074614-117074636 CGAGCAGATCACTGAAAATATGG - Intronic
1046932294 8:119853980-119854002 CCAGAAGATCGCTCGAGAGCAGG + Intronic
1046944497 8:119962011-119962033 CCAGCAGATCACTTGAGGTCAGG + Intronic
1047153262 8:122288411-122288433 CCAGCAAACCACTGGAAACTAGG + Intergenic
1047636779 8:126772315-126772337 TCAGCAAATCAGTGGAAACCAGG - Intergenic
1048375939 8:133822400-133822422 CCAGGAGGACACTGGAAGGCTGG + Intergenic
1048459588 8:134610539-134610561 CCAGAAGATCTCAGGAAAGGAGG - Exonic
1049056144 8:140239019-140239041 CCAGGAGCTCACTGGGAAGAGGG + Intronic
1049056516 8:140241312-140241334 CCAGGAGATCACTTGAACCCAGG + Intronic
1049149077 8:141022743-141022765 CAAGCAGATCACTGGAGGTCAGG + Intergenic
1049162475 8:141106132-141106154 CCAGGAGACCCCTGGGAAGCTGG - Intergenic
1049308783 8:141922388-141922410 CCAGCAGATCCCGGGAAGGCTGG + Intergenic
1049530175 8:143150374-143150396 CCAGCAGATCACTTGAGGTCGGG + Intergenic
1050551777 9:6755008-6755030 CCAGCAGATCACTTGAGCTCAGG + Intronic
1050971887 9:11888281-11888303 CCAGCAGATCTCAGCAAAGGTGG + Intergenic
1051483101 9:17579686-17579708 CCAACACATCCCGGGAAAGCCGG - Intronic
1052515853 9:29478425-29478447 CGAGCAGATCACTTGAGATCAGG - Intergenic
1052699418 9:31920291-31920313 CCAGCAGATCACTTGAGGCCAGG + Intergenic
1052888728 9:33676272-33676294 GCAGCAATTCACTGTAAAGCTGG - Intergenic
1054730261 9:68694877-68694899 TCAGATGATCACTGGAAAGTTGG - Intergenic
1055583448 9:77732159-77732181 CTGGCAGATTACTGCAAAGCAGG - Intronic
1056097403 9:83269477-83269499 CCGGCAGATCACTTGAGATCAGG + Intronic
1057289954 9:93799430-93799452 CAAGCAGATCACTTGAGATCAGG - Intergenic
1057806335 9:98222427-98222449 CCAGCCGATGCCTGCAAAGCTGG + Intronic
1058280750 9:103110521-103110543 ACATCAGATCACTTGGAAGCTGG + Intergenic
1059461209 9:114431496-114431518 CCAGCACAGCACTGGCATGCGGG + Intronic
1060592594 9:124828038-124828060 CCAGCAGATCACTTGAGTTCAGG + Intergenic
1060710916 9:125863123-125863145 CAAGCAGATCACTGGAACCCAGG - Intronic
1060720768 9:125975554-125975576 CAGGCAGATCACTTGAAACCAGG - Intergenic
1061186649 9:129058960-129058982 GCAGCTGAGCACTGGAAACCTGG - Intronic
1061300272 9:129700555-129700577 CGGGCAGATCACTTGAAGGCAGG - Intronic
1186175842 X:6925085-6925107 CAGGCAGATCACTTGAAATCAGG + Intergenic
1186761020 X:12721596-12721618 GCAACAGAGCACTTGAAAGCTGG - Exonic
1186908298 X:14134640-14134662 CAAGAAGATAGCTGGAAAGCTGG - Intergenic
1187151374 X:16684861-16684883 CCGGCAGATCACTTGAGATCAGG + Intronic
1188024936 X:25198240-25198262 CAAGTAGGTCACTGGAAAGCTGG - Intergenic
1188209198 X:27399040-27399062 CCAGAAGAGCACTGGGATGCAGG + Intergenic
1189232148 X:39460871-39460893 CAACCAGATCTCTGGAAAACTGG - Intergenic
1189238742 X:39509127-39509149 CCAGCAGAGTCCTGGACAGCAGG + Intergenic
1189601847 X:42635257-42635279 CCAGCAGATCACTTGAACTCAGG - Intergenic
1190000625 X:46683036-46683058 CCAGCAGATCACTTGAGGTCAGG - Intronic
1191689929 X:63928873-63928895 CCAACAGAGCACTGGTCAGCAGG + Intergenic
1192476021 X:71443936-71443958 CAGGCAGATCACTGGAATTCAGG - Intronic
1193643121 X:84036077-84036099 CAGGCAGATCACTTGAAATCAGG - Intergenic
1194055031 X:89121178-89121200 CCAGCTGATCACTTGAAGTCAGG - Intergenic
1194706477 X:97181296-97181318 CCAGCAGATCACTTGAGGTCAGG - Intronic
1195100547 X:101551018-101551040 CCTGCAGGTCAGTGTAAAGCTGG + Exonic
1195204585 X:102584142-102584164 CGAGCAGATCACTTGAATCCAGG + Intergenic
1195306108 X:103585650-103585672 CCAGCGGAACACTGGAATGGCGG + Intronic
1195581620 X:106510410-106510432 CCAGCAGATCACTTGAGCCCAGG - Intergenic
1195966312 X:110433032-110433054 CCAGCAGAGCACTGCCAAGAGGG + Intronic
1196411703 X:115426673-115426695 GAAGCAGATCACTGCATAGCAGG - Intergenic
1197927226 X:131659460-131659482 CCAGCAGATCACTTGAGGTCAGG - Intergenic
1200412355 Y:2873290-2873312 CAAGCAGATCACTTGAGATCAGG - Intronic
1200829387 Y:7676586-7676608 CCGGCAGATCACTTGAGCGCAGG - Intergenic
1201490660 Y:14537718-14537740 CGAGCAGATCACTGGAGGTCAGG + Intronic
1201514999 Y:14810299-14810321 CCAGCAGATCACTTGAGCTCAGG + Intronic
1201644179 Y:16209645-16209667 CGGGCAGATCACTTGAAACCAGG - Intergenic
1201658636 Y:16375676-16375698 CGGGCAGATCACTTGAAACCAGG + Intergenic
1201698228 Y:16851503-16851525 CAGGCAGATCACTGGAGATCAGG + Intergenic
1202109082 Y:21403346-21403368 CCAGCAAATCACTTGAACCCAGG - Intergenic