ID: 1077456272

View in Genome Browser
Species Human (GRCh38)
Location 11:2683031-2683053
Sequence GACCTTCTCCCACTTCTTAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 358
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 346}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077456270_1077456272 -8 Left 1077456270 11:2683016-2683038 CCTCCTGAGAGAGGTGACCTTCT 0: 1
1: 0
2: 1
3: 18
4: 163
Right 1077456272 11:2683031-2683053 GACCTTCTCCCACTTCTTACAGG 0: 1
1: 0
2: 0
3: 11
4: 346
1077456268_1077456272 3 Left 1077456268 11:2683005-2683027 CCTTAGTTCTGCCTCCTGAGAGA 0: 1
1: 1
2: 2
3: 124
4: 1169
Right 1077456272 11:2683031-2683053 GACCTTCTCCCACTTCTTACAGG 0: 1
1: 0
2: 0
3: 11
4: 346
1077456267_1077456272 18 Left 1077456267 11:2682990-2683012 CCTTGTGCTGTGCAGCCTTAGTT 0: 1
1: 0
2: 1
3: 23
4: 266
Right 1077456272 11:2683031-2683053 GACCTTCTCCCACTTCTTACAGG 0: 1
1: 0
2: 0
3: 11
4: 346
1077456266_1077456272 19 Left 1077456266 11:2682989-2683011 CCCTTGTGCTGTGCAGCCTTAGT 0: 1
1: 0
2: 1
3: 17
4: 192
Right 1077456272 11:2683031-2683053 GACCTTCTCCCACTTCTTACAGG 0: 1
1: 0
2: 0
3: 11
4: 346

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077456272 Original CRISPR GACCTTCTCCCACTTCTTAC AGG Intronic
902083839 1:13841212-13841234 GTCCTTTTCCCACTTTTTAATGG + Intergenic
902281948 1:15381310-15381332 GACCTTCTCCCTCTCCTGGCGGG - Exonic
903353145 1:22730311-22730333 GCCCTTCCCCCACTTCTTGTGGG + Intronic
904281261 1:29420520-29420542 GTCCTTCACCCACTTTTTAATGG + Intergenic
905487399 1:38312478-38312500 GTCCTTTGCCCACTTCTTAAGGG - Intergenic
906051045 1:42872742-42872764 GTCCTTTTCCCACTTTTTAATGG + Intergenic
906732535 1:48095398-48095420 GTCCTTCGCCCACTTTTTAATGG + Intergenic
908960358 1:69690396-69690418 GACTTTTTCCTACTTCTTCCCGG - Intronic
909680708 1:78288183-78288205 TAACTTCTCTCACTTCCTACAGG + Intergenic
910642455 1:89478592-89478614 GTCCTTTACCCACTTCTTAATGG - Intergenic
911319804 1:96399695-96399717 TGCCTTTGCCCACTTCTTACTGG + Intergenic
912151943 1:106870334-106870356 GTCCTTCGCCCACTTTTTAATGG + Intergenic
912757984 1:112340605-112340627 GTCCTTCGCCCACTTTTTAATGG - Intergenic
912946616 1:114090054-114090076 GACCTTCTCACACTAATTTCTGG + Exonic
914344765 1:146789525-146789547 GTCCTTCGCCCACTTTTTATGGG + Intergenic
915919139 1:159961152-159961174 GACTTTCTCTCTCTTCTTCCTGG + Intergenic
915940348 1:160114872-160114894 GACCTTCACACACATCTTAGAGG + Intergenic
916569697 1:166014297-166014319 CACCTTCTTCAATTTCTTACTGG + Intergenic
917352078 1:174088731-174088753 GTCCTTTTCCCACTTTTTAATGG + Intergenic
918458600 1:184753779-184753801 GCCTTTCTCCCATTTCCTACTGG + Intronic
920528141 1:206683923-206683945 GACCTCCTCCCACCTCTGACTGG - Intronic
920611555 1:207444333-207444355 CACCCTCTTCCACTACTTACTGG + Intergenic
921298881 1:213730589-213730611 GTCCTTTGCCCACTTTTTACTGG + Intergenic
921336251 1:214089665-214089687 GTCCTTTGCCCACTTCTTAATGG + Intergenic
921640475 1:217546914-217546936 GTCCTTTACCCACTTCTTAATGG - Intronic
922026969 1:221759140-221759162 CACCTTCTCCCTCTTTTTATAGG + Intergenic
923038297 1:230300928-230300950 GACCTCCTCACCCTTCTTGCTGG + Intergenic
923147311 1:231207201-231207223 AAACTTCTCCCACTTCTCAAGGG + Intronic
1063245736 10:4216403-4216425 GACCTTCAACAACTTCTTCCTGG + Intergenic
1064466185 10:15584520-15584542 AAACTTCACCCACTTCTCACAGG + Intronic
1066597432 10:37066690-37066712 GTCCTTCTCCCACTTTTTGATGG - Intergenic
1066817266 10:39435468-39435490 GTCCTTCACCCACTTTTTAATGG + Intergenic
1068827384 10:61454627-61454649 AGCATTCTCCCACATCTTACAGG + Intergenic
1069702763 10:70438743-70438765 TACCTTCTCCCACTGCTGCCAGG + Intronic
1071010459 10:80934366-80934388 GTCCTTTGCCCACTTTTTACAGG + Intergenic
1071396884 10:85232906-85232928 GACCTGATCCCAGATCTTACAGG - Intergenic
1071454177 10:85830634-85830656 GTCCTTTTCCCACTTTTTAATGG - Intronic
1071667284 10:87571878-87571900 GCCCTTTGCCCACTTTTTACTGG - Intergenic
1071738019 10:88323902-88323924 GACCTTGCCCCACTTTTTAATGG - Intronic
1071751745 10:88486530-88486552 GTCCTTTTCCCACTTTTTAATGG - Intronic
1072578349 10:96720135-96720157 GACCCCCTCCCACTTCTTCAGGG - Intronic
1073372962 10:103007189-103007211 GACCTACTCCCTGTTCGTACAGG - Intronic
1073946543 10:108757277-108757299 AATCTTCTCCCACCTCTTGCTGG + Intergenic
1074853488 10:117456958-117456980 GAGCTGCTCCCACTTCTTAGAGG - Intergenic
1075065821 10:119288255-119288277 GACCTTCTGCCACTCCTGCCGGG - Intronic
1075342668 10:121660035-121660057 CACCTTGTGCCACTTCTCACTGG + Intergenic
1076627023 10:131827751-131827773 GACCTTTACCCACTTTTTAATGG + Intergenic
1076933451 10:133550706-133550728 GTCCTTTACCCACTTCTTAATGG - Intronic
1077456272 11:2683031-2683053 GACCTTCTCCCACTTCTTACAGG + Intronic
1077818940 11:5716666-5716688 GTCCTTCGCCCACTTTTTAATGG - Intronic
1079021914 11:16916183-16916205 GTCCTTCGCCCACTTGTTAATGG + Intronic
1079879471 11:25906889-25906911 GTCCTTCGCCCACTTTTTAATGG - Intergenic
1080005435 11:27401340-27401362 TTGCGTCTCCCACTTCTTACAGG + Intronic
1080219502 11:29884675-29884697 GAAATTCACCCAATTCTTACAGG + Intergenic
1080326112 11:31075709-31075731 GTCCTTCGCCCACTTTTTAATGG + Intronic
1080398975 11:31916401-31916423 GTCCTTCTCACCCTTCTTTCCGG + Intronic
1080759907 11:35238401-35238423 CACCTTCACCCTCTTCTTTCTGG - Intergenic
1081442510 11:43095832-43095854 GACCTTCGCCCACTTTTTGATGG + Intergenic
1082858943 11:57835271-57835293 CACCTTCCCCCACTTCAGACTGG + Intergenic
1083497813 11:63073774-63073796 GACCTTCACCCACTTTTTGATGG + Intergenic
1085375276 11:76054682-76054704 GACTTTCTCTCACTTCCTTCAGG + Intronic
1085813729 11:79712705-79712727 GTCCTTCGCCCACTTTTTAACGG + Intergenic
1086439687 11:86815776-86815798 GATCCTCTCCCACATCTCACAGG + Intronic
1086788999 11:91010799-91010821 GTCCTTTTCCCACTTTTTATTGG - Intergenic
1087848751 11:103003970-103003992 GACCTTTGCCCACTTTTTAATGG - Intergenic
1087946349 11:104164478-104164500 TACCCTCTCCCACTTCCTCCTGG - Intergenic
1088473751 11:110214161-110214183 GTCCTTCTCCCACTTTTTGATGG - Intronic
1089053406 11:115565211-115565233 AACTTTCTACCACTTTTTACAGG - Intergenic
1089518126 11:119046575-119046597 GACCTTCTCCCCCTGGTCACTGG + Exonic
1089534483 11:119152359-119152381 GAGCTGCTCCCCCTTCTGACGGG + Intronic
1090097222 11:123754203-123754225 GGCCTTCTTCCACTTCTTCGTGG - Exonic
1090341599 11:126026672-126026694 GTCCCTCTCCCACTTTTTAAAGG - Intronic
1091509514 12:1107781-1107803 GACATTCTCCCAGTTCTTCAAGG - Intronic
1092651928 12:10644169-10644191 CACCTTCTCCCTGTTCCTACTGG - Intronic
1093085018 12:14857242-14857264 GTCCTTCTCCCACTTTTTATGGG + Intronic
1093368530 12:18335140-18335162 TTTCTTCTCCCACTTTTTACAGG + Intronic
1093609109 12:21132656-21132678 GTCCTTCACCCACTTCTTGATGG + Intronic
1093978569 12:25450807-25450829 GTCCTTTTCCCACTTTTTAATGG - Intronic
1094055313 12:26263318-26263340 GTCCTTTTCCCACTTTTTAATGG - Intronic
1094340588 12:29407126-29407148 GTCCTTCGCCCACTTCTTGATGG + Intergenic
1094434348 12:30404684-30404706 GTCCTTTGCCCACTTTTTACTGG + Intergenic
1094745247 12:33337034-33337056 GTCCTTCTCCCACTTTTTGACGG - Intergenic
1095333691 12:41001423-41001445 GACCTTTGCCCACTTTTTAATGG + Intronic
1095620120 12:44243075-44243097 GTCCTTTGCCCACTTCTTAATGG + Intronic
1096531357 12:52244609-52244631 GGACTTCTCTCCCTTCTTACCGG - Intronic
1096678583 12:53240145-53240167 GACTTGCTCTCACTTCTTTCAGG + Intergenic
1096955509 12:55521492-55521514 GTCCTTCGCCCACTTCTTGATGG - Intergenic
1097537920 12:60897273-60897295 GACCTTCGCCCACTTTTTGATGG + Intergenic
1097725802 12:63074545-63074567 GTCCTTTGCCCACTTCTTAATGG - Intergenic
1098303839 12:69081959-69081981 GTCCTTCACCCACTTCTTGATGG - Intergenic
1098329652 12:69339823-69339845 GACATTCTAGCACTTCTTTCAGG + Intergenic
1099551326 12:84047156-84047178 GACCTTCGCCCACTTTATAATGG + Intergenic
1100936225 12:99670148-99670170 GACCTTTCTTCACTTCTTACCGG + Intronic
1100950533 12:99844068-99844090 GTCCTTTGCCCACTTCTTAATGG + Intronic
1103688916 12:122754266-122754288 CACCTTCTCCCACTCCTTAACGG - Intronic
1106872466 13:34036774-34036796 GTCCTTCTGCCCCTTCTTTCAGG - Intergenic
1109316988 13:60761520-60761542 GTCCTTTGCCCACTTCTTAATGG + Intergenic
1109976554 13:69842361-69842383 GTCCTTCGCCCACTTTTTAATGG - Intronic
1110663830 13:78092317-78092339 CATCTTCTCACACTGCTTACAGG + Intergenic
1110827529 13:79990018-79990040 TTCCTTTTCCCTCTTCTTACAGG + Intergenic
1112205862 13:97322751-97322773 ACCCTTCTCCCACTTCTTCCCGG + Intronic
1114752765 14:25224201-25224223 GACCTTCTTCCAGCCCTTACAGG - Intergenic
1115011066 14:28545224-28545246 GTCCTTCGCCCACTTCTTGATGG + Intergenic
1116162923 14:41292376-41292398 GACCTTTGCCCACTTTTTAATGG - Intergenic
1116239876 14:42326543-42326565 GACCTTTTCCCAATTTTTAATGG + Intergenic
1116305216 14:43245239-43245261 TACCTTGTTCCACTTCTTAGAGG - Intergenic
1116532643 14:45991843-45991865 GTCCTTCTCCCACTTTTTGATGG + Intergenic
1116675995 14:47906362-47906384 GTCCTTCTCCCACTTGTTGATGG - Intergenic
1124591283 15:31055616-31055638 GACATCCTCCCAGTTTTTACTGG - Intronic
1125578783 15:40771544-40771566 GGCCTTCTCCCCTTTCTTCCTGG - Exonic
1126046454 15:44645781-44645803 GTCCTTTTCCCACTTTTTAATGG - Intronic
1127232702 15:57014440-57014462 GACCTTCTCTCATTTCCTCCTGG + Intronic
1127320699 15:57842569-57842591 GTCCTTTACCCACTTCTTAATGG + Intergenic
1127353266 15:58173559-58173581 GTCCTTCTCTCAATACTTACTGG - Intronic
1130070182 15:80640501-80640523 TTCCTTCTCCCACCTCTTCCAGG + Intergenic
1131280047 15:91013769-91013791 TACCTTATCCCACTTCCTCCAGG + Intronic
1135393115 16:22110555-22110577 TAACTTCTCCCTCTTCTTCCTGG - Intronic
1135998555 16:27272055-27272077 AACCTTCTCTCATTTCTTCCTGG - Intronic
1137397159 16:48124314-48124336 CACTCTCTCCCACTTCTTAGAGG + Intronic
1140167667 16:72570744-72570766 GTCCTTCTCCCACTTTTTGATGG - Intergenic
1141468446 16:84222390-84222412 CACCTTCTCCCACTCCTACCTGG - Exonic
1142259419 16:89035878-89035900 GCCCTTCTCCCACTTCCAGCAGG + Intergenic
1203029456 16_KI270728v1_random:562270-562292 GTCCTTCACCCACTTTTTAATGG - Intergenic
1203042265 16_KI270728v1_random:772161-772183 GTCCTTCACCCACTTTTTAATGG + Intergenic
1146117864 17:30158284-30158306 GTCCTTCACCCACTTTTTAATGG + Intronic
1146539207 17:33680172-33680194 GGCCTTCTCCCCATTCTTTCTGG + Intronic
1146693603 17:34892969-34892991 GCCCTTCTCCCCCTTCCTTCTGG + Intergenic
1149530265 17:57389446-57389468 GCCCTTCTCCCCTTTCTTCCTGG + Intronic
1149768768 17:59303130-59303152 GACCTTTGCCCACTTTTTAATGG - Intergenic
1150463866 17:65375280-65375302 GCTCCTCTCCCACCTCTTACTGG - Intergenic
1150475210 17:65469905-65469927 GACCTTCTCCCACATCAAATAGG + Intergenic
1153466141 18:5389827-5389849 GTCCTTTGCCCACTTCTTAATGG - Intergenic
1153548750 18:6238624-6238646 AAACTTCTACCACTTCTTGCTGG + Intronic
1155121128 18:22820136-22820158 GTCCTTCGCCCACTTTTTAATGG + Intronic
1157312122 18:46560381-46560403 GTCCTTCTCCTTCTTCTTCCGGG + Intronic
1159468935 18:68823876-68823898 GTCCTTCGCCCACTTTTTAATGG + Intronic
1159564735 18:70035872-70035894 GTCCTTTGCCCACTTCTTAATGG - Intronic
1159606575 18:70480458-70480480 GTCCTTTTCCCACTTTTTAATGG + Intergenic
1159611047 18:70526018-70526040 GTCCTTTTCCCACTTTTTAATGG + Intergenic
1161363853 19:3867711-3867733 GACCTCCTCCCACATAATACTGG + Intronic
1161630780 19:5354391-5354413 GCTCTTCTCCCACTTCATCCTGG - Intergenic
1162171893 19:8796663-8796685 GTCCTTCTCCCACTTTTTGTTGG + Intergenic
1162186880 19:8912469-8912491 GTCCTTCTCCCACTTTTTGTTGG - Intronic
1163047036 19:14650795-14650817 AAACTTCTCACACTTCTTTCAGG + Intronic
1164387662 19:27789632-27789654 GTCCTTCTCCCACTTTTTGATGG - Intergenic
1164517382 19:28947980-28948002 GACCTCCTCCCTCTACTTGCAGG + Intergenic
1166176033 19:41070752-41070774 GTCCTTTTCCCACTTTTTAATGG + Intergenic
925259253 2:2515901-2515923 GACCTTCTCTCACTGCTTTCTGG + Intergenic
926922504 2:17952928-17952950 ATCCTTCTCCCAAGTCTTACAGG - Intronic
927576038 2:24202461-24202483 GATCTTTTCCCAGTTTTTACTGG + Intergenic
928647463 2:33369659-33369681 GAGATTCTCCCACCTATTACAGG + Intronic
928759929 2:34570312-34570334 CACCTTCTCCCAGTTCCTAAAGG + Intergenic
930028304 2:47043226-47043248 AACTTTCTCCCACTTCCAACAGG - Intronic
930522723 2:52487899-52487921 GTCCTTTGCCCACTTCTTAATGG + Intergenic
930700140 2:54451612-54451634 GTCCTTTTCCCACTTTTTAATGG - Intergenic
931427204 2:62182151-62182173 TTCCTTCTCTCACTTCTTCCTGG + Intergenic
935060570 2:99603797-99603819 GTCCTTTTCCCACTTTTTAATGG - Intronic
935080626 2:99789777-99789799 GTCCTTCTCACACTTCTTAAAGG + Intronic
937828527 2:126394497-126394519 GTCCTTAGCCCACTTTTTACCGG + Intergenic
937940327 2:127280319-127280341 CACCTGCTACCACTTCATACAGG - Intronic
938849768 2:135248604-135248626 GCCCTTCGCCCACTTTTTAATGG - Intronic
939720557 2:145644873-145644895 GACCTTCCCCCACTGCCTGCAGG + Intergenic
941046117 2:160677536-160677558 AACCTTCCCTCACTTCTCACTGG + Intergenic
941423327 2:165311538-165311560 TACCTAATCCCACTTCTCACAGG + Intronic
941546629 2:166859008-166859030 GTCCTTCGCCCACTTTTTAATGG - Intergenic
943535624 2:189146119-189146141 TACCTTCTCCCAGATCTTTCTGG - Intronic
943589515 2:189780657-189780679 GACCTTCTCTTTCTTCTTATGGG - Intronic
943959895 2:194250840-194250862 GTCCTTCTCCCACTTTTTGAAGG + Intergenic
945023854 2:205601324-205601346 GTCCTTCCCCCACTTTTTAATGG + Intronic
946339650 2:219059283-219059305 GACCTTCACCCCCTTCCTTCGGG - Intronic
947146712 2:227074220-227074242 GTCCTTTTCCCACTTTTTAATGG - Intronic
1169115466 20:3062532-3062554 GCCCTTTGCCCACTTTTTACTGG - Intergenic
1169296628 20:4405571-4405593 CACCCTTTGCCACTTCTTACCGG + Intergenic
1170147239 20:13189472-13189494 GTCCTTCGCCCACTTTTTAATGG - Intergenic
1170246975 20:14231960-14231982 GTCCTTCTCCCACTTGTTGATGG + Intronic
1170973640 20:21140433-21140455 GACTTTCTCCCACTTTGTAGAGG + Intronic
1174767449 20:53267297-53267319 GTACTTGTCCCTCTTCTTACTGG - Intronic
1175591534 20:60196245-60196267 GTCCTTCACCCACTTTTTAATGG + Intergenic
1177290222 21:19101793-19101815 GACCTTGTACTTCTTCTTACTGG + Intergenic
1177794213 21:25755887-25755909 GGAATTCTCTCACTTCTTACTGG + Intronic
1178956139 21:37023760-37023782 GCCCTTTTCCCACTTTTTAATGG + Intergenic
1179362222 21:40720982-40721004 GATTTTCACCCACTTCTTTCTGG - Intronic
1179495280 21:41767242-41767264 GAGCTTCTCACGCTTCTCACGGG + Intergenic
1182650332 22:31846509-31846531 GAACTTATCCCACATCCTACTGG - Intronic
1184562932 22:45273862-45273884 CACCTTCCGCCACTTCTTAGTGG + Intergenic
949310267 3:2689553-2689575 GACCTTTTACCATTCCTTACAGG + Intronic
949605079 3:5644102-5644124 GACCTTTGCCCACTTTTTATTGG - Intergenic
949673799 3:6429324-6429346 GTCCTTCTCCCACTTTTTGATGG + Intergenic
951974531 3:28489989-28490011 GTCCTTTTCCCACTTTTTAATGG - Intronic
955946256 3:64197412-64197434 GACCTTTGCCCACTTTTTAATGG + Intronic
956809849 3:72854296-72854318 GTCCTTTGCCCACTTTTTACTGG + Intronic
957042935 3:75350804-75350826 GATCCTCTCCCAATTCTTTCTGG + Intergenic
957774224 3:84735129-84735151 GTCCTTCGCCCACTTCTTGATGG - Intergenic
958214478 3:90544706-90544728 GTCCTTCGCCCACTTTTTGCTGG - Intergenic
958875411 3:99610621-99610643 GTCCTTTGCCCACTTCTTAATGG + Intergenic
960149933 3:114239119-114239141 CAGCTGCTCCCACTTCTTCCAGG + Intergenic
960508851 3:118524669-118524691 GACCTTCTGCATCATCTTACAGG - Intergenic
960929495 3:122830947-122830969 GTCCTTTACCCACTTCTTAATGG - Intronic
961325527 3:126107086-126107108 GACTCTCTCCCACGTGTTACTGG - Intronic
961417311 3:126768860-126768882 GTCCTTTGCCCACTTCTTAATGG + Intronic
961972220 3:130981196-130981218 TACCTTCTCCCCCTACTTCCAGG + Intronic
963296885 3:143556409-143556431 CACCTTCTGGCACTTCATACTGG - Intronic
963579827 3:147111330-147111352 GTCCTTTTCCCACTTTTTAATGG + Intergenic
963612365 3:147486148-147486170 GTCCTTCACCCACTTTTTAATGG + Intronic
964955969 3:162356161-162356183 GATCTAGTCCCACTTCTTCCAGG + Intergenic
965947433 3:174260505-174260527 GACCTTCACCCACTTTTTGATGG + Intronic
966014263 3:175121894-175121916 AAGCTTCTACCACTTTTTACTGG + Intronic
966442762 3:179964619-179964641 GTCCTTTTCCCACTTTTTAATGG - Intronic
967338761 3:188373527-188373549 GTCCTTCTCCCACTTTTTGATGG + Intronic
967435856 3:189445250-189445272 ATCCTTCTCCCACTTTTTAATGG - Intergenic
967442443 3:189524847-189524869 GACCTTTGCCCACTTTTTAATGG - Intergenic
968325317 3:197808915-197808937 GATGTTCTGCCACTTCTTTCTGG + Intronic
969195021 4:5554380-5554402 GAACTTCTAACATTTCTTACAGG - Intronic
969952181 4:10848967-10848989 GACCTTTGCCCACTTTTTAATGG + Intergenic
971475836 4:27071054-27071076 GTCCTTCGCCCACTTTTTAATGG + Intergenic
972083779 4:35186963-35186985 GTCCTTTGCCCACTTCTTAATGG - Intergenic
972813932 4:42622708-42622730 GCCCTTTTCCCACTTTTTAATGG - Intronic
972889286 4:43536347-43536369 GAAATTATGCCACTTCTTACTGG - Intergenic
973125033 4:46572430-46572452 GTCCTTCTCCCACTTTTTGATGG - Intergenic
974493584 4:62598053-62598075 GACTTCCTCTCACATCTTACTGG - Intergenic
974598028 4:64038274-64038296 GTCCTTTGCCCACTTCTTACTGG - Intergenic
974698634 4:65408510-65408532 GTCCTTCGCCCACTTTTTAATGG - Intronic
976524438 4:86071212-86071234 GACCTTCGCCCACTTTTTAATGG + Intronic
978074774 4:104514839-104514861 ATCCTTCACCCACTTTTTACTGG + Intergenic
978304551 4:107311387-107311409 GACTTTCTCAAAGTTCTTACAGG - Intergenic
978919726 4:114168857-114168879 GTCCTTCTCCCACTTTTTGATGG + Intergenic
979128026 4:117001492-117001514 GACCTTCTTTCTCTTCTTTCTGG + Intergenic
979797905 4:124870176-124870198 AACGTTCTCCAACTTCTTTCTGG - Intergenic
979984902 4:127301703-127301725 GACCTTATCCCACTTTTGATGGG - Intergenic
980015980 4:127651038-127651060 GTCCTTCTCCCACTTTTTGATGG + Intronic
980307138 4:131076197-131076219 GTCCTTCTCCCACTTTTTGATGG - Intergenic
980856179 4:138443070-138443092 TACTTTGTCCCACTTCTTCCTGG + Intergenic
981190849 4:141860898-141860920 GACCTCCACCCACTCCTGACTGG + Intergenic
981192266 4:141878167-141878189 GTCCTTCGCCCACTTTTTGCTGG + Intergenic
983799468 4:171908317-171908339 GTCCTTCTCCCACTTTTTGATGG - Intronic
984278436 4:177638233-177638255 GGCATTATCCCACTTCTTATGGG + Intergenic
984815194 4:183829969-183829991 GGCCTGCTCCCTCTTCTTGCAGG + Intergenic
986380128 5:7175866-7175888 GTCCTTCGCCCACTTTTTAATGG - Intergenic
986865221 5:11978272-11978294 CACCTTCTCCATCTTATTACTGG + Intergenic
988218383 5:28307377-28307399 GTCCTTTTCCTACTTTTTACTGG - Intergenic
988422068 5:31018543-31018565 GTCCTTTGCCCACTTTTTACTGG - Intergenic
990831192 5:59960018-59960040 GACCTTTTCCCACATTTTAATGG - Intronic
992026753 5:72677507-72677529 GTCCTTTGCCCACTTCTTAATGG + Intergenic
992928969 5:81621276-81621298 GTCCTTCGCCCACTTTTTAATGG - Intronic
994207399 5:97050717-97050739 GACATGGTCCCACTTCTGACTGG - Intergenic
994649106 5:102504520-102504542 GACCATGGCCCTCTTCTTACAGG - Intergenic
995090946 5:108176052-108176074 TACCATCTCCCACTTCTCCCAGG - Intronic
995163838 5:109013902-109013924 GTCCTTCTCCCACTTTTTGATGG + Intronic
995357603 5:111257318-111257340 GTCCTTCGCCCACTTTTTAATGG - Intronic
996003202 5:118388279-118388301 GTCCTTCTCCCACTTTTTGATGG - Intergenic
996438137 5:123458678-123458700 GTCCTTCTCCCACTTGTTGATGG - Intergenic
997434627 5:133865439-133865461 CACCTTCCCCCACCTCTCACAGG - Intergenic
997511221 5:134455920-134455942 GGTCCTCTCCCACTTCTTCCAGG + Intergenic
1000078356 5:157817802-157817824 GACCTTCAGCCATTTTTTACTGG - Intronic
1001536057 5:172498643-172498665 GTCCCTCGCTCACTTCTTACTGG + Intergenic
1001758823 5:174191192-174191214 GCACCTCTCCCACTTCTTGCAGG - Intronic
1001938470 5:175724184-175724206 GACTTCCTCCCCCTTCTTACTGG - Intergenic
1004833656 6:19506067-19506089 GACCTTTACCCACTTTTTAATGG + Intergenic
1005080066 6:21947896-21947918 GCACATCTCCCACTACTTACTGG + Intergenic
1005330480 6:24745207-24745229 TCCCTTCTCCCACATCTTATAGG + Intergenic
1006613682 6:35310990-35311012 TACCTTTTGCCACTTCTTCCAGG + Intronic
1008949960 6:57146106-57146128 GTCCTTTGCCCACTTCTTAATGG + Intronic
1009582376 6:65551998-65552020 GACCTTCGCCCACTTTTTGATGG - Intronic
1009662864 6:66636143-66636165 GTCCTTCTCCCACTTTTTGATGG - Intergenic
1009721441 6:67475803-67475825 GTCCTTCTTTCACCTCTTACAGG - Intergenic
1010330418 6:74617136-74617158 GTCCTTTGCCCACTTTTTACTGG + Intergenic
1010775745 6:79883154-79883176 GTCCTTTTCCCACTTTTTAATGG - Intergenic
1011533794 6:88353646-88353668 GTCCTTCACCCACTTTTTAATGG + Intergenic
1011584983 6:88914941-88914963 GTCCTTTTCCCACTTTTTAATGG - Intronic
1012253248 6:97003318-97003340 GTCCTTTTCCCACTTTTTAATGG + Intronic
1012324914 6:97904924-97904946 AACCTTCACCCACTTGTTAATGG + Intergenic
1012706946 6:102543549-102543571 GTCCTTCGCCCACTTTTTAATGG - Intergenic
1012765789 6:103365176-103365198 GACCTTCACCCACATTTTAATGG - Intergenic
1013138588 6:107307626-107307648 GACCTTTTCCCATTTCTTGTGGG + Intronic
1013301746 6:108810454-108810476 GATCTTCTCCCTGGTCTTACTGG - Intergenic
1013457610 6:110345095-110345117 GACCTTTGCCCACTTTTTAATGG - Intronic
1014359074 6:120452596-120452618 GTCCTTTCCCCACTTCTTAATGG - Intergenic
1014613815 6:123577956-123577978 GTCCTTTGCCCACTTCTTAATGG + Intronic
1015714049 6:136172458-136172480 GTCCTTCGCCCACTTTTTAATGG + Intronic
1015933201 6:138382932-138382954 GCCCTTCTCCCTCTTCTCATGGG - Exonic
1016473674 6:144402670-144402692 GACTTCCTCCCTCTTCATACTGG - Intronic
1018959376 6:168436551-168436573 GTCCTTTGCCCACTTTTTACTGG - Intergenic
1019876264 7:3813932-3813954 GTCCTTCTCCCACTTTTTGATGG + Intronic
1020921648 7:14272718-14272740 GATCATCTCCTAGTTCTTACGGG - Intronic
1023023625 7:36032355-36032377 GCCCTGCTCTCTCTTCTTACAGG + Intergenic
1024217632 7:47261258-47261280 GTCCTTTTCCCACTTTTTAATGG - Intergenic
1027141599 7:75661633-75661655 GACCCACTCCCCCTTCTTTCAGG - Intronic
1027572431 7:79886756-79886778 GTCCTTCTCCCACTTTTTGATGG - Intergenic
1027849081 7:83425900-83425922 GTCTTTCTCCCACTTTTTAATGG - Intronic
1028031016 7:85912778-85912800 GTCCTTTTCCCACTTTTTAGTGG - Intergenic
1030200482 7:106898202-106898224 GTCCTTTGCCCACTTCTTAATGG + Intronic
1031988578 7:128180328-128180350 GAGCATCTCCCACCTCTGACTGG + Intergenic
1032647588 7:133842470-133842492 GTCCTTTGCCCACTTCTTAATGG + Intronic
1034825656 7:154260065-154260087 GACCTGCTCCCACTCCTTTTGGG - Intronic
1035697739 8:1612712-1612734 GTCCTTCTCCCACTTTTTGATGG - Intronic
1036122062 8:6029453-6029475 GACCATCTCACACTTTTTATAGG - Intergenic
1036954684 8:13174685-13174707 GTCCTTTGCCCACTTTTTACTGG + Intronic
1038782467 8:30579963-30579985 GCCCTTCTCCCTATTCTTAAAGG - Intronic
1039037310 8:33373810-33373832 TCCATTCTCCCAATTCTTACAGG - Intronic
1040141528 8:43922759-43922781 GTCCTTCGCCCACTTCTTGATGG - Intergenic
1041427081 8:57733977-57733999 GTCCTTTGCCCACTTCTTAATGG + Intergenic
1042407149 8:68419148-68419170 GTCCTTCGCCCACTTCTTGATGG - Intronic
1043084872 8:75816827-75816849 GATCTTTTGCCACTTCTTCCTGG + Intergenic
1044609209 8:94075701-94075723 CACCTTCTCTCACTTCCAACTGG + Intergenic
1045590839 8:103594867-103594889 GACTTTCTCCCATGTCTTATAGG - Intronic
1046394506 8:113624933-113624955 GACCGTCTCCCAGGTCCTACAGG - Intergenic
1048398493 8:134039095-134039117 GTCCTTTGCCCACTTCTTAATGG + Intergenic
1048483080 8:134819602-134819624 CACCTTCTCTGACTTCTTTCTGG + Intergenic
1048701602 8:137097207-137097229 GTCCTTTGCCCACTTTTTACTGG - Intergenic
1050334309 9:4575866-4575888 GCCCTACTCCCATTTCTTATTGG + Intronic
1050403974 9:5287775-5287797 GTCCTTTGCCCACTTTTTACTGG + Intergenic
1050440731 9:5660673-5660695 GTCCTTTGCCCACTTCTTAATGG + Intronic
1051117235 9:13709761-13709783 GTCCTTCTCCCACTTTTTGATGG + Intergenic
1051530946 9:18102587-18102609 GACCTGCTCCCACATCTTGCTGG - Intergenic
1052015083 9:23453760-23453782 GACCTTCTCCCTCTGCATTCAGG + Intergenic
1053145829 9:35711575-35711597 GACCCTCTGCCTCTTCATACCGG + Exonic
1054828459 9:69597336-69597358 GTCCTTCTCCCACTTTTTGATGG + Intronic
1055133551 9:72803553-72803575 GTCCTTCACCCACTTTTTAATGG - Intronic
1055714104 9:79098670-79098692 GTCCTTCGCCCACTTCTTGATGG + Intergenic
1055841819 9:80514273-80514295 GTCCTTTTCCCACTTTTTAATGG + Intergenic
1056076852 9:83050362-83050384 GTCCTTCTCCCACTTTTTGATGG + Intronic
1056613821 9:88144224-88144246 GTCCTTCTTCCACTTTTTAATGG + Intergenic
1057412636 9:94830871-94830893 GTCCTTCACCCACTTTTTAATGG + Intronic
1058500650 9:105612197-105612219 GTCCTTCACCCACTTTTTAATGG + Intronic
1058921683 9:109622050-109622072 GTCCTTTGCCCACTTCTTAATGG - Intergenic
1058926630 9:109670939-109670961 GTCCTTTGCCCACTTCTTAATGG + Intronic
1059180106 9:112203835-112203857 GCCCTTCACCCACTTTTTAATGG + Intergenic
1060754283 9:126200894-126200916 GTCCTTTACCCACTTCTTAATGG + Intergenic
1060770529 9:126328431-126328453 GACCTTTTACCACTTCCAACTGG + Intronic
1186914116 X:14201510-14201532 GTCCTTCACCCACTTTTTAATGG + Intergenic
1186921553 X:14287428-14287450 GTCCTTCGCCCACTTTTTAATGG + Intergenic
1186987240 X:15030269-15030291 GTCCTTCTCCCACTTTTTGATGG - Intergenic
1187371399 X:18710495-18710517 GACCTTTGCCCACTTTTTAATGG - Intronic
1187562604 X:20416840-20416862 GTCCTTCTCCCACTTTTTGATGG - Intergenic
1189208041 X:39258561-39258583 GCCCTTCTCAGACCTCTTACTGG - Intergenic
1190311055 X:49117286-49117308 GACCTGGTCCCACTTCTCAGGGG - Intronic
1191788208 X:64940229-64940251 AACCTTCACCCACTTTTTAATGG + Intronic
1192075424 X:67990685-67990707 AACCTTCACCCACTTTTTAATGG + Intergenic
1193292243 X:79788796-79788818 GTCCTTCTCCCACTTTTTGATGG + Intergenic
1193400089 X:81032143-81032165 GACCTTCACCCACTTTTTGATGG - Intergenic
1193400696 X:81038749-81038771 GACCTTCACCCACTTTTTGATGG - Intergenic
1193424166 X:81320497-81320519 GACCTTCACCCACTTTTTGATGG + Intergenic
1193549037 X:82866921-82866943 GTCCTTTGCCCACTTCTTAATGG + Intergenic
1193938090 X:87647055-87647077 GTCCTTAGCCCACTTCTTAATGG - Intronic
1194184846 X:90763846-90763868 TGCCTTCTCACTCTTCTTACTGG - Intergenic
1195104259 X:101588105-101588127 GTCCTTTGCCCACTTTTTACAGG + Intergenic
1195867301 X:109446946-109446968 AACCTTCTCCCACTTTTTGATGG - Intronic
1195913496 X:109913150-109913172 GTCCTTCGCCCACTTGTTAATGG - Intergenic
1197047894 X:122022166-122022188 GTCCTTCGCCCACTTTTTAATGG + Intergenic
1197350380 X:125374879-125374901 GTCCTTTACCCACTTCTTAACGG + Intergenic
1197361608 X:125511180-125511202 GTCCTTCACCCACTTTTTAATGG + Intergenic
1198067103 X:133109236-133109258 GTCCTTCACCCACTTTTTAATGG + Intergenic
1198067701 X:133115690-133115712 GTCCTTCACCCACTTTTTAATGG - Intergenic
1198928449 X:141825305-141825327 GTCCTTCGCCCACTTTTTAATGG + Intergenic
1199026909 X:142950303-142950325 GACCTTTGCCCACTTTTTAATGG + Intergenic
1199292247 X:146118301-146118323 GTCCTTTGCCCACTTTTTACTGG - Intergenic
1200531464 Y:4345954-4345976 TGCCTTCTCACTCTTCTTACTGG - Intergenic
1201621872 Y:15968083-15968105 GTCCTTCACCCACTTTTTAATGG + Intergenic