ID: 1077457124

View in Genome Browser
Species Human (GRCh38)
Location 11:2687877-2687899
Sequence TGTCCCGCGGAAATCCTGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 33
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 31}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077457113_1077457124 20 Left 1077457113 11:2687834-2687856 CCAAACTCTGGTTCCTGAGGAGC 0: 1
1: 0
2: 3
3: 129
4: 2788
Right 1077457124 11:2687877-2687899 TGTCCCGCGGAAATCCTGGTGGG 0: 1
1: 0
2: 0
3: 1
4: 31
1077457120_1077457124 -2 Left 1077457120 11:2687856-2687878 CCTCAAAGGCTGGACTTGGGGTG 0: 1
1: 0
2: 0
3: 20
4: 156
Right 1077457124 11:2687877-2687899 TGTCCCGCGGAAATCCTGGTGGG 0: 1
1: 0
2: 0
3: 1
4: 31
1077457111_1077457124 25 Left 1077457111 11:2687829-2687851 CCAGGCCAAACTCTGGTTCCTGA 0: 1
1: 0
2: 0
3: 18
4: 243
Right 1077457124 11:2687877-2687899 TGTCCCGCGGAAATCCTGGTGGG 0: 1
1: 0
2: 0
3: 1
4: 31
1077457116_1077457124 7 Left 1077457116 11:2687847-2687869 CCTGAGGAGCCTCAAAGGCTGGA 0: 1
1: 0
2: 3
3: 24
4: 200
Right 1077457124 11:2687877-2687899 TGTCCCGCGGAAATCCTGGTGGG 0: 1
1: 0
2: 0
3: 1
4: 31

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077457124 Original CRISPR TGTCCCGCGGAAATCCTGGT GGG Intronic
900764011 1:4491835-4491857 ATGCCCTCGGAAATCCTGGTAGG + Intergenic
900833130 1:4979276-4979298 GCTCCCGGGGAAATCCTGATGGG + Intergenic
924888630 1:248248581-248248603 TGTCCCGAGGAAACCCAGGCAGG + Intergenic
1073321287 10:102617698-102617720 TTCCCCGTGGAAATCCAGGTTGG + Intronic
1073473686 10:103739383-103739405 TTTCCCGCTGAAATCCTGACAGG + Intronic
1077457124 11:2687877-2687899 TGTCCCGCGGAAATCCTGGTGGG + Intronic
1086925340 11:92634224-92634246 TGGCCAGAAGAAATCCTGGTAGG - Intronic
1106237527 13:27876396-27876418 TTTCCCGCTGAAAACCTTGTGGG - Intergenic
1126412734 15:48388646-48388668 TGTCCCGGGGAACTTCTGTTAGG + Intergenic
1127880505 15:63153167-63153189 TTACCCGCAGAAGTCCTGGTTGG - Exonic
1135074669 16:19383097-19383119 TGGCCCGCTGAGATGCTGGTGGG + Intergenic
1139614663 16:68081680-68081702 TGTCTGGCAGAGATCCTGGTTGG + Intergenic
1143303776 17:5930045-5930067 CGTCCCGGGGAAAACCTGCTGGG + Intronic
1151701147 17:75743198-75743220 TGTCCAGCAGACATCCTGGAAGG - Intronic
1165376312 19:35445127-35445149 GGCCCTGCTGAAATCCTGGTAGG + Intronic
926454540 2:13049041-13049063 TGTCATGGGGGAATCCTGGTAGG - Intergenic
928736265 2:34293960-34293982 TTTCCAGAGGAAGTCCTGGTGGG - Intergenic
943312660 2:186345780-186345802 TGTCCCGACGAAATTCTGGTAGG + Intergenic
943527550 2:189036678-189036700 TGTACCACGTAAAACCTGGTGGG - Exonic
947919300 2:233855404-233855426 TGTCCTGCGGAAATTTAGGTGGG + Intergenic
1172410076 20:34714500-34714522 TGTCCCTAGAAAATCCTGGGTGG + Intronic
1175296637 20:57913284-57913306 AGACCCGTGGAAATCCTGGGTGG + Intergenic
1176207437 20:63896889-63896911 TGTCACCCGGAAGTCCTTGTCGG + Intronic
1177166722 21:17612479-17612501 GGTCCCGCGGAAAGCCTCGCGGG + Intronic
1184092214 22:42298836-42298858 TGTCCTGGGGAAGGCCTGGTGGG - Intronic
974015366 4:56644135-56644157 TGTCCCACGGAGATTCAGGTAGG - Intergenic
975371395 4:73592579-73592601 TGTCCCTTGGATATCCAGGTTGG - Intronic
1024979648 7:55146596-55146618 TCTCCCGCAGAAATCCTGCATGG + Exonic
1030432623 7:109469970-109469992 TGTTCCCAGGAAAACCTGGTAGG - Intergenic
1037688786 8:21165725-21165747 TTTCCTGCGTAAATCCTTGTGGG + Intergenic
1050376379 9:4977826-4977848 TGTCTCTCAGAAATCCTGCTGGG - Intergenic
1062446581 9:136597790-136597812 TGACCCAAGGAAGTCCTGGTGGG - Intergenic
1185571636 X:1139149-1139171 TGTGACGCAGAAATGCTGGTGGG - Intergenic