ID: 1077457224

View in Genome Browser
Species Human (GRCh38)
Location 11:2688354-2688376
Sequence TCTGGGGAACTTCCCCGTAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 124
Summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 116}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077457219_1077457224 -1 Left 1077457219 11:2688332-2688354 CCATGGGGGTCTTCCTCTCGTGT 0: 1
1: 0
2: 0
3: 8
4: 101
Right 1077457224 11:2688354-2688376 TCTGGGGAACTTCCCCGTAGAGG 0: 1
1: 0
2: 1
3: 6
4: 116

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077457224 Original CRISPR TCTGGGGAACTTCCCCGTAG AGG Intronic
908179607 1:61590817-61590839 TCTGGGTACCTACCCAGTAGTGG - Intergenic
909447465 1:75764156-75764178 GCTGGGGAGCTTCCACGTTGAGG - Intronic
913464170 1:119122532-119122554 TCTGGGCAAATACCCAGTAGTGG - Intronic
913613417 1:120530852-120530874 TCTGAGGAACTTCCCTCTGGGGG + Intergenic
914235607 1:145808193-145808215 TCTGGATAACTACCCAGTAGCGG + Intronic
914371770 1:147031608-147031630 TCTGAGGAACTTCCCTCTGGGGG + Intergenic
914577768 1:148991395-148991417 TCTGAGGAACTTCCCTCTGGGGG - Intronic
915752404 1:158223986-158224008 TCTGGGGCACTTCCACCTAGTGG + Intergenic
916260950 1:162841637-162841659 TCTGGGTATCTACCCAGTAGTGG + Intronic
918270692 1:182895813-182895835 TCTGGGGAACTACCCAGTAGTGG - Intergenic
919243986 1:194953447-194953469 TTTGGGGAAATACCCAGTAGTGG - Intergenic
923442363 1:234032866-234032888 TCTGGGTAGCTACCCAGTAGTGG + Intronic
924816887 1:247450369-247450391 TCTGGGTAGATGCCCCGTAGTGG + Intergenic
1064206525 10:13328851-13328873 TCTGCGCAACATCCCCGCAGTGG + Intronic
1067030376 10:42875554-42875576 CCTGGAGGACTTCCCGGTAGAGG + Intergenic
1067058309 10:43064989-43065011 TCAGGCGAGCTTCCCCGAAGTGG + Intergenic
1069788622 10:71005440-71005462 TATGGGGAACTTCCCCACAGAGG - Intergenic
1077457224 11:2688354-2688376 TCTGGGGAACTTCCCCGTAGAGG + Intronic
1078997019 11:16712249-16712271 TCTGGGTAAATACCCAGTAGTGG + Intronic
1080375642 11:31707082-31707104 TTTGGAGAAATTCCCAGTAGTGG + Intronic
1081781031 11:45712921-45712943 TCTCTGGAACTACCCCGAAGGGG + Intergenic
1082613782 11:55334693-55334715 TGGGGGGCACTTCCCAGTAGGGG - Intergenic
1083903051 11:65652915-65652937 TCTGGGGAAAATCCCCGCCGAGG - Intergenic
1084405666 11:68971428-68971450 TCTGGGGGACTTCCCGGAGGAGG - Intergenic
1085300352 11:75454974-75454996 TCTGGGGAACTCCCTCCTGGTGG + Intronic
1088598276 11:111455748-111455770 GCTGGGGAACTGCCCTGCAGGGG - Exonic
1089404850 11:118189104-118189126 TCTGGGCAAATACCCAGTAGTGG + Intergenic
1091166192 11:133478319-133478341 ACTGGGGAACTTCTCTGTACTGG - Intronic
1091332518 11:134741386-134741408 TCTGGGTAGGTACCCCGTAGTGG + Intergenic
1093506424 12:19871892-19871914 TCTGGGTAAATCCCCAGTAGTGG - Intergenic
1094598242 12:31884840-31884862 TCTGGGGGTCTTCCCAGCAGCGG - Intergenic
1099393186 12:82104709-82104731 TCTGGGTAGATTCCCAGTAGTGG - Intergenic
1102440300 12:112958750-112958772 TGGGAGGCACTTCCCCGTAGGGG - Intronic
1102900232 12:116630920-116630942 TCTGGGGAACTCCTCCGTTCTGG + Intergenic
1103880337 12:124161170-124161192 TCTGGGTAGATTCCCGGTAGTGG + Intronic
1104155519 12:126127459-126127481 TCTGGGTAGATTCCCAGTAGTGG - Intergenic
1105401707 13:20102045-20102067 TCTGAGGATCTTTCCCGTACTGG + Intergenic
1106973838 13:35181174-35181196 TCTGGGTAAATACCCAGTAGTGG + Intronic
1108120077 13:47176041-47176063 TCTGGATAACTTCCCAGAAGGGG - Intergenic
1109945791 13:69429916-69429938 TCTGGGTAGATACCCCGTAGTGG - Intergenic
1113420810 13:110170223-110170245 TCTGGTGAAGACCCCCGTAGTGG - Intronic
1115916815 14:38324174-38324196 TCACGGTAACTGCCCCGTAGAGG - Intergenic
1116896074 14:50315909-50315931 TCTGGGTAGCTACCCAGTAGTGG + Intronic
1128538942 15:68511577-68511599 CCTGGGGAGCTTCTCTGTAGAGG + Intergenic
1138001038 16:53280161-53280183 TCTGGGTAAATACCCAGTAGTGG - Intronic
1138486467 16:57348027-57348049 TCTGAAGAGCTTCCCCTTAGTGG - Intergenic
1140899464 16:79354482-79354504 TCAGGGGGACTTCCCAGTAGAGG + Intergenic
1141884590 16:86882831-86882853 TCAGGGGCACTTCCCCGGGGAGG - Intergenic
1144579560 17:16450730-16450752 TCTGAGGAACATCCCCCTTGAGG - Intronic
1144947653 17:18978057-18978079 TCTGGGGAGCTTCCTCTTTGGGG + Exonic
1149505015 17:57187017-57187039 TCTGGGGAAATTTCCTCTAGAGG - Intergenic
1149589999 17:57821924-57821946 TGTGGGGAACTTCCACGGATGGG - Intergenic
1152215883 17:79032208-79032230 TCTGGGCAACTTCCCGGAGGAGG + Intronic
1152501767 17:80716068-80716090 TCTGGGTAAATACCCAGTAGTGG + Intronic
1153449631 18:5212866-5212888 TCTTGGGAATTTCCGCATAGAGG + Intergenic
1163916381 19:20244260-20244282 CCTGTGGAGCATCCCCGTAGGGG + Intergenic
1164583804 19:29452617-29452639 TCTGGGTATATTCCCAGTAGTGG - Intergenic
1167942728 19:52960705-52960727 TCTGGGGTACTTTCCAGTGGGGG - Intronic
1168387075 19:55972965-55972987 TCTGGGTGAATTCCCAGTAGTGG + Intronic
925167049 2:1722562-1722584 TCTGAGGAACTTCCCAGCAAAGG + Intronic
925340944 2:3135678-3135700 TCTGGGTAGATACCCCGTAGTGG + Intergenic
929957592 2:46470564-46470586 TTTAGGGAACTTCCCAGAAGTGG - Intronic
932135240 2:69223121-69223143 TCTGGGGACCTTCTGAGTAGAGG - Intronic
935439852 2:103079936-103079958 TTTGGGTAAATTCCCAGTAGGGG - Intergenic
936910725 2:117589949-117589971 TCTGGGCACATACCCCGTAGTGG + Intergenic
937218868 2:120329996-120330018 GCTGGGGCACTTCCCAGTCGGGG - Intergenic
940593099 2:155754029-155754051 TCTGGGAAAATACCCAGTAGTGG - Intergenic
944859731 2:203803724-203803746 TCTGGGGACCTGCCCAGTGGTGG - Intergenic
948600403 2:239104638-239104660 GCTTGGGAAGGTCCCCGTAGGGG + Intronic
1170311966 20:15002115-15002137 TCTGGGTAAATACCCAGTAGTGG + Intronic
1173158050 20:40631531-40631553 TCTGGGGAATTTCCCAGCAGGGG + Intergenic
1173234253 20:41229403-41229425 TCTGGGTAACTACCCAGAAGTGG + Intronic
1174215322 20:48911977-48911999 TCTGGGGAACCTAACTGTAGTGG - Intergenic
1175292554 20:57886575-57886597 TCTGGGTAAATGCCCAGTAGTGG + Intergenic
1180543102 22:16471042-16471064 TCTGGGTAGCTACCCAGTAGTGG - Intergenic
1180799354 22:18624577-18624599 GCTGGGGAAAGTCCCCGTGGGGG + Intergenic
1181222364 22:21370689-21370711 GCTGGGGAAAGTCCCCGTGGGGG - Intergenic
1181638124 22:24183675-24183697 GCTGGGGAAAGTCCCCGTGGGGG - Intronic
1184936228 22:47724317-47724339 TTAGGGGAACTTACCTGTAGAGG - Intergenic
951508312 3:23473905-23473927 TCTGGGTAAATACCCAGTAGCGG + Intronic
953103515 3:39853257-39853279 TCTGGGTAAATACCCAGTAGTGG + Intronic
960517032 3:118613749-118613771 TCTGGGTAGCTACCCAGTAGTGG - Intergenic
960607774 3:119525704-119525726 TCTGAGGAAGTTCCCAGAAGAGG + Exonic
961629932 3:128289193-128289215 TCTGTGGAACTTCTCCCCAGTGG + Intronic
962305908 3:134285857-134285879 TCTGGGCAAATACCCAGTAGTGG - Intergenic
962870498 3:139486659-139486681 TTTGGGGAAATACCCAGTAGTGG + Intergenic
965345593 3:167545335-167545357 TCTGGGGAGATACCCCATAGTGG - Intronic
967205578 3:187117684-187117706 TCTGGGTAGATACCCCGTAGTGG + Intergenic
973161640 4:47025247-47025269 TCTGGGTAAATACCCAGTAGTGG + Intronic
975991712 4:80265557-80265579 TCTGGGGACGTTGCCCGTACAGG + Intergenic
979008979 4:115342442-115342464 TGTGGGGGACTTGCCCTTAGAGG - Intergenic
979238646 4:118429066-118429088 TCTGGGGAACTTCCAAGAACTGG - Intergenic
982768200 4:159371549-159371571 TCTGGGGAGATACCCAGTAGTGG - Intergenic
984763107 4:183379042-183379064 TCTGGGGAGCTTCCCAGAAAGGG - Intergenic
992159905 5:73991266-73991288 TCTGGGGAACTTGACTGCAGTGG + Intergenic
994213393 5:97110085-97110107 TTTGGGTAAATTCCCAGTAGTGG + Intronic
994680612 5:102882222-102882244 TCTGGGTAGCTACCCAGTAGTGG + Intronic
995574338 5:113513789-113513811 TCTCCGGAGCTTCCCGGTAGTGG + Exonic
996861110 5:128066763-128066785 TCTGGGGAACTTCCTGGGGGAGG + Intergenic
997891963 5:137684908-137684930 TCTGGGGAACTTCCCTGAGGGGG + Intronic
999376684 5:151091617-151091639 TCAGGGAAACTTCCCAGAAGAGG - Intronic
1002535491 5:179873433-179873455 TCGGGGGCACTGCCCTGTAGAGG - Intronic
1008030357 6:46687961-46687983 TCTCGGCAACTCCCCCGTCGAGG - Intronic
1009475845 6:64091588-64091610 TCTGGGGACCATCAACGTAGAGG - Intronic
1010328824 6:74597187-74597209 TCTGGGCTCCTTCCACGTAGTGG - Intergenic
1011005684 6:82642747-82642769 TCTGGGTAAATACCCAGTAGTGG - Intergenic
1014170305 6:118271420-118271442 TCTGGGGAACTTCTCCATTCTGG - Intronic
1024917656 7:54521530-54521552 TCTGGGTAGATTCCCAGTAGTGG + Intergenic
1030530385 7:110705427-110705449 CCTGGGGAACTACCTCTTAGGGG - Intronic
1034047395 7:147944044-147944066 ACTGGGAAACTTCCCCATTGAGG - Intronic
1034917890 7:155056135-155056157 TGTGGGGAATTTCCCCAAAGGGG - Intergenic
1038777877 8:30547148-30547170 TATGGGGAGATGCCCCGTAGAGG - Intronic
1039588669 8:38728650-38728672 TCTGGGGACCCTCGCCGAAGAGG + Intronic
1040843899 8:51815033-51815055 TCTGGGTAAATACCCAGTAGTGG - Intergenic
1042783667 8:72522464-72522486 TTTGGATAAATTCCCCGTAGTGG - Intergenic
1042847199 8:73180290-73180312 TCTGGGTAGATTCCCAGTAGTGG + Intergenic
1052638546 9:31134014-31134036 TCTGGGTAAATACCCAGTAGTGG - Intergenic
1061987217 9:134136539-134136561 TCTGGGGTCCTTCCCTGAAGGGG - Intronic
1193784920 X:85749154-85749176 TCTGGGTAACTACCCAGTAGTGG + Intergenic
1194791367 X:98154987-98155009 TCTGGGTAAATACCCAGTAGTGG + Intergenic
1196935021 X:120721111-120721133 TCTGGGTAGATTCCCAGTAGTGG + Intergenic
1197070281 X:122288420-122288442 TCTGGGTAAATACCCAGTAGTGG - Intergenic
1197545737 X:127821827-127821849 TCTGGGTAGATTCCCAGTAGTGG - Intergenic
1199150121 X:144422189-144422211 TCTGGGTAGATTCCCAGTAGTGG + Intergenic