ID: 1077457567

View in Genome Browser
Species Human (GRCh38)
Location 11:2690058-2690080
Sequence CCTTCAGCCCAGACAGAAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 281
Summary {0: 1, 1: 0, 2: 2, 3: 16, 4: 262}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077457567_1077457571 3 Left 1077457567 11:2690058-2690080 CCTGCTTCTGTCTGGGCTGAAGG 0: 1
1: 0
2: 2
3: 16
4: 262
Right 1077457571 11:2690084-2690106 AGCAGGGACAATCGCTCTTCCGG 0: 1
1: 0
2: 0
3: 7
4: 82
1077457567_1077457573 5 Left 1077457567 11:2690058-2690080 CCTGCTTCTGTCTGGGCTGAAGG 0: 1
1: 0
2: 2
3: 16
4: 262
Right 1077457573 11:2690086-2690108 CAGGGACAATCGCTCTTCCGGGG 0: 1
1: 0
2: 0
3: 3
4: 51
1077457567_1077457579 24 Left 1077457567 11:2690058-2690080 CCTGCTTCTGTCTGGGCTGAAGG 0: 1
1: 0
2: 2
3: 16
4: 262
Right 1077457579 11:2690105-2690127 GGGGTTAGAACTGGGGGAGCAGG 0: 1
1: 0
2: 2
3: 19
4: 345
1077457567_1077457572 4 Left 1077457567 11:2690058-2690080 CCTGCTTCTGTCTGGGCTGAAGG 0: 1
1: 0
2: 2
3: 16
4: 262
Right 1077457572 11:2690085-2690107 GCAGGGACAATCGCTCTTCCGGG 0: 1
1: 0
2: 1
3: 7
4: 96
1077457567_1077457580 25 Left 1077457567 11:2690058-2690080 CCTGCTTCTGTCTGGGCTGAAGG 0: 1
1: 0
2: 2
3: 16
4: 262
Right 1077457580 11:2690106-2690128 GGGTTAGAACTGGGGGAGCAGGG 0: 1
1: 0
2: 1
3: 24
4: 243
1077457567_1077457574 15 Left 1077457567 11:2690058-2690080 CCTGCTTCTGTCTGGGCTGAAGG 0: 1
1: 0
2: 2
3: 16
4: 262
Right 1077457574 11:2690096-2690118 CGCTCTTCCGGGGTTAGAACTGG 0: 1
1: 0
2: 0
3: 1
4: 30
1077457567_1077457577 18 Left 1077457567 11:2690058-2690080 CCTGCTTCTGTCTGGGCTGAAGG 0: 1
1: 0
2: 2
3: 16
4: 262
Right 1077457577 11:2690099-2690121 TCTTCCGGGGTTAGAACTGGGGG 0: 1
1: 0
2: 0
3: 2
4: 60
1077457567_1077457575 16 Left 1077457567 11:2690058-2690080 CCTGCTTCTGTCTGGGCTGAAGG 0: 1
1: 0
2: 2
3: 16
4: 262
Right 1077457575 11:2690097-2690119 GCTCTTCCGGGGTTAGAACTGGG 0: 1
1: 0
2: 0
3: 6
4: 69
1077457567_1077457576 17 Left 1077457567 11:2690058-2690080 CCTGCTTCTGTCTGGGCTGAAGG 0: 1
1: 0
2: 2
3: 16
4: 262
Right 1077457576 11:2690098-2690120 CTCTTCCGGGGTTAGAACTGGGG 0: 1
1: 0
2: 0
3: 3
4: 55

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077457567 Original CRISPR CCTTCAGCCCAGACAGAAGC AGG (reversed) Intronic
900210175 1:1451741-1451763 CCTTAAGCCCAGCCTGAATCAGG + Intronic
900215725 1:1480562-1480584 CCTTAAGCCCAGCCTGAATCAGG + Intronic
900399023 1:2465379-2465401 CCTCCGGCCAAGGCAGAAGCTGG + Intronic
901042542 1:6374207-6374229 CCCTCAGCCCAAACAGAGGCGGG + Intronic
905652722 1:39667349-39667371 CCGCCACCCCAGACAGCAGCTGG + Intronic
906197267 1:43936746-43936768 CCCTCAGCCCAGGCAGCCGCAGG - Exonic
907323657 1:53621270-53621292 CCCCCAGCCCAGCCAGGAGCAGG + Intronic
910026747 1:82664417-82664439 TATTCAGCACTGACAGAAGCAGG + Intergenic
910910805 1:92231992-92232014 CCTTCATTCCAGACATCAGCTGG - Intronic
912715127 1:111978062-111978084 CCTCAAGCCCTGACAGCAGCTGG + Intronic
914702372 1:150146998-150147020 TCTTCACCACAGACAGAAACTGG + Intergenic
917173245 1:172201459-172201481 CCTTCACCCCAAAGAGATGCAGG + Intronic
918590372 1:186234441-186234463 CTTTCAACCCAGACAAGAGCAGG - Intergenic
921279472 1:213551328-213551350 TGTTCAGCCCAGACAAAAGGGGG + Intergenic
922398052 1:225223043-225223065 CCTTCAGCCCAGCCATTACCAGG + Intronic
922573172 1:226645622-226645644 CTTCCAACCCAGACAGCAGCAGG - Intronic
922774741 1:228209429-228209451 CCTTCAGCACAGGCAGTAACGGG + Intronic
922924797 1:229339661-229339683 CAGCCAGCCCAGACAGAAGTAGG + Intronic
923889002 1:238190364-238190386 CCTTAAGCCCAGACAGTATTGGG + Intergenic
924653136 1:245948715-245948737 GCTTCAGCCCTGGCAGCAGCAGG - Intronic
1063092189 10:2875132-2875154 CCCTGAGCCAGGACAGAAGCGGG + Intergenic
1063615334 10:7595270-7595292 CCTTCAGTCCAAACATAATCTGG - Intronic
1064872379 10:19952843-19952865 CCTTCTGGCCAGACAAAAACAGG - Intronic
1064918298 10:20486941-20486963 CCATCAGCCAAGCCAGGAGCTGG + Intergenic
1070160675 10:73865137-73865159 CCCTCAGCCCAGGCAGATGCAGG + Intronic
1070549497 10:77480060-77480082 CCTGCAGCCAAGACAGAAGCTGG + Intronic
1070767041 10:79062677-79062699 CCTGCAGCCTTGACAGAAGAGGG + Intergenic
1072735488 10:97876227-97876249 CATACAGCCCAGACAGACGAAGG - Intronic
1073140024 10:101241090-101241112 CCTTCTGCACAGGCAGAACCTGG - Intergenic
1073290952 10:102413062-102413084 CCCTCTGCCCACACAGAAGCAGG + Intronic
1073369516 10:102974646-102974668 ACTTCAGCCCTGCCAGTAGCTGG + Intronic
1074050354 10:109876042-109876064 CCTTCAGCCCTGACCCCAGCAGG + Intronic
1075180642 10:120207676-120207698 ACTTCAGCCCAGACAGGAAGGGG - Intergenic
1076233256 10:128839350-128839372 CCTCCGGCCCTGTCAGAAGCAGG + Intergenic
1077457567 11:2690058-2690080 CCTTCAGCCCAGACAGAAGCAGG - Intronic
1077755841 11:5026187-5026209 GCTCCATCCCAGAGAGAAGCAGG - Intergenic
1080530716 11:33173191-33173213 CCAACCTCCCAGACAGAAGCTGG + Intergenic
1081447389 11:43144063-43144085 CTTACAGACCATACAGAAGCAGG - Intergenic
1081570817 11:44289763-44289785 CTTAGAGCCCAGACTGAAGCTGG - Intronic
1083041060 11:59687954-59687976 CCTGCACCCCACACAGAAGGAGG - Intergenic
1084107143 11:66987522-66987544 CCATCAGCCCTGACAGCAGGAGG + Intergenic
1084333503 11:68444054-68444076 CCATCAGCCAAGAAACAAGCTGG - Intronic
1084415882 11:69032775-69032797 CCCTCAGCCAAGCCAGGAGCTGG + Intergenic
1084753668 11:71221337-71221359 CCTTGTGCCCAACCAGAAGCTGG - Intronic
1084979297 11:72820830-72820852 CCTTCAACCCAGAGCCAAGCAGG - Intronic
1085045567 11:73351032-73351054 CCGGCACCCCACACAGAAGCGGG - Intronic
1087446593 11:98262498-98262520 CCTTCAGCCCTGACAGGAGAAGG + Intergenic
1089051648 11:115550799-115550821 CCTTCAACTCAGGGAGAAGCAGG - Intergenic
1091368249 11:135039354-135039376 CCTTGAGCCTAGACATAAGAAGG + Intergenic
1091634054 12:2183993-2184015 CTTTCAGACCAGGCAGAGGCTGG - Intronic
1092758685 12:11789454-11789476 GCTGAAGCCCAGACCGAAGCAGG - Intronic
1097001723 12:55882626-55882648 TCTTCAGGCCAGACAGATGGTGG + Intergenic
1102768826 12:115455564-115455586 ACTTCTGCCCAGACTGAACCTGG - Intergenic
1103092802 12:118109386-118109408 ACTTCAGCCCCCAGAGAAGCTGG + Intronic
1103362854 12:120363828-120363850 CCTTCAGCCCTGGCAGGAGTTGG + Intronic
1104054668 12:125220285-125220307 ACCTCAGCCCAGACACAAGGTGG - Intronic
1104537049 12:129627870-129627892 ACTTCAGCCCTGAAAGTAGCTGG - Intronic
1104913568 12:132252064-132252086 CCTTTCTCCCAGACAGACGCTGG - Intronic
1106481864 13:30143043-30143065 CCTTCAGACCAGACAGCGGCCGG + Intergenic
1106852906 13:33814466-33814488 CCACCAGTCCAGGCAGAAGCAGG - Intergenic
1107437013 13:40389127-40389149 TCTTCAGCCCAGACACATGTGGG + Intergenic
1109375298 13:61485267-61485289 CCTTAAGCCATGACAGAAACTGG + Intergenic
1110651777 13:77950475-77950497 CCTTCAGAGCTGACAGAAGGAGG + Intergenic
1112341131 13:98553691-98553713 CCTTCAGCCCAGCCTGCAGCAGG - Intronic
1113465619 13:110510834-110510856 CCTTCAGACCAAAGTGAAGCCGG + Intronic
1113702736 13:112399322-112399344 CCCTCAGCCCCGACAGAGACTGG - Intronic
1116864125 14:50017588-50017610 CCTTCAGCATCGACAAAAGCTGG + Intergenic
1117252598 14:53951940-53951962 CCTCCTCCCCAGACTGAAGCCGG + Exonic
1118378876 14:65201505-65201527 CCTGGAGCCCAGAGAGAAGGGGG + Intergenic
1118902570 14:69999040-69999062 CCATCAGCACAGACATAAGGTGG + Intronic
1119211647 14:72836443-72836465 CCTTCAGGGCAGGCAGGAGCAGG - Intronic
1119433408 14:74583036-74583058 CAGTCAGCCCAGACAACAGCTGG + Intronic
1119844812 14:77821129-77821151 CCTTCAGGCCAGCCAGAAGCAGG + Intronic
1120300956 14:82706046-82706068 GCTCCAGCCCAGAGAGATGCAGG + Intergenic
1121876849 14:97460680-97460702 CCTTCAGGGCAGAGAGAAGATGG + Intergenic
1122021082 14:98838536-98838558 TCATCATCTCAGACAGAAGCAGG - Intergenic
1122139387 14:99653298-99653320 CCTTCAGGCCAGAGCGAGGCAGG - Intronic
1122836069 14:104431710-104431732 CCCTTGGCCCAGGCAGAAGCTGG - Intergenic
1122884975 14:104706933-104706955 CCTGCAGCACCGACAGGAGCTGG - Exonic
1122986823 14:105216285-105216307 CCTCCAGCGCTGACAGAGGCTGG + Intronic
1202833478 14_GL000009v2_random:60040-60062 CCATCAGCCCAGGCAGGATCTGG - Intergenic
1123397794 15:19954825-19954847 ACCTCAGCCAAGACAGAGGCTGG - Intergenic
1123696160 15:22880618-22880640 ACTCCAGCCCAGACAGAAACCGG + Intronic
1124089065 15:26580453-26580475 CCATCTGCCAAGAGAGAAGCAGG + Exonic
1125142090 15:36420182-36420204 CATTCAGTCAAGACAGAAGAAGG - Intergenic
1125213887 15:37246906-37246928 CCTTCTGACCAGTCAGGAGCTGG + Intergenic
1125574176 15:40744149-40744171 ACTGCAGACCAGACAGAAACGGG + Exonic
1125714673 15:41812782-41812804 TCCTCAGCCCAGACAGCATCTGG - Intronic
1126198235 15:45955414-45955436 CCATCAGCAGAGTCAGAAGCGGG + Intergenic
1126797047 15:52267875-52267897 CCTTCAGCCCAGCCAGAGCTTGG + Intronic
1127901694 15:63345719-63345741 CCTGGAGCCCAGAGAGAGGCAGG + Intronic
1131514097 15:93066013-93066035 CCTTCAGCGGGGACAGAACCTGG - Intronic
1132332809 15:101024518-101024540 TCTGCAGCCCAGACAGAGCCAGG + Intronic
1132336312 15:101050646-101050668 CCTGCATCCCAGACAGCATCAGG + Intronic
1132498080 16:273244-273266 CCTTGGGCCCAGAGAGAAGCTGG + Intronic
1132999659 16:2842472-2842494 CCTCCAGCCCGGACTGAAGTTGG + Intergenic
1133046338 16:3090344-3090366 CCTTCAGGCGAGACAGCTGCGGG + Exonic
1133652219 16:7823060-7823082 GCCTCAACCCAGACAGAAGAGGG - Intergenic
1133763816 16:8821459-8821481 GCTTCAGCACAGACACAGGCAGG - Intronic
1134191362 16:12123704-12123726 CCTTCAGCCCTGAATGAAGAAGG + Intronic
1135303487 16:21350156-21350178 CCTGCAGCACAGGCAGCAGCAGG + Intergenic
1135939412 16:26808360-26808382 CTTTCTTCCCAGACAGCAGCAGG - Intergenic
1136001618 16:27298892-27298914 GCTTCAGCCCCCACAGTAGCTGG - Intergenic
1136300234 16:29329350-29329372 CCTGCAGCACAGGCAGCAGCAGG + Intergenic
1139487089 16:67264069-67264091 CCTTCAAACCAGAGAGAATCGGG + Intronic
1139581074 16:67873844-67873866 CCTTCATCCCAGAAAGAACACGG - Intronic
1139705425 16:68737680-68737702 CCTCCAGCGCAGACCGAGGCGGG + Intronic
1139909797 16:70390666-70390688 CCCTCTGTCCAGACAGCAGCAGG - Intronic
1141196577 16:81865626-81865648 CCAGGAGCCCAGACAGCAGCAGG - Intronic
1142061964 16:88036114-88036136 CCTGCAGCACAGGCAGCAGCAGG + Intronic
1142186327 16:88696432-88696454 CCTCCAACACAGACAGCAGCTGG + Intergenic
1142238188 16:88932530-88932552 CCTTCAGCCTACAGAGTAGCTGG - Intronic
1142407082 16:89896216-89896238 CCTTAAGCCCAGAGAGAGGAAGG - Intronic
1142563979 17:827666-827688 CCTCCAGAAAAGACAGAAGCAGG + Intronic
1143026374 17:3944101-3944123 CATTCAGGCCAGAGAGATGCGGG - Intronic
1144787464 17:17840072-17840094 CCTCCAGTCCAGACAAAACCAGG - Intergenic
1145239632 17:21232906-21232928 CCTTCTGCCCAGGCAGACCCAGG + Intergenic
1145813655 17:27780653-27780675 CCTAAAGCCCAGCCAGCAGCAGG - Intronic
1146009920 17:29185718-29185740 CCTCCACCCCAGAAAGAAGCTGG + Intergenic
1146884216 17:36460076-36460098 CAGCCAGCCCAAACAGAAGCGGG - Intergenic
1147349721 17:39831604-39831626 TCTTGGGCCCACACAGAAGCAGG - Intronic
1147452614 17:40515190-40515212 CCTTCTCTGCAGACAGAAGCAGG + Intergenic
1151495361 17:74455061-74455083 CCTTCAGCCCGGACAGCCCCTGG - Intergenic
1151850556 17:76687233-76687255 CCATCAGCACAGCCTGAAGCAGG - Intronic
1152408917 17:80112249-80112271 CCTGCACCCCAGCCTGAAGCTGG + Intergenic
1152755040 17:82083710-82083732 CCTCCGGCCCAGGGAGAAGCAGG - Intronic
1153820640 18:8828657-8828679 CCATCTGCCCAGAGAGAAGAAGG - Intronic
1160660520 19:296150-296172 CCTGCAGCCCAGACCCAGGCAGG - Intergenic
1164295935 19:23910040-23910062 CCTTCAGACCTGACAGAAAGAGG - Intergenic
1164798205 19:31053587-31053609 ACTTCACCCCAGAGAGATGCAGG + Intergenic
1166713041 19:44949216-44949238 CCTTCAGCACAGAAAGAACTTGG - Exonic
1167143392 19:47667565-47667587 CCTTCAGGCCAGGCAGGAACAGG + Intronic
1167940553 19:52942693-52942715 CCTTCAGAACAGACAGAGGGCGG + Intronic
1168718870 19:58544157-58544179 CCTCCAGACCACACAGAAGCGGG - Intronic
1202639194 1_KI270706v1_random:67655-67677 CCATCAGCCCAGGCAGGATCTGG + Intergenic
925104820 2:1282495-1282517 CACTCAGCCCAGCCTGAAGCTGG - Intronic
927175261 2:20401536-20401558 CCTTCAGCCCATGCCTAAGCAGG - Intergenic
928155850 2:28875760-28875782 TCTGAAGCCCAGACAGGAGCAGG - Intergenic
929603159 2:43217606-43217628 CATTCAGCCCACACAGCAGTGGG - Intergenic
929795485 2:45055564-45055586 CCATCAGCCCAGACCCCAGCAGG + Intergenic
934969761 2:98753761-98753783 CCTTCAGAGCTGACAGAAGGAGG - Intergenic
940639799 2:156333850-156333872 CCTACAGCCCAGCCAGGAGAGGG + Intronic
941190341 2:162373662-162373684 CCTACAGAACAGACAGAAGTAGG + Exonic
942869924 2:180722308-180722330 CCTTCTGCCGAGGCTGAAGCAGG - Intergenic
944417328 2:199491890-199491912 CCTTCTGGACAGAAAGAAGCGGG - Intergenic
945331554 2:208545688-208545710 ACTTAAGCAAAGACAGAAGCTGG + Intronic
946420884 2:219563914-219563936 CCTTCAGCCTAGACAAATGGTGG - Intronic
947457298 2:230266612-230266634 CCTTCAGCCAAGACTTCAGCTGG - Intronic
947931199 2:233966579-233966601 ACATCAGCACAGAGAGAAGCTGG - Intronic
948455519 2:238102789-238102811 CCCTCAGCCAAGACAGTAGGAGG - Intronic
948771045 2:240251407-240251429 CCCTCATCCCACACAGAAGGAGG + Intergenic
1169459052 20:5778671-5778693 CTTTCAGCCATGACAGGAGCAGG + Intronic
1169763421 20:9121503-9121525 CATTTAGACCAGACAAAAGCTGG - Intronic
1171450149 20:25229988-25230010 CCTGCCGCCGAGAGAGAAGCAGG + Intergenic
1172280406 20:33703801-33703823 CCTTCAGGCCTGCCAGAGGCTGG + Exonic
1172772981 20:37392364-37392386 TCTTCAGCCCATATAGAAGATGG - Intronic
1175117312 20:56691645-56691667 CCTTCACCACCGAGAGAAGCAGG + Intergenic
1176047284 20:63099503-63099525 TGTCCAGCCCAGACAGAAGGAGG + Intergenic
1176050461 20:63116634-63116656 CCATCCGGCCAGCCAGAAGCTGG + Intergenic
1176177787 20:63736851-63736873 CCAGCAGCAGAGACAGAAGCTGG - Intronic
1176647517 21:9365264-9365286 CCATCAGCCCAGGCAGGATCTGG + Intergenic
1176744483 21:10639547-10639569 ACCTCAGCCAAGACAGAGGCTGG - Intergenic
1178681495 21:34675989-34676011 CTGTCAGCCCAGACAGAGACGGG - Intronic
1178865352 21:36322106-36322128 CCTTCAGGCCACACAAAAACAGG - Intronic
1178940326 21:36900231-36900253 ACTTCAGACCAGACAGATGGAGG + Intronic
1181107999 22:20585969-20585991 CCTCCTGCACAGACAGCAGCGGG + Intronic
1181236860 22:21452520-21452542 ACTCCAGCCTAGACAAAAGCTGG - Intergenic
1181261265 22:21599541-21599563 ACTTAAGACCAAACAGAAGCAGG + Intronic
1181872180 22:25908411-25908433 CCGTCAGTCCTGCCAGAAGCGGG + Exonic
1182715793 22:32355376-32355398 CCTTCCTCTCAGACAGCAGCTGG + Intronic
1183511542 22:38238139-38238161 CATTCAGGGCAGAAAGAAGCAGG - Intronic
1183617784 22:38955621-38955643 TCTGCAGCCCAGACATGAGCGGG - Intronic
1183896766 22:40975645-40975667 CCTTTTGCCCAAGCAGAAGCTGG - Intergenic
1184001166 22:41674674-41674696 TGTTCAGAGCAGACAGAAGCAGG - Exonic
1184264883 22:43341709-43341731 TCTCCAGCCCAGACAGGAGCGGG - Intronic
1184947123 22:47811382-47811404 CACTCAGCACACACAGAAGCAGG - Intergenic
1185294883 22:50048247-50048269 CCTGGAGGACAGACAGAAGCAGG - Intronic
1185334976 22:50267370-50267392 CCTTCAGCCCGCGCAGCAGCTGG + Exonic
949894076 3:8756496-8756518 CCCAAAGCCAAGACAGAAGCTGG + Intronic
950121243 3:10483813-10483835 TCTCCAGTCCAGACAGATGCTGG + Intronic
950191162 3:10977156-10977178 CCTTGAGCCCAGGCATCAGCAGG - Intergenic
950629769 3:14274752-14274774 ACTCCAGACCAGACTGAAGCAGG - Intergenic
952820541 3:37482223-37482245 CCTGCAGCCCAGGCAGATGCTGG + Intronic
954498710 3:50989205-50989227 GCTTCACCCCAGAGAGATGCAGG - Intronic
956537732 3:70296800-70296822 TCTTCAGCCCACACTGTAGCTGG + Intergenic
957953184 3:87150282-87150304 CCTTTAGCCATGACTGAAGCTGG + Intergenic
960492341 3:118332983-118333005 CTTTCAGCCAAAACTGAAGCTGG - Intergenic
960561680 3:119091203-119091225 TCTTCAGCCTAGCCAGAATCTGG - Intronic
960753567 3:120983137-120983159 CCCTCAGGCCAGAAAGAAGCAGG - Intronic
960818361 3:121698245-121698267 CCTTCACCTGAGAGAGAAGCTGG + Exonic
961568159 3:127778539-127778561 CTTTCATCCCAGACAGCAGAAGG - Intronic
962106352 3:132394518-132394540 CATCCAGCCCAGAGAGCAGCTGG + Intergenic
962896219 3:139717304-139717326 CTGTCAGCCCAGACAGCAACCGG + Intergenic
964150054 3:153513213-153513235 TTTTCAGCTCAGACAGAAACTGG + Intergenic
966757457 3:183384762-183384784 CCTGCTGCCCAGACAGAACCAGG - Intronic
967198589 3:187051032-187051054 CCTTCAGCCCTTACAGTGGCTGG + Intronic
967741722 3:193010434-193010456 CCTTCAGCCTTGACAGACACAGG - Intergenic
967812784 3:193774622-193774644 CCTTAAGCCCAGACGGCTGCTGG - Intergenic
967863316 3:194169965-194169987 CTTTCAGCCAAGAGAGAAGCTGG - Intergenic
1202739362 3_GL000221v1_random:39723-39745 CCATCAGCCCAGGCAGGATCTGG - Intergenic
968757862 4:2426151-2426173 CCATCACCACAGACCGAAGCTGG - Intronic
969300886 4:6296256-6296278 GCTTCAGCCCAAAGAGCAGCAGG + Intronic
970136685 4:12932870-12932892 CATTTAGCCCAGAGAGAAGAGGG - Intergenic
971081290 4:23214746-23214768 GCATCAGCAAAGACAGAAGCCGG - Intergenic
973270977 4:48263136-48263158 ACATCAGCCCAGCCAGAAACAGG + Intronic
978391847 4:108235501-108235523 CCTTCAGTGCAGACAGAAAATGG + Intergenic
982100327 4:151960842-151960864 CTTTCTGAGCAGACAGAAGCAGG - Intergenic
982274047 4:153621828-153621850 CCTGCTGCCCAGAGAGAGGCAGG + Exonic
1202766542 4_GL000008v2_random:153525-153547 CCATCAGCCCAGGCAGGATCTGG + Intergenic
985628416 5:1002182-1002204 GCTGCAGCTCAGGCAGAAGCAGG + Intergenic
986496824 5:8350863-8350885 CTTCCAGCCCACAGAGAAGCAGG + Intergenic
988439505 5:31216336-31216358 CCTGCAGGCCACACAAAAGCAGG - Intronic
990975975 5:61562261-61562283 CCCTCAGCCCAAACAGACGGGGG - Intergenic
992078605 5:73214222-73214244 CCCTGAGCCCAGCCAGAGGCAGG + Intergenic
994242710 5:97443872-97443894 GCTCCAGCCCAGAGAGATGCAGG + Intergenic
994680915 5:102886801-102886823 CCCACAGGACAGACAGAAGCTGG - Intronic
994817435 5:104601953-104601975 CCTTCGGTGCAGACAGAACCTGG - Intergenic
995481769 5:112600407-112600429 CCATCAGGCCAGAAAGAGGCTGG + Intergenic
998045670 5:138984738-138984760 CCTTATACCCAGACAAAAGCAGG + Intronic
999048271 5:148492909-148492931 CCTTCCACCAAGCCAGAAGCTGG + Intronic
999074566 5:148781781-148781803 GCTCCACCCCAGACAGATGCAGG - Intergenic
999371965 5:151061221-151061243 CCTTCATCCCAGAAAGGGGCAGG + Intronic
1000168002 5:158673660-158673682 CCTTCAGATAATACAGAAGCAGG - Intergenic
1002212178 5:177605596-177605618 GAGTCAGCCCGGACAGAAGCTGG - Intronic
1002845813 6:943234-943256 CCTTGAACCCCAACAGAAGCTGG - Intergenic
1003021269 6:2511626-2511648 CCTTCTTCCAATACAGAAGCTGG - Intergenic
1004000689 6:11594359-11594381 CCTTCGGTCCAGAGAGAGGCTGG - Intergenic
1006946032 6:37785075-37785097 CCTTGGACCCAGACATAAGCTGG + Intergenic
1007573796 6:42911750-42911772 CCTCCAGCCCAGGGAGGAGCTGG - Intergenic
1011411509 6:87071253-87071275 ACCTCAGCCCTGACAGTAGCTGG + Intergenic
1016670460 6:146699476-146699498 TCTTCTGCCCAGGCAGAAGATGG + Intronic
1021796943 7:24265341-24265363 CCTAAATCCCAGAAAGAAGCAGG + Intergenic
1023834853 7:44062115-44062137 CCTTCACCCCAGGCACTAGCAGG - Intronic
1024582244 7:50809641-50809663 TCTTCAGCCACGTCAGAAGCTGG + Intergenic
1025846180 7:65200295-65200317 CCTAGAGCCCAGAAGGAAGCTGG + Intergenic
1028063307 7:86348690-86348712 CACTGAGCCCAGTCAGAAGCAGG + Intergenic
1028650964 7:93150484-93150506 CCTTCAGAGCTGACAGAAGGAGG - Intergenic
1029504028 7:100951385-100951407 GAGTCAGCCCAGACAGCAGCAGG + Intronic
1032501941 7:132406203-132406225 TTCTCAGCCCAGACAGAAGTTGG + Intronic
1034196972 7:149255493-149255515 CCATCCCCCCAGACAGCAGCGGG - Exonic
1034512277 7:151545726-151545748 CCTGCTGCCCAGCCAGAAGCTGG - Intergenic
1035662189 8:1356488-1356510 CCACCAGCACAGACAGAACCAGG - Intergenic
1036440756 8:8779764-8779786 CCTGCTGCCAAGTCAGAAGCGGG - Intergenic
1036490807 8:9223844-9223866 CATTCAACCCAGACATCAGCAGG - Intergenic
1042229260 8:66540442-66540464 CCTGCAGCCCAGAATGAGGCTGG - Intergenic
1042973086 8:74432561-74432583 CCTCCAGCCCATCCAGAAGATGG - Intronic
1043784494 8:84380930-84380952 CTGGCAGCTCAGACAGAAGCTGG + Intronic
1048563058 8:135563446-135563468 CCTTCCTCTCAGCCAGAAGCTGG + Intronic
1052626506 9:30982415-30982437 CCTGCACCCCAGAGAGATGCAGG - Intergenic
1052703068 9:31960707-31960729 GCTTCACCCCAGAGAGATGCAGG - Intergenic
1053346389 9:37381576-37381598 TCTGCAGCCCGGACAGGAGCTGG - Intergenic
1054931111 9:70636309-70636331 CTTGCAGCCCATACAGAAACAGG + Intronic
1055623476 9:78149814-78149836 CATTCAGCACAGACAGAGTCTGG + Intergenic
1055757867 9:79573512-79573534 CCAACAGCCCAGGCAGAGGCTGG - Intronic
1055991927 9:82115630-82115652 CTTGCAGCTCAGAGAGAAGCTGG + Intergenic
1059343623 9:113613534-113613556 CCTCCAGCCCAAACAGCTGCAGG - Intergenic
1059541167 9:115131971-115131993 GCATCAGCCTAGACAGAAGGTGG - Intergenic
1060246697 9:121952528-121952550 CCTCCTCCCCAAACAGAAGCTGG - Intronic
1061226825 9:129285158-129285180 CTCTCAGCCCAGCCAGAACCAGG - Intergenic
1061885143 9:133587587-133587609 CCTTCAGTGCAGTCAGAGGCTGG + Intergenic
1061940779 9:133882764-133882786 CCTTCAGAGCAGACAGACTCAGG + Intronic
1062051574 9:134449999-134450021 CCTTCAGCTAAGACGGAATCAGG - Intergenic
1062324310 9:136004979-136005001 CTTGCAGCCCCGACAGAAACCGG - Intergenic
1062376147 9:136262747-136262769 CCTGCAGCCCAGCCTGGAGCAGG + Intergenic
1203772201 EBV:55141-55163 CGATCAGCTCAGACAGAAGGAGG - Intergenic
1203708005 Un_KI270742v1:69672-69694 CCATCAGCCCAGGCAGGATCTGG - Intergenic
1203547299 Un_KI270743v1:138403-138425 CCATCAGCCCAGGCAGGATCTGG + Intergenic
1186394875 X:9197862-9197884 CCTTCAGTACAAACACAAGCCGG + Intergenic
1188289699 X:28372086-28372108 GCTCCACCCCAGACAGACGCAGG + Intergenic
1188809200 X:34631632-34631654 CCTTTGGCCCTGACAGAAGTAGG - Intronic
1190125993 X:47706077-47706099 CATTAAGCCCAGAGACAAGCTGG + Intergenic
1190339544 X:49286031-49286053 CCTGGAGCCCAGTCAGCAGCAGG + Exonic
1192166946 X:68832433-68832455 TCCTCAGCCCTGTCAGAAGCTGG + Intronic
1195248261 X:103016936-103016958 CCTTCAATTCAGACAGAGGCTGG + Intergenic
1195745189 X:108110285-108110307 CCTTAAGCCCAGAAAGAGGAGGG + Intronic
1196582999 X:117396998-117397020 GCTCCACCCCAGACAGATGCAGG - Intergenic
1196796196 X:119503683-119503705 ATTTCAGCCCAGCCAGGAGCAGG + Intergenic
1197040402 X:121929769-121929791 CTTTTAGCCAAGACTGAAGCTGG - Intergenic
1197371147 X:125627640-125627662 CCTCCATCCCTGACAGAATCTGG + Intergenic
1199299036 X:146191417-146191439 CAATCAGTCCAGACAGAATCAGG + Intergenic
1199438081 X:147836721-147836743 CCTTCAGCTCAGTAAGAGGCGGG + Intergenic