ID: 1077457966

View in Genome Browser
Species Human (GRCh38)
Location 11:2692291-2692313
Sequence CAATAGGGATGGAGGGAAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 546
Summary {0: 1, 1: 0, 2: 3, 3: 31, 4: 511}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077457966_1077457976 16 Left 1077457966 11:2692291-2692313 CCTGCTTCCCTCCATCCCTATTG 0: 1
1: 0
2: 3
3: 31
4: 511
Right 1077457976 11:2692330-2692352 CCACCATTTCTCTGTACTGCAGG 0: 1
1: 0
2: 0
3: 13
4: 141
1077457966_1077457978 30 Left 1077457966 11:2692291-2692313 CCTGCTTCCCTCCATCCCTATTG 0: 1
1: 0
2: 3
3: 31
4: 511
Right 1077457978 11:2692344-2692366 TACTGCAGGCATCTCCTAACTGG 0: 1
1: 0
2: 1
3: 23
4: 207
1077457966_1077457972 -7 Left 1077457966 11:2692291-2692313 CCTGCTTCCCTCCATCCCTATTG 0: 1
1: 0
2: 3
3: 31
4: 511
Right 1077457972 11:2692307-2692329 CCTATTGCCACTGTCCTGATAGG 0: 1
1: 0
2: 0
3: 6
4: 107

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077457966 Original CRISPR CAATAGGGATGGAGGGAAGC AGG (reversed) Intronic
900760026 1:4464120-4464142 CAGTGGGGTTGGAGGGAAGGAGG - Intergenic
900993307 1:6107683-6107705 ATATAGGGATGGAGGGATGATGG + Intronic
901193215 1:7424952-7424974 GCATAGGGAGGGAGGGAGGCAGG + Intronic
901300450 1:8196557-8196579 GAAGAGGGAGGCAGGGAAGCAGG - Intergenic
901419753 1:9143004-9143026 CAGGAGGGAGGGAGGGAAGAAGG - Intergenic
902589043 1:17460429-17460451 CAATTGGGATGCAGAGAAGGAGG - Intergenic
902699744 1:18163661-18163683 CAATGGGGTTGCAGGGAAGTTGG - Intronic
903296351 1:22345476-22345498 CCATAGCGATGCAGCGAAGCTGG - Intergenic
903341666 1:22658760-22658782 ACAGAGGGATGGAGGGATGCAGG + Intronic
904118631 1:28180420-28180442 CAACAGGCAGGGAGGGAACCAGG + Intronic
904623415 1:31789040-31789062 CAGTTGGTATGGAGGGAAACGGG - Intergenic
905452339 1:38064745-38064767 CAACAGGAAGCGAGGGAAGCAGG - Intergenic
905538860 1:38744523-38744545 CAAAAGGGCTGGAGGGAACTAGG + Intergenic
905776382 1:40669985-40670007 CAAGAGGGATGGAGAGAAGTGGG - Intergenic
906783987 1:48597887-48597909 AAAGAGGGAGGGAGGGAAGGAGG + Intronic
907074501 1:51566179-51566201 AAAGAGGCATGGAGGGAAGAGGG - Intergenic
907462518 1:54613419-54613441 GAAAAGGGAGGGAGGGAAGGAGG - Intronic
907492858 1:54820048-54820070 AGATAGGGAGGGAGGGAAGAAGG - Intronic
907508080 1:54936569-54936591 AAAGAGGGAAGGAGGGAAGGAGG - Intergenic
908149543 1:61285660-61285682 AAATAGGGGTGGAGGGTAGGGGG + Intronic
908474328 1:64472803-64472825 CCCTAGGGATGGAGTGAAGGTGG - Intronic
908625060 1:66030959-66030981 GAAGAGGGAGGGAGGGAAGAGGG + Intronic
911470561 1:98313007-98313029 CAAAAGGGATGGAGGAAAGTGGG + Intergenic
912330473 1:108815817-108815839 CAGTGAGGATGGAGGGAAACTGG - Intergenic
913116921 1:115705813-115705835 AAATAGGGAGGGAGGGAGGGAGG - Intronic
913185025 1:116363058-116363080 GGATAGGGATGCAGGGAAGCTGG - Intergenic
913524747 1:119679968-119679990 CATTAGAGATGGCTGGAAGCAGG + Intronic
914846986 1:151288869-151288891 CCATGGAGATGGGGGGAAGCAGG + Intronic
914854465 1:151341115-151341137 CAATAGGGTGAGAGGGAAGCAGG + Exonic
915128479 1:153681355-153681377 GAATAGGGAAGGATGGAGGCTGG - Intronic
916058232 1:161082477-161082499 AAATAGGGATGGAAGGAGGCAGG + Intronic
916482244 1:165225010-165225032 AATTAGGGATGGAGAGAAGGAGG + Intronic
917016478 1:170537108-170537130 AAAGAGGGAGGGAGGGAAGAAGG - Intronic
917042580 1:170822442-170822464 CACTAGAGATGGAGGGGAGATGG - Intergenic
917343245 1:174002593-174002615 CAATAGTGGTGGATGGAAACAGG - Intronic
917482892 1:175427755-175427777 AAAGAGGGAAGGAGGGAAGAAGG - Intronic
917709334 1:177668842-177668864 CCAAAGGGAAGGAGGGAAGCTGG - Intergenic
917811571 1:178663384-178663406 TAATAAGGATGGAGGGGAGGAGG + Intergenic
918223530 1:182457525-182457547 CAAATGGGATTGAGGGAAGAGGG + Intronic
918301495 1:183208120-183208142 CAAGAGGGAAGGAAGGAAGGAGG + Intronic
918418987 1:184342832-184342854 CAACAGAGATGGAGGGCAGTGGG - Intergenic
919874082 1:201848732-201848754 CAATAGAGCTGGAGGGTAGATGG - Intronic
920023686 1:202976117-202976139 AAAGAGGGAAGGAGGGAAGGAGG - Intergenic
920526687 1:206672210-206672232 AGATAGGAGTGGAGGGAAGCGGG - Intronic
920684934 1:208102171-208102193 CTGGAGGGAGGGAGGGAAGCTGG - Intronic
921787228 1:219245149-219245171 GAAGAGGGAGGGAGGGAAGGAGG - Intergenic
923689258 1:236176745-236176767 TAAGAGGGAGGGAGGGAAGAAGG - Intronic
924083722 1:240426636-240426658 CAATATGGGAGGAGGCAAGCGGG - Intronic
924116529 1:240753177-240753199 CAGAAGGGAGGGAGGGAAGGAGG - Intergenic
1062822980 10:548504-548526 CAGGAGGGAGGGAGGGAGGCAGG + Intronic
1062885223 10:1011064-1011086 CAGTCAGGATGGAGGGATGCAGG - Intronic
1062885246 10:1011150-1011172 CAGTCAGGATGGAGGGATGCAGG - Intronic
1063289963 10:4735116-4735138 AAAGAGGGAGGGAGGGAAGGAGG - Intergenic
1065142204 10:22728710-22728732 AAATTGGGAGGGAAGGAAGCAGG + Intergenic
1065772876 10:29093975-29093997 GGATAGGCATGGAGGGAGGCTGG - Intergenic
1066177774 10:32927304-32927326 CAACAGGAGTGGAGAGAAGCAGG + Intronic
1067914669 10:50384473-50384495 AAGCAGGGATGGAGGGAAGGAGG - Intronic
1068994018 10:63181745-63181767 GAATAGTAATGGAGGAAAGCAGG + Intronic
1069312929 10:67061460-67061482 CAAATGGTATGGAGAGAAGCAGG - Intronic
1069583951 10:69584575-69584597 CAATGGGAATGGAGTGAAGTGGG + Intergenic
1069840146 10:71334751-71334773 GAATGGGGATGGGGGGAGGCTGG - Intronic
1071444772 10:85735806-85735828 AAGGAGGGATGGAGGGATGCAGG + Intronic
1071908524 10:90203020-90203042 CATCAGGGATGGAGAGAAGCAGG - Intergenic
1072651392 10:97298519-97298541 AAAAAGGGAGGGAGGAAAGCTGG + Intergenic
1072722123 10:97787583-97787605 CAAAAAGGATGGAGGGAACAAGG - Intergenic
1073072710 10:100805101-100805123 GAATAGATATGGAGGGAAGATGG + Intronic
1073674387 10:105628827-105628849 CAATATGCAGAGAGGGAAGCAGG - Intergenic
1074107826 10:110401744-110401766 CCATGGGGAGGGAGGGAGGCAGG - Intergenic
1075536248 10:123274718-123274740 CAAAATGGATGGAGGGAGGTGGG + Intergenic
1075656289 10:124163315-124163337 TAATGGGGATGGAGGGAGGGAGG + Intergenic
1075699442 10:124459718-124459740 CATAAGGGAAAGAGGGAAGCAGG - Intergenic
1076000666 10:126910463-126910485 GAAAAGGGAGGGAGGGAAGGAGG - Intronic
1076454348 10:130579052-130579074 CCCTATGGCTGGAGGGAAGCAGG - Intergenic
1077217470 11:1400938-1400960 CAGCAGGGATGGAAGGAAGGAGG - Intronic
1077457966 11:2692291-2692313 CAATAGGGATGGAGGGAAGCAGG - Intronic
1077549687 11:3194545-3194567 CAACATGGAAGGAGGGAAGGGGG - Intergenic
1077574978 11:3376106-3376128 GAGTTGGGATGGAAGGAAGCTGG - Intronic
1077787637 11:5401971-5401993 CAAGCGGGAGGGAGGGAAGGAGG - Intronic
1078307955 11:10210006-10210028 CAAGAAGGAAGGAAGGAAGCTGG + Intronic
1078460131 11:11508822-11508844 CTACAGTGATGGAGTGAAGCTGG - Intronic
1079822855 11:25152939-25152961 GGATAGGCATGGAGAGAAGCTGG - Intergenic
1079922529 11:26450403-26450425 CAATAGGGCTAGGGAGAAGCAGG + Intronic
1081093737 11:38905047-38905069 AAATAGGGAGGGAGGAAAGGGGG + Intergenic
1081477508 11:43449002-43449024 CAATGGGGATGGAGAAAAGTAGG - Intronic
1081501381 11:43669996-43670018 CTTAAGGGAGGGAGGGAAGCTGG + Intronic
1081729341 11:45358156-45358178 CATTTGGGATGGAGGGCAGAGGG + Intergenic
1083034958 11:59628514-59628536 CAGGAGGGAGGGAGGGAAGGAGG - Intergenic
1083147167 11:60768203-60768225 AAAAAGGGATGGAGGGCATCAGG + Intronic
1083318647 11:61831792-61831814 CAACAGGAAGGGAAGGAAGCTGG - Intronic
1083651596 11:64207704-64207726 CAGAAGGGAGGGAGGGAAGAGGG - Intronic
1084704180 11:70806371-70806393 AAGTAGGGTTGGAGGGAAGTTGG - Intronic
1084919544 11:72458070-72458092 AAAGAGGGAGGGAGGGAAGGAGG + Intergenic
1085004619 11:73074929-73074951 CAGTGGGGAGGGAGGGAGGCAGG + Intronic
1085658982 11:78345031-78345053 CAGGAGGGAGGGAGGGAGGCGGG + Intronic
1085775827 11:79365706-79365728 CAACAGGCACAGAGGGAAGCAGG + Intronic
1085877815 11:80430115-80430137 CAACAGGGTTGGATGGAACCAGG - Intergenic
1085998209 11:81947968-81947990 TGAGAGGGAGGGAGGGAAGCGGG + Intergenic
1086390798 11:86360742-86360764 AAATAAGGATGGAAGGAAACAGG + Intergenic
1086509725 11:87543403-87543425 CAATTGGGATGTAGGGCACCAGG + Intergenic
1086540278 11:87900731-87900753 GAAGAGGGAGGGAGGGAAGAAGG + Intergenic
1087128400 11:94648116-94648138 CAATGGGGATTTGGGGAAGCAGG + Intergenic
1087417015 11:97870285-97870307 CAATAGGGAGGAAGGAAAGAAGG - Intergenic
1087813586 11:102634222-102634244 ACATAGAGATAGAGGGAAGCTGG - Intergenic
1087901558 11:103647167-103647189 CAATAGAGAGAGAGTGAAGCGGG + Intergenic
1088126168 11:106426353-106426375 TATGAGGGATTGAGGGAAGCTGG + Intergenic
1088194182 11:107257469-107257491 GGATATGGATGGTGGGAAGCAGG + Intergenic
1088919824 11:114252733-114252755 CACGAGGAATGTAGGGAAGCCGG + Intergenic
1088979714 11:114851296-114851318 AGAGAGGGAGGGAGGGAAGCAGG - Intergenic
1089531201 11:119130973-119130995 TAATTGGGGTGGAAGGAAGCTGG + Intronic
1089733732 11:120535379-120535401 TAAGAGGGAGGGAGGGAAGGAGG + Intronic
1090357069 11:126147232-126147254 CAGTAGGGAGGGAGGGAGGGAGG - Intergenic
1090746663 11:129710829-129710851 CAATAAGGAAGGAGGGAAATGGG - Intergenic
1091022823 11:132116231-132116253 CCATAGGGCTGGAGGGACACAGG + Intronic
1091584993 12:1811059-1811081 CGAGAGGGATGGAGGGCAGGGGG - Intronic
1092009749 12:5099534-5099556 GAATAGGGGTGGAGGAAAACAGG - Intergenic
1095535028 12:43235088-43235110 TAATAGGAAGGGAGGGAAGGAGG + Intergenic
1095946426 12:47756353-47756375 CAAGAGGGAAGGAGGGAGGGAGG + Intronic
1096072382 12:48782534-48782556 AGGTAGGGATGGAGGGCAGCAGG - Intronic
1096123827 12:49105613-49105635 CAATAGGGAGGGAGTGGAGTGGG - Intronic
1096398002 12:51281308-51281330 CGGGAGGGATGGAGGGAGGCAGG - Exonic
1096943190 12:55372469-55372491 AAGGAGGGAAGGAGGGAAGCAGG + Intergenic
1097279092 12:57833467-57833489 GGAAAAGGATGGAGGGAAGCAGG - Intronic
1097323694 12:58252511-58252533 AAATAGGCAGGGAGGGAAGGAGG - Intergenic
1097912239 12:64982714-64982736 GAATTGGGATGGAGGAAAGCAGG - Intergenic
1099005716 12:77232913-77232935 AAAGAGGGAGGGAGGGAAGGAGG - Intergenic
1099609413 12:84848502-84848524 AAAGAGGGATGGATGGAAGGAGG + Intergenic
1101662052 12:106774636-106774658 AAAGAGGGAAGGAAGGAAGCTGG + Exonic
1102152538 12:110698753-110698775 AAAAACGGAAGGAGGGAAGCGGG - Intronic
1102176044 12:110875752-110875774 CGTTAGGGATGAAGGGAAGAGGG - Intronic
1102773745 12:115501143-115501165 TAGTAAGGATGGTGGGAAGCAGG + Intergenic
1103652444 12:122443464-122443486 AAAGAGGGAAGGAGGGAAGGAGG - Intergenic
1104084671 12:125463331-125463353 CAATAGGGATGGATGGCAATGGG + Intronic
1104772874 12:131375161-131375183 AGAGAGGGATGGAGGGAAGATGG + Intergenic
1105514687 13:21078382-21078404 AAAGAGGGAGGGAAGGAAGCGGG + Intergenic
1105694408 13:22873592-22873614 CAAAAGGAATGGAGGGAGGGAGG - Intergenic
1105756645 13:23471012-23471034 CAACAGGGTTGGAGGGAGGGAGG + Intergenic
1106938564 13:34750713-34750735 GAAGAGGGAGGGAGGGAAGGAGG + Intergenic
1106966507 13:35077569-35077591 CAATATGGATGGAGGGGAAAGGG - Intronic
1107842602 13:44474694-44474716 AAATAAGAATGGAGGGAAGAAGG + Intronic
1108436466 13:50406002-50406024 GAAGAGGGAGGGAGGGAGGCAGG - Intronic
1108514818 13:51191120-51191142 GAATAGGAATGGAGGGAAAGGGG - Intergenic
1108829293 13:54456918-54456940 AAAGAGGGAGGGAGGGAAGGAGG - Intergenic
1110012100 13:70349442-70349464 AAAAAGGGATGGAGGGAGGGAGG + Intergenic
1110392839 13:74995187-74995209 AAAAAGGGCTTGAGGGAAGCTGG - Intergenic
1111446172 13:88348038-88348060 AAAAAGGGAAGGAGGGAGGCAGG + Intergenic
1111855676 13:93634079-93634101 CGAATGGGATTGAGGGAAGCTGG - Intronic
1112130600 13:96519524-96519546 CAATAGGGCTGGAAGTGAGCTGG + Intronic
1112158540 13:96844750-96844772 CTGTAGGGATGGAGACAAGCAGG - Intergenic
1112406325 13:99123789-99123811 CAAAAGGGTTGGAAGGAAGCAGG - Intergenic
1113120914 13:106923143-106923165 CAAAAATGAAGGAGGGAAGCTGG + Intergenic
1113680686 13:112242227-112242249 ACAGAGGGATGGAGGGAAGGAGG + Intergenic
1114260215 14:21031193-21031215 CAATGGGGATTTAGGGAAGTAGG - Intronic
1114739536 14:25081085-25081107 AAAGAGGGAGGGAGGGAAGAAGG - Intergenic
1115026801 14:28756145-28756167 AAAGAGGGAAGGAGGGAAGGAGG + Intergenic
1115054669 14:29108822-29108844 AAAGAGGGAGGGAGGGAAGTAGG + Intergenic
1115765392 14:36617964-36617986 CATAAGGGAGGGAGAGAAGCAGG + Intergenic
1116303780 14:43221692-43221714 CAGTAGGGATGGTGGGAGGAGGG - Intergenic
1116472713 14:45305086-45305108 CAATAGGGATGAGTGCAAGCAGG - Intergenic
1116548476 14:46202712-46202734 CAAGAGGGATGAAGAGAAGTTGG + Intergenic
1117699259 14:58396518-58396540 CAAAAGGGAGGGAAGGAAGGAGG + Intronic
1118346235 14:64943058-64943080 AAAAAGGGAGGGAGGGATGCAGG + Intronic
1119151292 14:72361949-72361971 TAAGAGGGCTGCAGGGAAGCAGG + Intronic
1119431205 14:74569141-74569163 AGATAGAGATGGAGGGAAGGAGG + Intronic
1120122966 14:80704761-80704783 CAATAAGGAAGAAGGGAAGGAGG - Intronic
1121334025 14:93065829-93065851 ACATAGGGATGGTGGGAAGCTGG + Intronic
1121430932 14:93888038-93888060 ACAGAGGGAGGGAGGGAAGCAGG - Intergenic
1121678492 14:95773553-95773575 CAATTGGGATGGAAGGTGGCTGG - Intergenic
1121780798 14:96620937-96620959 GAATGGGCATGGAGTGAAGCCGG - Intergenic
1121797225 14:96745206-96745228 CTGTAGGGAAGGAGGGAGGCAGG - Intergenic
1122040401 14:98983779-98983801 CAATAGGAAGGGAGGGAGGAAGG + Intergenic
1122412952 14:101535235-101535257 CAGTGGGGATGGAGGGGACCCGG - Intergenic
1122855759 14:104559420-104559442 AGATGGGGATGGAGGGAGGCCGG - Intronic
1123410919 15:20058399-20058421 AAAGAGGGAGGGAGGGAAGAAGG + Intergenic
1124153094 15:27199888-27199910 AAAGAGGGAAGGAAGGAAGCAGG - Intronic
1124598422 15:31110906-31110928 CAGAAGGGAGGGAGGGAAGGGGG - Intronic
1125841503 15:42805608-42805630 TAATAGAGATGGAGGGAAATGGG - Intronic
1126464615 15:48950609-48950631 CAGTGGGGATGGAGGGAAATGGG + Intronic
1127613804 15:60663137-60663159 CTATAGAGAGTGAGGGAAGCTGG - Intronic
1128942391 15:71799430-71799452 AAAAAGGGAGGGAGGGAGGCTGG - Intronic
1130000481 15:80042228-80042250 AAAGAGGGAGGGAGGGAAGTAGG - Intergenic
1130764933 15:86860348-86860370 CAAAAGGAATGAAGGGGAGCTGG - Intronic
1130938139 15:88487445-88487467 CAGTGGGGATGGAGAGAAGTTGG + Intergenic
1131016397 15:89061082-89061104 AAATGGGGAGGGAGGGAAGGAGG + Intergenic
1131102667 15:89705375-89705397 CAAGAGGGGTGGAGGAAGGCAGG + Intronic
1131330630 15:91496012-91496034 AGAGAGGGATGGAGGGAAGGAGG - Intergenic
1131354744 15:91734926-91734948 AAAGAGGGAGGGAGGGAAGAGGG + Intergenic
1131361181 15:91792068-91792090 CAAAGGGGATGGAGGGAGGAGGG - Intergenic
1131901055 15:97088464-97088486 CAAGAGGGAGGCAGGCAAGCAGG - Intergenic
1132255355 15:100372310-100372332 GACTAGGGAGGGAGGGAGGCAGG + Intergenic
1132378335 15:101347844-101347866 CAACAGGAGTGGAGGGCAGCAGG + Intronic
1133584681 16:7181502-7181524 GAAGAGGGAGGGAGGGAAGAAGG - Intronic
1133839301 16:9394145-9394167 AGAGAGGGAGGGAGGGAAGCAGG - Intergenic
1134291744 16:12907154-12907176 GAAGGGGGATGGAGGGAAGGAGG - Intronic
1135152563 16:20021858-20021880 AAATAGGGAGGGAGGGAGGGAGG - Intergenic
1135602799 16:23797499-23797521 TGAAAGGGAAGGAGGGAAGCTGG + Intergenic
1135609699 16:23855673-23855695 TATAAGGGATAGAGGGAAGCAGG + Intronic
1137598763 16:49742339-49742361 GAAGAGGGGAGGAGGGAAGCAGG + Intronic
1137637789 16:50002231-50002253 AAAGAGGGAGGGAGGGAAGGTGG - Intergenic
1137985913 16:53107949-53107971 CAATAGGGAGGGAGGGGTGAAGG + Intronic
1138250233 16:55496660-55496682 CAATATGGATGGAGGTAGTCAGG + Intronic
1139464216 16:67145544-67145566 CAAGAGGGATAGAGGGGAGCAGG - Intronic
1141102581 16:81208918-81208940 CAGTAGGTATGGAGTGCAGCTGG + Intergenic
1141531726 16:84650863-84650885 CTTTAATGATGGAGGGAAGCAGG + Exonic
1141568392 16:84918917-84918939 CCACTGGGATGGAGAGAAGCTGG + Intronic
1143035152 17:3990869-3990891 AAAAAGGGAGGGAGGGAGGCAGG - Intergenic
1143650859 17:8263688-8263710 CAAGAGAGATGGGTGGAAGCGGG - Intronic
1143726141 17:8847939-8847961 CAATAAGCAGGGAGGGATGCTGG - Intronic
1144204683 17:12971760-12971782 CACCAGGGATGGAGGGAAAGGGG - Intronic
1144242123 17:13322845-13322867 AAAGAGGGACGGAGGGAAGAAGG - Intergenic
1144952166 17:19000213-19000235 CACTAGGGCTGGAGGGAGGCTGG + Intronic
1145010455 17:19364918-19364940 CCATAGGCATGCAGGGAAGAGGG - Intronic
1146086333 17:29833714-29833736 AAGTAGGGAGGGAGGGAAGGAGG - Intronic
1146299097 17:31674263-31674285 CAGTAGGCAAGGAGGGAAGAAGG + Intergenic
1146477055 17:33171524-33171546 CAATGGTGATGGAGAAAAGCAGG - Intronic
1146631028 17:34469385-34469407 CATTAGGGTTGGAGGGAAGCTGG - Intergenic
1146822555 17:35996057-35996079 CAGGAGGGAGGGAGGGAAGGGGG + Intronic
1147425569 17:40344465-40344487 CCAGAGGGCTGGAGAGAAGCTGG + Intronic
1148231935 17:45941615-45941637 AAAGAGGGAAGGAGGGAAGGGGG - Intronic
1149334060 17:55617531-55617553 CCAAAGGGATGGAGCAAAGCCGG - Intergenic
1149388811 17:56169610-56169632 GGAAAGGGATGGAGGGTAGCAGG + Intronic
1149999218 17:61422474-61422496 GAAGAAGGATGGAGGGAAGAGGG + Intergenic
1150245366 17:63670710-63670732 CAAAAGGGATGCAAGGAAGAGGG + Intronic
1150775122 17:68075125-68075147 AGGGAGGGATGGAGGGAAGCAGG - Intergenic
1150790186 17:68196711-68196733 CCATTGGGCTGGAGGGCAGCAGG + Intergenic
1151303474 17:73246661-73246683 CACTAGGGATGGAAAGGAGCAGG - Intronic
1151685809 17:75646076-75646098 CAATAGGGAAGCTGGGAAGAGGG - Intronic
1151708810 17:75787946-75787968 TTATGGGGGTGGAGGGAAGCAGG - Intronic
1151724526 17:75876568-75876590 CAAGAGGGCCGGTGGGAAGCCGG - Intronic
1152014551 17:77741861-77741883 CATCAGGGATGGAGGGAGACTGG - Intergenic
1152204546 17:78967556-78967578 CCGTGTGGATGGAGGGAAGCCGG + Intergenic
1152726931 17:81952173-81952195 CAGAAGGGTTGAAGGGAAGCAGG + Intergenic
1155832484 18:30535142-30535164 TGAAAGGGATGAAGGGAAGCTGG + Intergenic
1155850096 18:30763511-30763533 CAAAAGGGATGAAGGGTAGAGGG + Intergenic
1156451473 18:37268888-37268910 CAAGAGGGAGGGAGGGATGGAGG - Intronic
1156631241 18:38971818-38971840 AAATATGTATGGAGGGATGCAGG - Intergenic
1156918432 18:42488977-42488999 CAATAGGGCTGGAGAGGAGTAGG - Intergenic
1158070235 18:53462028-53462050 GAAGAGGGATGGAGTGAAGAGGG + Intronic
1158435480 18:57432943-57432965 CAATATTGATCGAGGGAAGGCGG + Intergenic
1158551810 18:58442560-58442582 CAGTGGGGCTGGAAGGAAGCTGG - Intergenic
1159039256 18:63307818-63307840 CAAGAGGGAGGAAGGGAGGCTGG + Intronic
1159418822 18:68188170-68188192 AAATAGTGATGGAGGGAGGGAGG + Intergenic
1160888181 19:1362044-1362066 CAAGAGGGAAGGAGGGAAGGAGG - Intronic
1161122891 19:2539896-2539918 AAAGAGGGAGGGAGGGAAGGAGG - Intronic
1161842697 19:6692561-6692583 CCATAAGGATGGAGAGAAGGAGG + Intronic
1161980330 19:7626890-7626912 GAATAGGGGTGGGGAGAAGCAGG - Intronic
1161994235 19:7702661-7702683 TAGGAGGGAAGGAGGGAAGCGGG + Intergenic
1162134745 19:8548430-8548452 AAAGAGGGCTGGAGGGAAACTGG - Intronic
1162204683 19:9046934-9046956 AAAGAGGGAGGGAGGGAGGCAGG - Intergenic
1163004759 19:14390128-14390150 GAAGAGGGAGGGAGGGAAGGAGG + Intronic
1163148791 19:15399275-15399297 GCAGAGGGGTGGAGGGAAGCTGG + Intronic
1163521491 19:17794721-17794743 CGATAAGGAGGGAGGGAGGCAGG - Intergenic
1163689530 19:18730970-18730992 AAAAAGGGAAGGAGGGAAGGAGG - Intronic
1165321875 19:35090588-35090610 GAATAGGGAAGGCGGGGAGCGGG + Intergenic
1165717384 19:38055250-38055272 GAAAAGGGAGGGAGGGCAGCTGG + Intronic
1166329585 19:42070227-42070249 GAAGAGGGAGGGAGGGAGGCAGG + Intronic
1167250802 19:48397482-48397504 CAATTGAGATTGAGGGAGGCAGG - Intronic
1167854835 19:52229086-52229108 CATCAGGGCTGGAGGGAAGGAGG + Exonic
1168470747 19:56638760-56638782 CAATGGGGATGGAGAGCAGTGGG - Intergenic
1168601677 19:57723714-57723736 CAGTAGGGTGGGGGGGAAGCTGG - Intronic
925212457 2:2061561-2061583 CCAGAGGGATGGAGGGAAGAGGG + Intronic
926276892 2:11410739-11410761 AAATAGGCATAGAGGGAAGAGGG - Intergenic
927220396 2:20702782-20702804 CAACAGGGATGGAGGCAGGATGG - Intronic
927245007 2:20950555-20950577 CACGATGGATGGAAGGAAGCAGG - Intergenic
927672247 2:25078578-25078600 CAGCAGGGCTGGAGGGAAGCTGG - Intronic
927712717 2:25335813-25335835 CAATAGGGATGGTGGTGAGCAGG + Intronic
928251596 2:29686001-29686023 TAAAAGGGAAGGAGGGAGGCAGG - Intronic
928368817 2:30723801-30723823 CAAGAGAGGTGGAGGGAGGCAGG - Intronic
929372969 2:41249620-41249642 AAAGAGGGAGGGAGGGAAGGAGG + Intergenic
929883365 2:45856684-45856706 CAGGGGGGATGGAGGGAAGTTGG - Intronic
932168992 2:69536432-69536454 CAACAGGGATGGAAGTAAGCAGG + Intronic
932577110 2:72968727-72968749 AAAGAGGGAGGGAGGGAAGGAGG - Intronic
932693434 2:73933278-73933300 GAACAGTGATGGAGGGAAGGAGG - Intronic
932790920 2:74654164-74654186 CAATCGGGATTGAGTGAAGGCGG - Intergenic
933158702 2:79001390-79001412 CAATAGGAATGAAGAGAAGAGGG - Intergenic
933230780 2:79804967-79804989 CAAATGGGAAGGAGGGGAGCGGG + Intronic
933654003 2:84872533-84872555 CTAGAGGGAGGGAGGGAAGAAGG + Intronic
934687889 2:96335096-96335118 GAAGAGGGACGGAGGGGAGCGGG - Intergenic
934954455 2:98605934-98605956 CAGTGGGGCTGGAGGAAAGCAGG - Intronic
935846078 2:107166919-107166941 ACATAGGGATGTAGGGAAGGTGG - Intergenic
936416718 2:112322147-112322169 CAAGAGGGAGGGAGGGAGGAAGG - Intronic
936600059 2:113887209-113887231 CAAAAGAGAGAGAGGGAAGCGGG + Intergenic
937318150 2:120945062-120945084 CACTAGGGAGGGAGGGAAAGAGG + Intronic
937627902 2:124064446-124064468 TAATAGAAATGGAGAGAAGCAGG - Intronic
939786237 2:146516692-146516714 CAGTAGAGATGGAGATAAGCGGG + Intergenic
941855759 2:170228653-170228675 CACTAGCTATGGTGGGAAGCTGG + Intronic
942160068 2:173175085-173175107 CAAAAGAGAGGGAGGGAAGTAGG - Intronic
942211756 2:173678243-173678265 CAAGAGGGAGGGAGGGAAGAAGG + Intergenic
942280358 2:174356588-174356610 AAAGAGGGAGGGAGGGAAGAAGG + Intronic
942624369 2:177883814-177883836 CAAGAGGGAGGGAGGGGAGAAGG + Intronic
943239940 2:185370197-185370219 CAATAGGAATTGAGGCAAACAGG - Intergenic
944905317 2:204256380-204256402 AAAAAGAGATGGAGGGAAGGAGG + Intergenic
945051076 2:205824961-205824983 CAAGAGGGAGGGAGGGAGGGAGG + Intergenic
945958226 2:216105963-216105985 CAAGAGGGAGGGAGGGAAGGAGG + Intergenic
946552980 2:220823529-220823551 GAAGAGGGATGGAGGGAGGTAGG - Intergenic
946917538 2:224540410-224540432 AAAAAGGGAGGGAGGGAAGAAGG + Intronic
947210907 2:227707718-227707740 AAATAGAGATTGAGAGAAGCTGG - Intronic
947304605 2:228730257-228730279 CAATACGGATGGAAGGAATAAGG - Intergenic
948099897 2:235365270-235365292 AAAAAGGGAGGGAGGGAAGGAGG + Intergenic
948536535 2:238651346-238651368 CATTAGGGATGGATGGGGGCAGG - Intergenic
948650663 2:239441388-239441410 CAGCAGGGAGGGAGGGAGGCCGG + Intergenic
1169009816 20:2241230-2241252 AAAGAGGGAGGGAGGGAAGAAGG - Intergenic
1169248974 20:4045946-4045968 AGAAAGGGATGGAGGGAAGCAGG - Intergenic
1169252884 20:4073606-4073628 TCTTGGGGATGGAGGGAAGCAGG + Intronic
1169867417 20:10217233-10217255 CATTGCGGAGGGAGGGAAGCGGG - Intergenic
1170465320 20:16617748-16617770 GAATAGGGTGTGAGGGAAGCAGG + Intergenic
1170687689 20:18584345-18584367 CAGGAGGGATGGAGAGAAGAGGG + Intronic
1170813908 20:19696928-19696950 CAATGGGGAAGGAGGGAGGGAGG + Intronic
1170922980 20:20696630-20696652 CAATAGGGGTGGAGGGGTGGAGG - Intronic
1171965084 20:31523795-31523817 GAATAGGGAAGGAAGGAAACTGG + Intronic
1172071646 20:32261694-32261716 CAAAAGGGGTGGAGGGCAGTGGG - Intergenic
1172595726 20:36149769-36149791 CAAGAGAGCTGGAGGGCAGCTGG - Intronic
1172858744 20:38030248-38030270 AAGGAGGGAGGGAGGGAAGCAGG + Intronic
1173475594 20:43356861-43356883 CTCTAGGGGTGGAGTGAAGCTGG - Intergenic
1174472472 20:50771035-50771057 CACGAGGGAGCGAGGGAAGCTGG - Intergenic
1174747554 20:53078709-53078731 CAATAGAGATGTAGAGAAGTGGG + Intronic
1175565339 20:59970975-59970997 CAATAGGGAGGGGTGGAAACTGG - Intronic
1175816207 20:61884482-61884504 CAGGAGGGAGGGAGGGAAGATGG + Intronic
1175972279 20:62692674-62692696 GAAGAGGGAGGGAGGGAGGCCGG + Intergenic
1177046895 21:16182539-16182561 AAGGAGGGATGGAGGGAGGCAGG - Intergenic
1178027580 21:28485731-28485753 GAAAAGGGAGGGAGGGAAACAGG - Intergenic
1178460203 21:32795985-32796007 AAAGAGGGAAGGAGGGAAGGAGG - Intronic
1178492906 21:33064754-33064776 CAATGGGGAAGGAGTGAAACCGG + Intergenic
1178663179 21:34523483-34523505 CAAAAGGGAGGGAGGGAGGAGGG + Intronic
1178744775 21:35238261-35238283 CAGCAGGGGTGGAGGGGAGCTGG + Intronic
1179081676 21:38176973-38176995 AAAGAGGGATGAAGGGAGGCAGG + Intronic
1179249613 21:39661965-39661987 CGACAGGGATGGAAGGATGCCGG - Exonic
1180151561 21:45950801-45950823 CAACAGGGCTGGAGGGAGGGAGG - Intergenic
1182257370 22:29048891-29048913 AAACAGGGATGGAGGGACACTGG + Intronic
1182393059 22:30015509-30015531 GAAGAGGGAGGGAGGGAAGGAGG - Intronic
1182486344 22:30641309-30641331 GACTAGGGAGGGAGGGAAGGAGG - Intronic
1182754434 22:32667283-32667305 GAAAAGGGAGGGAGGGAAGGAGG - Intronic
1183272079 22:36868560-36868582 GAAGAGGGAGGGAGGGGAGCTGG + Intronic
1185045047 22:48524563-48524585 CACTCGGGATGGCTGGAAGCTGG + Intronic
949457101 3:4250289-4250311 GAAGAGGGAAGGAGGGAAGGAGG + Intronic
949547531 3:5084585-5084607 CAAAGGGGAGGGAGGGACGCAGG + Intergenic
949893044 3:8747426-8747448 GAATAGGGATGTAAGAAAGCTGG - Intronic
950175659 3:10872390-10872412 AAATGGGGATGGAAGGAAGACGG - Intronic
950526863 3:13529348-13529370 CAGGAGGGATGGAGGGAAAAGGG - Intergenic
950546121 3:13639070-13639092 CACTGTGGGTGGAGGGAAGCAGG + Intergenic
951498952 3:23362488-23362510 CAGCAGGGATGGAGGGAGGAGGG - Intronic
951651302 3:24954652-24954674 CAATAGAGAGGGAGAGAAGGGGG + Intergenic
951752155 3:26048442-26048464 CACTAAGAATGGAGGGAAGGGGG - Intergenic
951840689 3:27030939-27030961 CAATAGGGATGGATATAAGTTGG + Intergenic
952344163 3:32468541-32468563 AAATAGGGAAGGAGGGAGGAAGG - Intronic
952382437 3:32816096-32816118 TAATGGGGCTGGGGGGAAGCAGG - Intergenic
953038935 3:39237796-39237818 CCGGAGGGAGGGAGGGAAGCAGG - Intergenic
953059277 3:39413881-39413903 GAATCAGGATGGTGGGAAGCAGG + Intergenic
953349423 3:42203460-42203482 CAAGAGGGAGAGAGGGAAGGAGG - Intronic
953775506 3:45813189-45813211 CAAGAGTGCTGGAGGGATGCTGG - Intergenic
954361825 3:50126237-50126259 CAGAAGGGATGGTGGGAAGAGGG + Intergenic
954413298 3:50380668-50380690 AAATGGGGAGGGAGGGGAGCAGG + Intronic
955278024 3:57566597-57566619 TAATGAGGATGGAGGGAAACTGG - Exonic
956520057 3:70094196-70094218 CGATAGGGATGGAGAGCAGCAGG - Intergenic
956790573 3:72677022-72677044 CAATAGGGATTGGGGGAACAGGG + Intergenic
957192797 3:77031312-77031334 CAATGGGGATGATGGGAAGATGG + Intronic
959893887 3:111585500-111585522 TAATAGGGATGAAGGGAAGCTGG + Intronic
960004449 3:112767620-112767642 CAGGAGGGAGGGAGGGAAGTTGG - Intronic
960504813 3:118479673-118479695 GAAGAGGGAGGGAGGGAAGGGGG - Intergenic
961099964 3:124190361-124190383 AAATAGTGATGGTGGGAAGGGGG - Intronic
961185601 3:124912438-124912460 CAAGAGGCATGGAGGGTAGTGGG + Intronic
962053699 3:131846490-131846512 GAATGGGGATAAAGGGAAGCTGG - Intronic
963121164 3:141778229-141778251 CAAGAGGGCTGGAGGGCTGCTGG - Exonic
963173571 3:142275877-142275899 CCATACGGATGGAGAGAAGAGGG + Intergenic
963321628 3:143815044-143815066 CAAAAGGGAAGGAAGGAGGCAGG + Intronic
963667237 3:148203631-148203653 CAATAGGGCTAGAGAGGAGCTGG + Intergenic
963919517 3:150892326-150892348 CATAAGGGAGTGAGGGAAGCAGG - Intronic
964421736 3:156510846-156510868 CAAAGGGGCAGGAGGGAAGCCGG - Intronic
964671999 3:159236851-159236873 AAAAACGGATGGAGGGGAGCAGG + Intronic
965083887 3:164069463-164069485 CAGGAGGGAAGGAGGGAAGGTGG + Intergenic
965382272 3:168004708-168004730 GAGTAGGAATGGAGGGAAGGAGG - Intergenic
967130889 3:186469738-186469760 ATTTAGCGATGGAGGGAAGCTGG - Intergenic
967365559 3:188682564-188682586 GAATGGGGTTTGAGGGAAGCTGG + Intronic
968817178 4:2828199-2828221 CAATAGGGAGGGAGGAAGGGAGG - Intronic
972579682 4:40384240-40384262 TAATGGGGATAGAGGGAAGAGGG + Intergenic
974095496 4:57359467-57359489 AGAGAGGGATGGAGGGAAGTTGG + Intergenic
974142762 4:57908701-57908723 AAGTGGGGATGGAGAGAAGCAGG + Intergenic
974198674 4:58610975-58610997 TAATATGGATAGAAGGAAGCTGG + Intergenic
974694024 4:65341045-65341067 GAGGAGGGATGAAGGGAAGCCGG - Intronic
976575437 4:86664878-86664900 CAACGTGGATAGAGGGAAGCAGG - Intronic
976575448 4:86664978-86665000 CAACGTGGATAGAGGGAAGCAGG - Intronic
979652733 4:123154960-123154982 AAAGAGGGAAAGAGGGAAGCAGG - Intronic
979740794 4:124148248-124148270 GAAGAGGGAGGGAGGGAAGGTGG - Intergenic
980078618 4:128320513-128320535 AAGGAGGGAGGGAGGGAAGCAGG - Intergenic
980279843 4:130705597-130705619 CATTAGGGATAGAGGTAATCTGG + Intergenic
980962758 4:139492720-139492742 AAAGAGGGAGGGAGGGAAGGGGG - Intergenic
981585362 4:146295641-146295663 CACTAGGGTTGGTGGGTAGCTGG + Intronic
981802135 4:148670216-148670238 GAACAGGGATGCAGGGAAGCAGG + Intergenic
981836348 4:149058854-149058876 CAATAAGGATGGAGGAAAGAGGG - Intergenic
982038778 4:151373930-151373952 CTATAGGAATGTAGAGAAGCAGG - Intergenic
982139633 4:152305316-152305338 AAATAGGGATTCAGGAAAGCAGG - Intergenic
982201271 4:152963308-152963330 CTATAGGGCTGAAGGGAAGTGGG + Intronic
982288209 4:153756566-153756588 CCATAGGGGTGGAGAGAAGGGGG - Intronic
982529262 4:156517989-156518011 AAGGAGGGAGGGAGGGAAGCAGG + Intergenic
982972050 4:162000879-162000901 AAGAAGGGATGGAGGGAAGAGGG + Intronic
983257014 4:165411322-165411344 GAAGAGGGATGGAGGGAAGAAGG - Intronic
984175575 4:176412732-176412754 CAATAAGGATGGAGTGACACAGG - Intergenic
984580269 4:181502705-181502727 CCATAGGGAAAGAGGGAAGAAGG + Intergenic
985004858 4:185524090-185524112 CAGTAGGACTGGAGGGAAGTAGG - Intronic
985135935 4:186786218-186786240 CAAAAGAGCTGGAGGGAAACAGG - Intergenic
985590735 5:763599-763621 CAAAACGGATGGAGGAAAGGGGG + Intronic
986074936 5:4326816-4326838 CAGTAGAGGTGGAGGGCAGCAGG - Intergenic
986178691 5:5373668-5373690 TAATAGGGAGGGAAGGAGGCTGG - Intergenic
988699249 5:33656865-33656887 AATTAGGGATGCAGGGGAGCTGG - Intronic
988993770 5:36695051-36695073 AAAAAGGGAGGGAGGGAAGGAGG + Intergenic
989448280 5:41556458-41556480 CAATAGGGAGGGAGGGGATAGGG - Intergenic
990765546 5:59178200-59178222 GCATAGGGATGGAGGGATGAGGG - Intronic
990768564 5:59216426-59216448 TAGTAGGGATGGAAGGAAGTGGG - Intronic
990816752 5:59794477-59794499 CAGGAGGGAGGGAGGGAAGGAGG - Intronic
993724975 5:91356450-91356472 CAATGGTAATGGAGGGAAACGGG + Intergenic
994918989 5:106017709-106017731 GAAGAGGGAAGGAGGGAAGGAGG - Intergenic
995207446 5:109497433-109497455 CAAGAGGGATGGAGGGAAGAAGG + Intergenic
995324496 5:110875202-110875224 AAAGAGGGAGGGAGGGAAGGAGG - Intergenic
995860838 5:116638923-116638945 GAAAAGGAAAGGAGGGAAGCAGG + Intergenic
996418300 5:123233900-123233922 AAAGAGGGAGGGAGGGAAGAAGG - Intergenic
998471328 5:142386228-142386250 CCATGGGGATGAAGGGAAGGAGG + Intergenic
999392569 5:151205014-151205036 CCATAGGGAGGGAGGGAGGGAGG - Intronic
1001505415 5:172275483-172275505 GAATTGGGAAAGAGGGAAGCAGG - Intronic
1002454574 5:179338847-179338869 CACCAGGCGTGGAGGGAAGCCGG + Intronic
1002587618 5:180261167-180261189 CACCAGTGATGCAGGGAAGCTGG + Intronic
1003286051 6:4734681-4734703 GGATGGGGATGGAGGGAAGATGG + Intronic
1003583760 6:7367152-7367174 GAAGGGGGATGGAGGGAAGAGGG - Intronic
1004126818 6:12882121-12882143 ACAGGGGGATGGAGGGAAGCAGG + Intronic
1004131242 6:12921777-12921799 AAACAGGGAGGGAGGGAAGAAGG + Intronic
1004510050 6:16277884-16277906 CAGTGGGGAGGGAGGGGAGCAGG + Intronic
1005555633 6:26979394-26979416 AAAAAGGGAGGGAGGGAAGGAGG + Intergenic
1006257554 6:32843808-32843830 CCCTAGGGATGCAGGGAGGCGGG - Intronic
1007264021 6:40584002-40584024 CAAGAGAAAGGGAGGGAAGCAGG + Intronic
1007337976 6:41168469-41168491 CATCCGGGATGGAGGGAGGCAGG - Intergenic
1007998522 6:46334549-46334571 CAATAGGGATGGTGGGGTGGGGG + Intronic
1009369903 6:62886135-62886157 GAAAAGGGAGGGAGGGAAGAAGG + Intergenic
1009518056 6:64644380-64644402 GAATTGGGATGGAGTGAAGAGGG + Intronic
1009659130 6:66587058-66587080 AAAGAGGGAGGGAGGGAAGAAGG - Intergenic
1011262303 6:85482394-85482416 AAAAAGGGAGGGAGGGAAGGTGG + Intronic
1014534702 6:122600787-122600809 GAGTAGGCATGCAGGGAAGCAGG + Intronic
1014985149 6:127997395-127997417 GAATAATTATGGAGGGAAGCAGG - Intronic
1015085568 6:129287072-129287094 AAAGAGGGAGGGAGGGAAGGAGG + Intronic
1015194126 6:130506656-130506678 AGACAGAGATGGAGGGAAGCAGG + Intergenic
1015823190 6:137284358-137284380 AAATAGGGAGGCAGGGAGGCAGG + Intergenic
1015856580 6:137631454-137631476 CCTTAGGGCTGGAAGGAAGCTGG + Intergenic
1016802649 6:148182365-148182387 AAAGAGGGAGGGAGGGAAGGAGG + Intergenic
1018800334 6:167217223-167217245 CATTAGGGAGAGAAGGAAGCTGG - Intergenic
1018844957 6:167549119-167549141 CAATATGGATGGATGAAACCAGG - Intergenic
1019334856 7:478306-478328 CAAGAGGGAGGGAGGGAGGGAGG + Intergenic
1019357138 7:586495-586517 CAACAGGGCTGGAGGGTGGCAGG - Intronic
1019560728 7:1655542-1655564 AAAGAGGGAGGGAGGGAAGGAGG - Intergenic
1020095977 7:5369566-5369588 CAAGAGGGAAGGAGGGAAGGAGG + Intronic
1020227050 7:6288597-6288619 CAAAAGGGAGGGAGGGAGGAAGG - Intergenic
1020770989 7:12394376-12394398 CGAATGGGATGGAGGGGAGCAGG + Intronic
1022139081 7:27476501-27476523 CAAAAGGGAGGGAGGGAGGAAGG + Intergenic
1022384549 7:29889097-29889119 TGGTTGGGATGGAGGGAAGCAGG - Intronic
1022493724 7:30840024-30840046 CAAGAGGGAGGGACAGAAGCTGG - Intronic
1023056926 7:36298268-36298290 CAACAGGGCTGGAAGGAAGTTGG + Intronic
1023428974 7:40069783-40069805 AAAAAGTGATGGAGGGAGGCCGG + Intronic
1023590865 7:41779215-41779237 CAGTAGGGATTGCGGGAAGAAGG + Intergenic
1024043591 7:45573540-45573562 CAATTGGGAGGGAAGGACGCTGG - Intergenic
1025606667 7:63044517-63044539 TAGTAGGGATGCAGGGAAGGGGG - Intergenic
1026650090 7:72209309-72209331 AAAGAGGGAAGGAGGGAAGGAGG - Intronic
1026650108 7:72209369-72209391 AAAGAGGGAAGGAGGGAAGGAGG - Intronic
1027556775 7:79673844-79673866 GAATAGCTATAGAGGGAAGCAGG + Intergenic
1029926946 7:104328545-104328567 CAGGAGGGAGGGAGGGGAGCCGG + Intergenic
1030273459 7:107694488-107694510 CAATCGGTATGCAGAGAAGCAGG - Intronic
1030741108 7:113110813-113110835 CCACAGGGATGGAGAGAAGTGGG + Intergenic
1030990927 7:116298978-116299000 TGATAGGGCTGGAGGGAAGTGGG + Intronic
1031438944 7:121769059-121769081 CAAAAGGGTTGGAGGGTAGAAGG + Intergenic
1031982844 7:128139942-128139964 AAAGAGGGAGGGAGGGAGGCAGG - Intergenic
1032630160 7:133642423-133642445 CAAAGGGGATGGAGGGAAATAGG - Intronic
1034738278 7:153449272-153449294 GACAAGGGCTGGAGGGAAGCAGG + Intergenic
1035392315 7:158513074-158513096 CAGCAGGGAAAGAGGGAAGCGGG + Intronic
1035437739 7:158871657-158871679 GAAAGGGGAAGGAGGGAAGCGGG - Intronic
1036633043 8:10528957-10528979 TGAGAGGGGTGGAGGGAAGCAGG - Intronic
1036778269 8:11628456-11628478 CAGTAGGGATGCAGGGAAGGGGG + Intergenic
1037337809 8:17808623-17808645 CAAAAGGGATGCAGTCAAGCAGG + Intergenic
1037632178 8:20668102-20668124 CGATAGGGTGGGAGGAAAGCAGG - Intergenic
1037775788 8:21834803-21834825 CAGGAGGGAGGGAGGGAGGCAGG + Intergenic
1038577758 8:28719819-28719841 TGATAGGGATGTAGAGAAGCTGG + Intronic
1038591899 8:28846913-28846935 TACTAGAGCTGGAGGGAAGCTGG + Intronic
1038725659 8:30080279-30080301 GAAGAGGGTAGGAGGGAAGCAGG - Intronic
1038732058 8:30136616-30136638 CAAATGGGATGGAGTGAATCAGG - Intronic
1038891910 8:31734891-31734913 TAATAGGGATGGCTGGAAGCAGG - Intronic
1039096005 8:33886136-33886158 CTACAGGGAGGGAGGGAAGAGGG + Intergenic
1040417234 8:47206194-47206216 CAACAGTGATGGAGAGAAGCAGG + Intergenic
1041444174 8:57931875-57931897 GAAGAGGGAGGGAGGGAAGGAGG + Intergenic
1041740694 8:61153569-61153591 CAATAAGAATAAAGGGAAGCGGG + Intronic
1042230024 8:66545711-66545733 GAGGAGGGATGGAGGGAAGGAGG + Intergenic
1042329271 8:67560835-67560857 AAATAGGGATGGGGCTAAGCAGG - Intronic
1044210421 8:89543766-89543788 CAATAGGGAAGAAAGGATGCTGG - Intergenic
1045088143 8:98710152-98710174 AAATAGGGATGGAGACAAGACGG + Intronic
1045863622 8:106840256-106840278 CAATGAGGATGGAGAGAAGATGG - Intergenic
1046106274 8:109670856-109670878 CAAGAGGGAAGGAGGGAGGGAGG + Intronic
1047868657 8:129057845-129057867 GAATAGGGATGGCAGGAAGAAGG + Intergenic
1048100547 8:131346390-131346412 AAATAGGGATGAATGGACGCAGG - Intergenic
1048332483 8:133480104-133480126 GGATGGGGAAGGAGGGAAGCTGG + Intronic
1048541799 8:135348836-135348858 CGGTAGGGAGGGATGGAAGCAGG - Intergenic
1048955859 8:139535323-139535345 CAATAGGGAAGGAGGAAGACAGG + Intergenic
1049325203 8:142017993-142018015 CAGTAGCCATGGAGGGCAGCTGG - Intergenic
1050053483 9:1627345-1627367 GAAGAGGGAGGGAGGGAAGTAGG + Intergenic
1050407155 9:5321668-5321690 GAAGAGGGAGGGAGGGAAGAAGG + Intergenic
1051434547 9:17016953-17016975 AAAGAGGGAGGGAGGGAGGCAGG - Intergenic
1051853509 9:21536289-21536311 GGATAGGAAAGGAGGGAAGCTGG + Intergenic
1052835729 9:33248656-33248678 CCAGAGGGACGGAGAGAAGCTGG - Intronic
1053728304 9:41026471-41026493 GAATAGAGATGGAGGGAAAGGGG + Intergenic
1055313978 9:75014536-75014558 AAAGAGGGAGGGAGGGAAGACGG + Intronic
1056322024 9:85444276-85444298 AAAGAGGTATGGAGGGAAGAAGG - Intergenic
1056540232 9:87564621-87564643 CAAGAGGGAGGGAGGGAGGAAGG + Intronic
1056599216 9:88033017-88033039 CAAGAAGGATGGAGGTAAGAGGG - Intergenic
1056942942 9:90970866-90970888 CAATGGGGCTGGAAGGAGGCTGG - Intergenic
1057211903 9:93205099-93205121 CAGAATGGATGGAGGAAAGCAGG - Intronic
1057861032 9:98641047-98641069 CAATAGGGGTGGAGGGGAGAAGG - Intronic
1058007882 9:99938827-99938849 TAAGAGGGAGGGAGGGAAGAAGG + Intronic
1058843747 9:108934964-108934986 CAGTAGGGATGGCGAGAAGAGGG + Intronic
1059008939 9:110435467-110435489 AGATGGGGGTGGAGGGAAGCAGG + Intronic
1059035328 9:110748181-110748203 GAAGAGGGAGGGAGGGAAGGAGG - Intronic
1059139959 9:111843730-111843752 CAAGAGGGAGGGAGGGAGGGAGG + Intergenic
1060833964 9:126740918-126740940 CAATAGGGATGATGGGATCCTGG - Intergenic
1061036756 9:128118551-128118573 GAGCAGGGATGGAGGGATGCTGG + Intergenic
1061496513 9:130977903-130977925 CCCCAGGGATGGAAGGAAGCTGG + Intergenic
1062709952 9:137969863-137969885 CAGTAGGGCAGGAGGGAGGCAGG - Intronic
1185431182 X:12998-13020 AAAAAGGGAGGGAGGGAAGGAGG - Intergenic
1185431984 X:16678-16700 AAAAAGGGAGGGAGGGAAGGAGG - Intergenic
1185440449 X:225395-225417 AAAAAGGGAGGGAGGGAAGGAGG - Intergenic
1185441300 X:229391-229413 AAAAAGGGAGGGAGGGAAGGAGG - Intergenic
1186079293 X:5912897-5912919 CAGGAGGGAGGGAGGGAAGGAGG + Intronic
1187359886 X:18616149-18616171 CAATAGCTATGGAGAGAAGCAGG + Intronic
1189172885 X:38926343-38926365 CAATAGGGGAGTAGGGAAGCAGG + Intergenic
1189374990 X:40459708-40459730 GAAAAGGGAGGGAGGGAAGGAGG + Intergenic
1190053448 X:47168951-47168973 ACATAGGGATGGAGAGAGGCAGG + Intronic
1195000592 X:100639614-100639636 TGGTAGGGATGGAGGGAGGCTGG - Intronic
1195653318 X:107310066-107310088 CAAATGGGAGGGAGGGAAGAAGG - Intergenic
1196149348 X:112355336-112355358 CAAAAGGAAAGGAGGGAAGAAGG + Intergenic
1196873008 X:120130365-120130387 CGATGGGAATGGAGGTAAGCAGG + Intergenic
1197383125 X:125769886-125769908 TCATGGGGAGGGAGGGAAGCAGG - Intergenic
1197714384 X:129695901-129695923 GAAACGGGATGGCGGGAAGCTGG - Intergenic
1198131440 X:133699342-133699364 GAATGGGGATAGAGGGAACCTGG + Intronic
1198773927 X:140159579-140159601 CTGTAATGATGGAGGGAAGCTGG + Intergenic
1198862479 X:141085656-141085678 GAAAAGGTATGGAGGGAACCAGG + Intergenic
1198900215 X:141501730-141501752 GAAAAGGTATGGAGGGAACCAGG - Intergenic
1199607301 X:149586826-149586848 CGATATCGGTGGAGGGAAGCGGG - Intronic
1199631822 X:149782541-149782563 CGATATCGGTGGAGGGAAGCGGG + Intronic
1199709002 X:150454831-150454853 CAATTGGGATGGTGGGATGGTGG - Intronic
1199712997 X:150485120-150485142 CAAGTGGGATGTAGGGGAGCAGG - Intronic
1199942654 X:152640224-152640246 CCATGGGGAGGGAGGGGAGCAGG + Intronic
1201451112 Y:14116097-14116119 CAATATGGAGGGAGGGAGGGAGG + Intergenic
1201538901 Y:15084735-15084757 AAAGAGGGAGGGAGGGAAGGAGG + Intergenic
1201575931 Y:15461245-15461267 CAATAGGGAAAGAGAGAAGGAGG - Intergenic
1201650538 Y:16280004-16280026 AAATGGGAATGGAGGGAAGGAGG - Intergenic
1201888952 Y:18920441-18920463 AAAGAGGGAGGGAGGGAAGAAGG + Intergenic