ID: 1077458523

View in Genome Browser
Species Human (GRCh38)
Location 11:2695771-2695793
Sequence TAGGAGAAGCATTAGAAAGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 377
Summary {0: 1, 1: 0, 2: 2, 3: 18, 4: 356}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077458523_1077458525 30 Left 1077458523 11:2695771-2695793 CCTACTTTCTAATGCTTCTCCTA 0: 1
1: 0
2: 2
3: 18
4: 356
Right 1077458525 11:2695824-2695846 TCTCTGATAACTGATTAGCTTGG 0: 1
1: 0
2: 1
3: 16
4: 195

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077458523 Original CRISPR TAGGAGAAGCATTAGAAAGT AGG (reversed) Intronic
902848482 1:19132272-19132294 TAGGAGAATCACTTGAATGTGGG - Intronic
904021354 1:27468546-27468568 TAGGAGAATCATTTGAACCTGGG + Intronic
904152999 1:28458534-28458556 GGGCAGAAGCATTAGAAAGCGGG - Intronic
905711712 1:40110148-40110170 TAGGAGAATCATTTGAACCTAGG + Intergenic
906089223 1:43163945-43163967 TAGGAGAAAAATTATAAAGTGGG + Intergenic
907567638 1:55451186-55451208 TAGTAGATACATTAGAAAGGAGG + Intergenic
907650253 1:56287988-56288010 TAGCAGGCCCATTAGAAAGTGGG - Intergenic
907665901 1:56433624-56433646 TGGGTGAAGCAGTAGAGAGTAGG - Intergenic
908219940 1:61995159-61995181 TATGGGAAGCATTTGCAAGTGGG + Intronic
909272306 1:73639021-73639043 TAAAAGAAGAATGAGAAAGTCGG + Intergenic
910359871 1:86404907-86404929 TAGCTGCAGCACTAGAAAGTTGG - Intergenic
911117960 1:94265697-94265719 GAGCAGAAGCAGTAGAAAGGTGG - Intronic
912046434 1:105464841-105464863 AAGGAGGATCATTAGACAGTTGG + Intergenic
912351182 1:109015414-109015436 TAGGAGAATCACTTGAAACTGGG - Intronic
913675257 1:121134334-121134356 TAGCAAAAGCAATTGAAAGTAGG + Intergenic
914027093 1:143921953-143921975 TAGCAAAAGCAATTGAAAGTAGG + Intergenic
914811598 1:151032864-151032886 TAGGAGAATCATTTGAACCTGGG - Intronic
915170313 1:153972905-153972927 CAGGAGAAGCATTGGGGAGTTGG + Intronic
915361149 1:155287073-155287095 AGGGAGGAGCCTTAGAAAGTTGG + Intronic
915680298 1:157575398-157575420 CATGAGAAGAATTAGAAAGCTGG + Exonic
915709562 1:157882603-157882625 TAGGAGAGGCATTAGTAATCAGG - Intronic
915790669 1:158666852-158666874 TAGGAGAAGCATAATGAGGTTGG + Intronic
915920354 1:159971721-159971743 TAGGACGTGCAGTAGAAAGTGGG + Intergenic
915923475 1:159996744-159996766 TAGAAGAAGAACTAGAAAGAAGG - Intergenic
916192734 1:162194826-162194848 TAGGAGAGCCATTTGAAATTGGG + Intronic
916912101 1:169361827-169361849 TAGGAGAAACGTCATAAAGTTGG + Intronic
917450699 1:175145225-175145247 TAGGAGAACAACTAGAAAGTAGG - Intronic
920004067 1:202819972-202819994 TAGGAGATACATAAGGAAGTAGG + Intergenic
920462618 1:206153171-206153193 TAGCAAAAGCAATTGAAAGTAGG + Intergenic
921386863 1:214578292-214578314 AATGAGAAGCAATAAAAAGTTGG - Intergenic
922981053 1:229827249-229827271 CAGGGGAAGCATTAGAAAATAGG - Intergenic
923975721 1:239260124-239260146 TATGAGTTGCATTAGCAAGTTGG + Intergenic
924419494 1:243894859-243894881 TACGAAAACTATTAGAAAGTTGG + Intergenic
1063307941 10:4923057-4923079 CAGGAGAAGCATTTGAACGCAGG + Intronic
1064636594 10:17374619-17374641 TAGGAGAATCACTTGAAACTAGG + Intronic
1065560956 10:26963253-26963275 TTGGAGAAGCAATAGATTGTGGG - Intergenic
1065812697 10:29456841-29456863 AAGGAGAATCATTTGAAACTGGG - Intergenic
1066631247 10:37461103-37461125 CAGGAGAATCATTTGAAACTGGG + Intergenic
1068027339 10:51662912-51662934 TAGGAGTAGCACTAGAATGTTGG + Intronic
1068173915 10:53431675-53431697 CCGAAGAAGCATTAGAAAGCTGG + Intergenic
1069094725 10:64244737-64244759 TAGGACAATTTTTAGAAAGTTGG + Intergenic
1069225753 10:65942209-65942231 TTGGAGATGCATTAGAACTTGGG + Intronic
1069342348 10:67426457-67426479 TAGAAGAAAGAGTAGAAAGTTGG + Intronic
1069804422 10:71109708-71109730 TAGCAAAAGCATTAGTAAGAGGG - Intergenic
1071216698 10:83412289-83412311 TAGTAAAAGTATTAAAAAGTAGG - Intergenic
1072109387 10:92303986-92304008 TAGGAGTAACATCAGCAAGTAGG + Intronic
1073081264 10:100862504-100862526 GAGGAGAAGCTTTAGAGAGAAGG - Intergenic
1074938534 10:118211656-118211678 CAGGAGAATCATTTGAAACTGGG + Intergenic
1075814588 10:125255090-125255112 TAAGAGAAGCATCAGAAATGAGG - Intergenic
1076005177 10:126943158-126943180 CAGGAGAATCATTTGAACGTGGG + Intronic
1077458523 11:2695771-2695793 TAGGAGAAGCATTAGAAAGTAGG - Intronic
1077621150 11:3725200-3725222 TAGGAAGAGCATTAAGAAGTTGG - Exonic
1078198262 11:9155259-9155281 TACCACAACCATTAGAAAGTAGG + Intronic
1078366742 11:10712811-10712833 TAGAAGTAGCATTTGAATGTTGG - Intergenic
1079234092 11:18675259-18675281 TAGGAGAAGCACTTGAACCTGGG - Intergenic
1080349924 11:31371914-31371936 CAGGAGAATCCTTTGAAAGTGGG - Intronic
1081608536 11:44543808-44543830 TAGGAGTAGCATTTGAACTTGGG - Intergenic
1083367158 11:62148361-62148383 TAGGACACACCTTAGAAAGTGGG - Intronic
1083597714 11:63926912-63926934 TAGGAGAACCATTTGAACCTTGG - Intergenic
1083769652 11:64859425-64859447 TAGGAGAATCATTTGAACCTGGG + Intronic
1083819500 11:65159980-65160002 CAGGAGAATCATTTGAAACTGGG - Intergenic
1085201418 11:74704482-74704504 AAGGAGAAACATAAGAAAGGTGG - Exonic
1085490038 11:76907135-76907157 TAGGAGAAGCTTTAAATAATTGG - Intronic
1086613954 11:88792148-88792170 TTGTAGTGGCATTAGAAAGTTGG + Intronic
1086828066 11:91524658-91524680 TAGGAGAAGCTATTGAAAATTGG + Intergenic
1088371525 11:109093675-109093697 TTGGATACGCATCAGAAAGTGGG + Intergenic
1088607460 11:111545204-111545226 TGGGAGAAACTTTAGAAAGGAGG + Intronic
1092352117 12:7764047-7764069 TAGGAGAATCACTTGAAACTGGG + Intergenic
1092470962 12:8780455-8780477 TTGGAGAAACATTAAAAAGTTGG + Intronic
1093574170 12:20707284-20707306 AAGGAGAAGAATGAGAAAATGGG + Intronic
1094076987 12:26488068-26488090 CAGGAGAAGCAGTAGGAGGTAGG + Intronic
1095357644 12:41294868-41294890 AAGGAGAAAAATTAGAAAATGGG + Intronic
1098443121 12:70538535-70538557 TAGGTAAAGCAATAGAAGGTAGG - Intronic
1098799532 12:74936447-74936469 TAGAAGAAGCAAGAGCAAGTTGG + Intergenic
1099957705 12:89367453-89367475 TAGGAGAATCACTTGAAACTAGG - Intergenic
1100306315 12:93352990-93353012 CAGGAGAATCATTTGAACGTGGG + Intergenic
1102308766 12:111827468-111827490 CAGGAGAATCATTTGAAACTGGG - Intergenic
1103945831 12:124525896-124525918 TTGCAGCAGCCTTAGAAAGTAGG - Intronic
1105687618 13:22801136-22801158 TAGGAAAAGCATGAGAACATTGG - Intergenic
1106299338 13:28449881-28449903 AAGGAGAAGAATTAGAAAGGAGG + Intronic
1107310117 13:39067829-39067851 TAGGAGAATCATTTGAACCTGGG + Intergenic
1107852931 13:44589197-44589219 AAAGAGAAGGACTAGAAAGTGGG + Intergenic
1109805908 13:67442529-67442551 TAGGCTAAGCATTCGAAATTAGG - Intergenic
1110849195 13:80224638-80224660 TAGGAGGAGGATGAGGAAGTTGG + Intergenic
1110987732 13:81993101-81993123 TAGGAGAAGTATTAGAAGCTGGG + Intergenic
1114010146 14:18357875-18357897 TAGGGGAAGCTGTAGACAGTAGG - Intergenic
1114042384 14:18691141-18691163 TAGGAGAAGCTGTAGGAAGACGG - Intergenic
1114164086 14:20201293-20201315 CAGGAGAATCATTTGAACGTGGG - Intergenic
1114449634 14:22816703-22816725 TAGGAGAAGAAACAGACAGTTGG - Intronic
1115208041 14:30934229-30934251 TAGGAGAATCACTTGAACGTGGG + Intronic
1115374422 14:32657858-32657880 TATGAGCAGGATTTGAAAGTTGG + Intronic
1115763722 14:36601315-36601337 TAGGAGAAACATTGGATACTTGG + Intergenic
1116169573 14:41382661-41382683 CAGGAGAAGCATTTGAACCTGGG + Intergenic
1117056083 14:51913206-51913228 TGATAGAAGCATTAAAAAGTAGG + Intronic
1117220163 14:53596315-53596337 TAGGAGTAACATTAAAAAGGAGG - Intergenic
1117245685 14:53883892-53883914 TAGGAGGATCATTTGAAACTAGG + Intergenic
1118037891 14:61888208-61888230 CAGGAGAATCGTTAGAACGTGGG - Intergenic
1118268921 14:64323298-64323320 TGGGAGAATCATTTGAAACTGGG - Intronic
1119322014 14:73737872-73737894 TGGGAGAATCATTAGAACCTGGG - Intronic
1119331148 14:73794887-73794909 CAGGAGAAGCATTTGAACGCAGG - Intergenic
1119518014 14:75263566-75263588 CAGGAGAATCACTTGAAAGTGGG + Intronic
1120347923 14:83313961-83313983 CAGGAGAATCACTAGAAACTGGG - Intergenic
1120634371 14:86932919-86932941 TAGTAGAATCATTAGAAGGAAGG + Intergenic
1121913539 14:97815106-97815128 TAGGAGAATCATTTGAAACCAGG - Intergenic
1122109572 14:99488063-99488085 TAGCTGAACCATTTGAAAGTAGG + Intronic
1122449374 14:101792968-101792990 CAGGAGAATCATTTGAATGTGGG - Intronic
1122482221 14:102054659-102054681 TAGGAGAATCATTTGAACTTGGG - Intergenic
1123792890 15:23740280-23740302 CAGGAGAATCATTTGAAACTGGG + Intergenic
1125035948 15:35123248-35123270 TAGGAGAATCATTTGAACCTGGG + Intergenic
1126344121 15:47675184-47675206 AAGGAAAAGAATCAGAAAGTTGG - Intronic
1126851180 15:52798195-52798217 TCGCAGAAGCTTTGGAAAGTTGG + Intergenic
1127651066 15:61008270-61008292 CATGAGATGCATTAGACAGTGGG - Intronic
1128211365 15:65905322-65905344 TAGGACAGGCATTAGACAATAGG + Intronic
1129553505 15:76479560-76479582 TAGGAAAAGCATCATAAAATTGG + Intronic
1129620417 15:77138767-77138789 TAGGAGAATCATTTGAACCTGGG + Intronic
1129637281 15:77333841-77333863 AAGGAGTAGCATTATGAAGTTGG - Intronic
1130343018 15:83015027-83015049 TTGAAGAAGCACTAAAAAGTGGG + Intergenic
1131533947 15:93218221-93218243 AAGGAGAAGCATTTGAACCTGGG - Intergenic
1131604960 15:93893739-93893761 TAACATAAGCATTAGGAAGTTGG - Intergenic
1131643088 15:94313388-94313410 TACGAGAAGCATTTTAAAATTGG + Intronic
1132166108 15:99592677-99592699 GAGGAGAAGCAGGAGAGAGTGGG + Intronic
1133594413 16:7277135-7277157 CAGAAGAAACATTAAAAAGTTGG + Intronic
1136294240 16:29292540-29292562 TTGGAGAAGCAGTAGAAGGTTGG + Intergenic
1140152110 16:72378073-72378095 TAGGAGAAGCATTCAAATCTGGG + Intergenic
1140722057 16:77780884-77780906 TAGGAGAATCATTTGAACCTGGG + Intergenic
1140898037 16:79342419-79342441 TTGGAGAAGTGTTAAAAAGTGGG - Intergenic
1142100144 16:88266586-88266608 TTGGAGAAGCAGTAGAAGGTTGG + Intergenic
1143701982 17:8667307-8667329 CAGGAGAATCATTAGAACCTGGG - Intergenic
1143843955 17:9757938-9757960 CAGGAGAATCACTAGAAAGCAGG - Intergenic
1144035587 17:11362473-11362495 TGGTAGAAGCATCAGAAAGCAGG - Intronic
1144041202 17:11412864-11412886 TCTGGGAAGCACTAGAAAGTAGG + Intronic
1145965806 17:28916285-28916307 CAGGAGAATCATTAGAACCTGGG - Intronic
1148119840 17:45201987-45202009 TAGGAGAATCATTTGAACCTGGG + Intergenic
1148163181 17:45463483-45463505 TAGGAGAATCACTTGAAACTGGG - Intronic
1149024045 17:52003647-52003669 TAGGAGAAGCTTCAGACAGAGGG + Intronic
1149302181 17:55315659-55315681 AAGGAGAAGCAGTAAAATGTTGG + Intronic
1149435333 17:56629203-56629225 TAGGGGAAGGTTTAGAAACTGGG - Intergenic
1149468396 17:56897408-56897430 TAGGAGAAGCGGTAGCAAGGGGG - Intronic
1152615398 17:81335654-81335676 GAGGAGAAGGAAGAGAAAGTTGG - Intergenic
1153153853 18:2127112-2127134 GAGGAGAAGCTAAAGAAAGTAGG - Intergenic
1155822733 18:30398407-30398429 AAGGAGATTCATTAGAATGTGGG + Intergenic
1156290391 18:35744438-35744460 TAGGAGAATCACTTGAACGTGGG - Intergenic
1158444329 18:57506034-57506056 TAGTCAAAGCTTTAGAAAGTGGG - Intergenic
1161701280 19:5797133-5797155 TAGGAGAATCACTAGAACCTGGG + Intergenic
1162825723 19:13250487-13250509 CAGGAGAATCATTTGAACGTGGG - Intronic
1164058370 19:21642760-21642782 TAGGAGAATCATTTGAACCTGGG - Intergenic
1164699881 19:30277780-30277802 GAGGACAAGCACTAGAAACTTGG - Intronic
1166402000 19:42488817-42488839 TAGGAGAATCACTTGAACGTGGG + Intergenic
1167057596 19:47121988-47122010 TAGGAGAATCACTTGGAAGTGGG - Intronic
1167175693 19:47862650-47862672 TAGGAGAATCACTTGAACGTGGG - Intergenic
1167919526 19:52771564-52771586 TAGGAGAATCATTTGAACCTGGG - Intronic
925466659 2:4112104-4112126 CAGGAGAATCATTTGAAACTGGG - Intergenic
926959330 2:18337057-18337079 ATGGGGAAGCATTAGTAAGTCGG - Intronic
928301544 2:30129754-30129776 TAGGAGAAGCTTCAGACAATGGG - Intergenic
928813359 2:35256590-35256612 TTTTTGAAGCATTAGAAAGTAGG - Intergenic
929343383 2:40850388-40850410 TAGGGGAACCATTAGAATATGGG + Intergenic
929850097 2:45579430-45579452 TAGGAGAATCTTTATAAACTTGG + Intronic
930147631 2:48023546-48023568 AGGGAGAAGCCTTAGGAAGTGGG + Intergenic
930269570 2:49240481-49240503 TAGGAGAGACATTAGAAAAGGGG + Intergenic
930291023 2:49492399-49492421 CAGGAGAAGCACTTGAAAATGGG + Intergenic
931149928 2:59561511-59561533 GAGGAGAAGCTTTAGAATGTGGG - Intergenic
931399991 2:61922799-61922821 TAGGAGAAAGATAAGAAAGGGGG + Intronic
932225750 2:70038984-70039006 TAGGAGAATCACTTGAACGTGGG + Intergenic
933145379 2:78845813-78845835 TAGGGGAAGTATTAGAAAGTGGG + Intergenic
933203373 2:79477261-79477283 TAGGAGAATCATGAGAACCTTGG - Intronic
934056465 2:88255251-88255273 TGGGAGAGGAAATAGAAAGTGGG - Intergenic
934499271 2:94841800-94841822 CAGGAGAATCATTTGAAACTGGG + Intergenic
935711857 2:105906088-105906110 AAGGAGCAGCATGAGAAAGGAGG - Intergenic
935917784 2:107975294-107975316 TTGGAAAAGCCTTAGAAATTTGG + Intergenic
936135151 2:109885945-109885967 TAGCAGAAACATTAAAAAATGGG - Intergenic
936209546 2:110485540-110485562 TAGCAGAAACATTAAAAAATGGG + Intergenic
936428734 2:112440792-112440814 TAGCAGAAACATTAAAAAATGGG + Intergenic
936722325 2:115267694-115267716 TAGGAGAAGAATAAGCATGTGGG - Intronic
936840679 2:116764605-116764627 CAGGAGAATCATTTGAACGTGGG - Intergenic
938590362 2:132730043-132730065 AAAGAGAAGCACTGGAAAGTAGG + Intronic
939301500 2:140347090-140347112 GAGGGGAAGCACTATAAAGTAGG - Intronic
940205678 2:151198984-151199006 TCTGAGGAGCATTAGACAGTGGG - Intergenic
941149312 2:161894036-161894058 TAAGAGAAACCATAGAAAGTAGG + Intronic
941469606 2:165868431-165868453 TAAGAGGAGCATTAGAAGGAGGG + Intronic
941876454 2:170438725-170438747 CAGGAGAAGCATTTGAACTTGGG - Intronic
942898379 2:181085748-181085770 TAGGAGCAGCATAAGAAGGAAGG + Intergenic
944906641 2:204268527-204268549 TAGCAGAACCATTAGTAAGTTGG - Intergenic
944985075 2:205167000-205167022 TGAGAGAAGCATGAGAAAGTGGG - Intronic
946801575 2:223422781-223422803 TATAATAAGCATTTGAAAGTAGG - Intergenic
948098336 2:235354223-235354245 TAGCAAAAACATTAGTAAGTGGG + Intergenic
948114733 2:235486142-235486164 TATGGGAAGCAATAGAAAGGTGG - Intergenic
948215744 2:236229013-236229035 CAGGAGAATCATTTGAAACTAGG + Intronic
948443251 2:238011415-238011437 TAATAGAAGGAGTAGAAAGTGGG - Intronic
1168837102 20:884727-884749 TAGGACAAGCCCAAGAAAGTGGG + Intronic
1169993461 20:11529391-11529413 CAGGAGAAGCATTTGAACCTGGG - Intergenic
1170774226 20:19361446-19361468 AAGGAAAAGCTGTAGAAAGTAGG + Intronic
1171379102 20:24719689-24719711 CAGGAGAATCATTTGAAACTGGG + Intergenic
1173647128 20:44640319-44640341 TAGGAGAATCATTTGAACCTGGG + Intronic
1174435495 20:50503664-50503686 TAGGAGAATCACTTGAACGTGGG + Intergenic
1174641267 20:52046245-52046267 TAGGAGAATCACTTGAATGTGGG + Intergenic
1174718580 20:52786436-52786458 TAGGAAAAGATCTAGAAAGTGGG + Intergenic
1175045823 20:56104263-56104285 TACCAGAAGCATTAAATAGTGGG + Intergenic
1177043502 21:16142115-16142137 TAGGAGAATCATTTGAACCTGGG - Intergenic
1177193206 21:17874608-17874630 AAGAAGAATCATTAGAATGTAGG + Intergenic
1178201058 21:30405756-30405778 GAGGAGAAGAATAAGAAAGAGGG - Intronic
1178369178 21:32012804-32012826 TAGGACAAGCTGTACAAAGTGGG + Intronic
1179599975 21:42470986-42471008 CAGGAGAAACATTTGAAACTGGG + Intergenic
1180434644 22:15288684-15288706 TAGGGGAAGCTGTAGACAGTAGG - Intergenic
1181076060 22:20377631-20377653 TAGGAGAATCATTTGAAACCAGG + Intronic
1182239204 22:28901378-28901400 AAGGAGAAGCATTAGAGAAGGGG - Intronic
1184204091 22:42989703-42989725 TAGGAGAATCATTTGAACCTGGG + Intronic
1184586865 22:45453787-45453809 CAGGAGAATCATTTGAAACTGGG + Intergenic
951548899 3:23857147-23857169 TAGGAGAAGCATCAGGAAATTGG + Intronic
953247515 3:41208480-41208502 TACTAGAGGAATTAGAAAGTGGG - Intronic
953363820 3:42324846-42324868 CTGGAGAAGCATAAGCAAGTGGG - Intergenic
953579894 3:44144407-44144429 TAGGAGAAGCAGTTCAAAGAAGG - Intergenic
954247525 3:49343244-49343266 TAGGAGAATCACTTGAAACTGGG + Intergenic
954639126 3:52087714-52087736 AAGGAGAAGCTATAAAAAGTGGG + Intronic
956001394 3:64733705-64733727 TGAGGGAAGCATTAGAAATTAGG - Intergenic
957090091 3:75721372-75721394 CAGGAGAAGCACTTGAATGTGGG - Intronic
957461418 3:80526010-80526032 AAGGAGAATCATTAGAAATAAGG + Intergenic
957941255 3:87007374-87007396 TAGGAGAATCATTTGACATTTGG - Intergenic
958688871 3:97434923-97434945 GAGGAGGAGCCTTAGAAAGATGG - Intronic
958953421 3:100440825-100440847 GAGGAGAAGCATTGGAAACCAGG + Intronic
960422274 3:117461841-117461863 TAGGAGAATCACTTGAACGTGGG - Intergenic
963012855 3:140789597-140789619 TAGGAGAATCATTTGAATCTGGG + Intergenic
963346600 3:144102405-144102427 CAGGAGAAGCAGTAGAAAAGTGG - Intergenic
963627983 3:147697099-147697121 GAGGAGAAGCAGGAGAGAGTGGG + Intergenic
964177447 3:153841229-153841251 TAGGAGAAGCAATAAGAATTGGG + Intergenic
964749080 3:160038338-160038360 TTGGACAAGCATTCAAAAGTAGG + Intergenic
965968670 3:174527424-174527446 TAGGAGAATCATTTGAATCTGGG + Intronic
966157041 3:176927757-176927779 AAGGAGAAGCATTAAAAAGGAGG - Intergenic
966217957 3:177521705-177521727 GAAGAGAAGTGTTAGAAAGTGGG - Intergenic
967289654 3:187906558-187906580 TAGAAGAAGCAGTGGAAAGGAGG + Intergenic
968850925 4:3077510-3077532 CAGGAGAAGCATTTGAACCTGGG - Intronic
969875954 4:10135689-10135711 TAGGAGAAGCATTCTCAAGGTGG + Intergenic
970701867 4:18750909-18750931 TAGCAGAAGCATGGAAAAGTAGG - Intergenic
971019621 4:22520788-22520810 TAGTTGAAGGACTAGAAAGTGGG - Intergenic
971465737 4:26958367-26958389 GAACAGAAGCATTAGAAAGAAGG - Intronic
973582868 4:52361499-52361521 GAGGAGAAGCAAGAGAGAGTTGG - Intergenic
973729778 4:53811938-53811960 CAGGAGAATCATTTGAAACTGGG - Intronic
975579448 4:75893403-75893425 TAGGAGAATCATTTGAACCTGGG + Intronic
977095398 4:92736262-92736284 CAGAAGAAGCATTTAAAAGTTGG + Intronic
977271631 4:94924165-94924187 TAGGACAAGCAAGATAAAGTTGG + Intronic
977327732 4:95597456-95597478 TATGAGATCCCTTAGAAAGTTGG - Intergenic
977490000 4:97699480-97699502 TGGAAGAAGCATAAGAAAATTGG - Intronic
977685411 4:99841909-99841931 TAGGAGAAGAATTTAAAAGAAGG - Intronic
978513560 4:109547885-109547907 TAGGAACAGGATTAGAAAATTGG + Intergenic
979951876 4:126902739-126902761 GAGGAGAAGCATCAGACAGCTGG - Intergenic
980206568 4:129726691-129726713 TTGGAGAAGAAATAGAAAGCAGG - Intergenic
980763182 4:137264012-137264034 TACGAGAAGCAGTCGAAAGAGGG + Intergenic
981695581 4:147555765-147555787 CAGGAGAAGCACTTGAAACTGGG + Intergenic
982635397 4:157889391-157889413 AAGAAGAACCATCAGAAAGTAGG + Intergenic
983351052 4:166588772-166588794 TAAGACAAGCATTGCAAAGTTGG + Intergenic
983483639 4:168306972-168306994 GAGGAAAAGAATTAGAAAATGGG - Intronic
984251025 4:177334825-177334847 GAGGAGAAGGATTTGAAAGGCGG + Intronic
984251893 4:177345780-177345802 TAGGAGAATCATTTGAACCTAGG - Intronic
984365905 4:178800056-178800078 CAGGAGAATCACTAGAACGTGGG + Intergenic
987703167 5:21427734-21427756 TAAGAGAAGTAGTAGAAGGTAGG - Intergenic
988456503 5:31391848-31391870 AAGAAGCAGGATTAGAAAGTAGG - Intergenic
988637062 5:32995978-32996000 CATTAGAAGCATTAGAAAATGGG - Intergenic
989071576 5:37517458-37517480 TAGGAGAATCATTTGAACCTAGG - Intronic
989413627 5:41148677-41148699 GAGGAGAAGCAGTAGAGAGCTGG + Intronic
989529943 5:42496350-42496372 TAGGAGAAGGTTTAGCAAATTGG + Intronic
990105359 5:52251686-52251708 TGGGACAAGAATTAGAAAGTGGG + Intergenic
992135183 5:73737302-73737324 TAGGAAAAGCGTGAGAAAGATGG - Intronic
994369508 5:98952133-98952155 TAGGAGAATCATTTGAACTTGGG + Intergenic
995020678 5:107363972-107363994 TATGACAAGCATTAGAGACTAGG + Intergenic
995978790 5:118076188-118076210 GAAGAGAAGCACCAGAAAGTGGG + Intergenic
998748068 5:145284691-145284713 TAGGAGAAAGAACAGAAAGTTGG - Intergenic
999697775 5:154201834-154201856 TAGGAGAATCATTTGAAGCTGGG + Intronic
1001587123 5:172840534-172840556 TGGGAGAAGCAATAGCAAGCAGG + Intronic
1001684544 5:173583735-173583757 TAGGAGGAGCATAAGAACCTGGG + Intergenic
1003279354 6:4678360-4678382 TAGGAGATATATTAGAAATTGGG - Intergenic
1003415899 6:5907605-5907627 TAGGAGATACATAAGAAAGTGGG - Intergenic
1003680190 6:8245066-8245088 TGGGAGAAGTTTTAGACAGTCGG + Intergenic
1004224051 6:13770133-13770155 CAGGAGAATCATTTGAAACTGGG - Intergenic
1004986518 6:21088847-21088869 TGGGAGAAGCACTTGAAACTGGG + Intronic
1005347495 6:24904865-24904887 TAGGAGAATCATTTGAACCTGGG - Intronic
1006948790 6:37804154-37804176 TGGGAGAATCATTTGAAACTGGG - Intergenic
1007522386 6:42460967-42460989 TAGGAGGAGCATTGAAAAGGTGG + Intergenic
1008156713 6:48024452-48024474 TAGGAGAAACCTAAAAAAGTTGG + Intronic
1008720110 6:54338629-54338651 CAGGAGAATCATTTGAAACTGGG + Intronic
1008935594 6:56988440-56988462 AAGGAGAAGAATTACAAAGAAGG + Intronic
1009216807 6:60930994-60931016 TAGGAGAAGCATCTGTTAGTTGG - Intergenic
1010608563 6:77923253-77923275 AAGGAAATGCATCAGAAAGTTGG - Exonic
1011853684 6:91662631-91662653 TAGGAGTAGCTTTAGATAGATGG + Intergenic
1012671241 6:102050552-102050574 TAGGAGAATCACTTGAAACTGGG + Intronic
1012910134 6:105108918-105108940 AAGGGGAAGAATAAGAAAGTAGG + Intronic
1013329596 6:109086545-109086567 AAGTAAAAGAATTAGAAAGTAGG - Intronic
1013918423 6:115369472-115369494 CAGAAAAAGCATTAGAAGGTTGG + Intergenic
1014200393 6:118602911-118602933 TAGGAGAATCGTTTGAACGTGGG - Intronic
1014623985 6:123703564-123703586 TAGTGGAAGCATTTGAAAGAAGG + Intergenic
1014825560 6:126045740-126045762 TAGGTGAATCATTAGAACTTTGG + Intergenic
1014883686 6:126753607-126753629 TAGTAGAAGCTTTAGAAAGATGG + Intergenic
1014918169 6:127179562-127179584 TAAGAAAACCATTACAAAGTTGG + Intronic
1014974499 6:127862510-127862532 TAGGAGAATCACTTGAATGTAGG - Intronic
1015093877 6:129390932-129390954 TAGGAGAAGGGTTATAAATTAGG - Intronic
1015958337 6:138621563-138621585 CAGGAGAATCATTTGAAACTGGG - Intronic
1016908537 6:149174678-149174700 TAGTAAGAGCATTGGAAAGTGGG - Intergenic
1016924172 6:149325620-149325642 TAGGAAAAGCATTAGAAAATTGG + Intronic
1017534500 6:155332447-155332469 TAGGAGAATCATTTGAACCTAGG - Intergenic
1017605864 6:156132346-156132368 TACAAAAAGCATTAAAAAGTGGG + Intergenic
1018372878 6:163184937-163184959 TGGGACAAGCAGTAGAAATTAGG + Intronic
1018883735 6:167913466-167913488 TGGGAGCAGCATGAGAAACTTGG - Intronic
1018943194 6:168324425-168324447 AAGGAGAAGGAGAAGAAAGTAGG - Intergenic
1019438396 7:1033463-1033485 TAGGAGAATCATTTGAACTTGGG + Intronic
1019797636 7:3063525-3063547 GAGGAGAAGCAGAAGAAAGAAGG - Intergenic
1019916807 7:4138652-4138674 CAGGAGAAGCATTTGAACCTGGG + Intronic
1019924339 7:4182337-4182359 GAGGAGCAGCATTAGAGAGAAGG - Intronic
1020943341 7:14568312-14568334 TTGGAAAAGCATTAAAAAGAAGG + Intronic
1021251792 7:18337184-18337206 AAGGGGGAGCATTTGAAAGTTGG - Intronic
1021489204 7:21200470-21200492 TAGGAGAATCAATAGAAACCAGG - Intergenic
1023887725 7:44373268-44373290 TAGGAGATGCATTAGTAGGGAGG - Intergenic
1023962810 7:44941256-44941278 TAGGAGAACCACTTGAAACTGGG + Intergenic
1024758448 7:52565077-52565099 CAGGAGAATCATTTGAACGTGGG - Intergenic
1024816174 7:53274714-53274736 TGGGAGAAGCATTTGAACGCTGG - Intergenic
1025636318 7:63323048-63323070 TAGCAGACGCATTTGAAATTTGG + Intergenic
1025646378 7:63425054-63425076 TAGCAGACGCATTTGAAATTTGG - Intergenic
1026202160 7:68223780-68223802 CAGGAGAAGCATTTGAACCTGGG - Intergenic
1026268560 7:68816721-68816743 ACGGAGAAGTATTGGAAAGTAGG - Intergenic
1027945786 7:84744140-84744162 TAGGATAAGCATTGTAAAGGTGG + Intergenic
1030919031 7:115356861-115356883 CAGGAGAAGCAGAAGCAAGTTGG + Intergenic
1031185829 7:118478767-118478789 TTAGAGAAGCATCAGAAATTAGG - Intergenic
1033852366 7:145513142-145513164 AAGGATTAGGATTAGAAAGTTGG - Intergenic
1036898251 8:12653011-12653033 TAGGAGAATCATTTGAATCTGGG - Intergenic
1037288811 8:17329216-17329238 GAGGAAAAGCCTTAGAAGGTGGG + Intronic
1037432454 8:18828230-18828252 TAGGAGAAAAAGTAGAAAGCTGG - Intronic
1038098949 8:24350404-24350426 TAGGAGAAGTACTTGAAACTGGG - Intronic
1038737567 8:30186207-30186229 CAGGAGAATCATTAGAACCTGGG - Intergenic
1038773738 8:30509203-30509225 AAGGAGAAGAATATGAAAGTAGG - Intronic
1041041205 8:53847999-53848021 TATGAAAAGCACAAGAAAGTAGG - Intergenic
1041302345 8:56425587-56425609 AAGGGGAAGCATTTGAGAGTTGG - Intergenic
1041511451 8:58659149-58659171 AAGGGGAAGGATTAGAAAGGGGG + Intronic
1042291436 8:67172902-67172924 GAGGAGAAGCAGGAGAATGTAGG + Intronic
1042360969 8:67882654-67882676 TAGTAGAGGCATTAGATATTTGG - Intergenic
1042381894 8:68125352-68125374 TAGGAAAAACATTAGAAATGGGG - Intronic
1042844465 8:73156601-73156623 TGGGAGAAGCATTTGAACCTGGG - Intergenic
1042860369 8:73307176-73307198 TAAAAGAAGGATTAGAAAGGTGG + Intronic
1042863188 8:73333989-73334011 TAGGAGAATCATTTGAACCTGGG + Intergenic
1043428117 8:80169075-80169097 CAGGAGAATCACTAGAAACTGGG - Intronic
1043992258 8:86769911-86769933 TAGTCAAAGCATTAAAAAGTTGG + Intergenic
1045905684 8:107342031-107342053 TCTGAGAAGCATAAGAAATTTGG - Intronic
1046548659 8:115683966-115683988 TAGGAGAAGCACTAGAACCCTGG + Intronic
1048100717 8:131348326-131348348 TCGGAGACACATTAGGAAGTAGG + Intergenic
1048221057 8:132542284-132542306 TAGGAGAATCATTTGAACTTAGG + Intergenic
1048383101 8:133885636-133885658 TATTAGAAGAATAAGAAAGTCGG + Intergenic
1048649582 8:136460257-136460279 TAGGAGAATCATTTGAACCTGGG - Intergenic
1050350427 9:4736020-4736042 CAGGAGAAGCACTTGAACGTGGG + Intronic
1050360228 9:4823168-4823190 ACGGAGAAACAGTAGAAAGTAGG - Intronic
1050554435 9:6776908-6776930 TAGGAGAAGCCTTTAAAAGGTGG - Intronic
1052193711 9:25686757-25686779 GAGGTGAAGCAAGAGAAAGTGGG - Intergenic
1052370368 9:27657136-27657158 TCAGGGAAGCATTAGAAAATTGG - Intergenic
1052723778 9:32204434-32204456 TAAGAGTAGCATAAGAAAGAAGG + Intergenic
1053657885 9:40238732-40238754 CAGGAGAATCATTTGAAACTGGG - Intronic
1053908255 9:42868006-42868028 CAGGAGAATCATTTGAAACTGGG - Intergenic
1054370006 9:64385004-64385026 CAGGAGAATCATTTGAAACTGGG - Intronic
1054526711 9:66137493-66137515 CAGGAGAATCATTTGAAACTGGG + Intronic
1054677637 9:67874758-67874780 CAGGAGAATCATTTGAAACTGGG - Intronic
1055528778 9:77162120-77162142 AAGGAGAAGATTTAGAAAGATGG + Intergenic
1055673284 9:78629012-78629034 TAGGAGAATCGTTTGAAACTGGG - Intergenic
1056344024 9:85672161-85672183 TAGGAGAATCATTTGAACCTGGG - Intronic
1056662432 9:88554296-88554318 TAGGAGAATCACTTGAACGTGGG - Intronic
1057404389 9:94755746-94755768 AAGGAAAAGCATCAGCAAGTGGG + Intronic
1058554028 9:106147219-106147241 CAGGAAAAGCTTCAGAAAGTGGG - Intergenic
1058594070 9:106596180-106596202 TAGGACAAGAGATAGAAAGTTGG + Intergenic
1186113496 X:6280004-6280026 TAGGAGGCGCATCAGAAAGAGGG - Intergenic
1186235717 X:7507295-7507317 TAGAACAAGGATTAGAAAGTTGG + Intergenic
1188582993 X:31737969-31737991 TAGTAGAAGCAGTATATAGTTGG + Intronic
1188686088 X:33072323-33072345 TAGGAGAATCATTTGAACCTGGG + Intronic
1189985928 X:46553274-46553296 TAGGAGAACCATTTGAACCTGGG - Intergenic
1192033008 X:67534771-67534793 TAGGAGAATCATTTGAACATAGG + Intergenic
1192550718 X:72051570-72051592 TAGGAGAAGCAAGAGGAAGGAGG - Intergenic
1195102793 X:101572335-101572357 TAGGAGAATCATTTGAATCTGGG - Intergenic
1197749782 X:129956748-129956770 GAGGAGAAGCTTTGGAAAGATGG - Intergenic
1197859784 X:130958176-130958198 TAGGAGAAGCTACTGAAAGTCGG + Intergenic
1198732615 X:139748638-139748660 GAGGAGAATCATTAGAACTTTGG - Intronic
1198967728 X:142244906-142244928 TAGGGGTAGCACTGGAAAGTGGG - Intergenic
1199177961 X:144814220-144814242 CAGCAAAAGCAGTAGAAAGTGGG + Intergenic
1202250687 Y:22868517-22868539 CAGGAGAATCACTGGAAAGTAGG + Intergenic
1202403676 Y:24502266-24502288 CAGGAGAATCACTGGAAAGTAGG + Intergenic
1202467103 Y:25167816-25167838 CAGGAGAATCACTGGAAAGTAGG - Intergenic