ID: 1077466393

View in Genome Browser
Species Human (GRCh38)
Location 11:2735633-2735655
Sequence GTCACCACCAAGACCACAGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 173
Summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 154}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077466393 Original CRISPR GTCACCACCAAGACCACAGT GGG Intronic
903760239 1:25692708-25692730 GTGGCCGCCAAGAACACAGTGGG + Intronic
903852832 1:26318473-26318495 GTCACCTCCATAACCACAGCAGG - Intronic
903902324 1:26656953-26656975 GTCACCACCACAACCACACATGG + Intergenic
904273269 1:29364185-29364207 GTTTCCACCACGAGCACAGTGGG - Intergenic
905352411 1:37356733-37356755 GTCACCATCAAGCCATCAGTGGG + Intergenic
906078182 1:43067451-43067473 TGCATCACCAAGACCACTGTGGG - Intergenic
907799347 1:57749491-57749513 GGCAACACCAGGTCCACAGTTGG + Intronic
908024168 1:59931196-59931218 GAAACCACCAGTACCACAGTAGG + Intergenic
911853662 1:102851164-102851186 GTCTCCATTAATACCACAGTGGG - Intergenic
913361819 1:117989465-117989487 CTCACCACCAAGAGGACAGAAGG + Intronic
916401355 1:164452375-164452397 CTCTCCACCCAGCCCACAGTTGG + Intergenic
916442395 1:164840517-164840539 GTTACCACCCTGAGCACAGTGGG - Intronic
920965391 1:210696900-210696922 GTTTCACCCAAGACCACAGTTGG - Intronic
923383261 1:233442483-233442505 CTCCCCACCAAAACCAAAGTGGG + Intergenic
1064529312 10:16291024-16291046 ATCACCCCCAAAACCACAGGCGG + Intergenic
1067139037 10:43640434-43640456 GTCACCATAAAGACCAAAGTAGG + Intergenic
1069522439 10:69134715-69134737 TTCAACACTAAGACCCCAGTAGG - Intronic
1071951395 10:90706855-90706877 ATGACCTCAAAGACCACAGTAGG + Intergenic
1076368062 10:129934983-129935005 ATCACCACCAGGTACACAGTAGG - Intronic
1077466393 11:2735633-2735655 GTCACCACCAAGACCACAGTGGG + Intronic
1082235309 11:49815864-49815886 GTCACTACCAAAATCACAGGGGG + Intergenic
1084602274 11:70152879-70152901 GTCACTATCCAGACCACAGATGG + Intronic
1085905032 11:80749823-80749845 GTAACCCCCAACCCCACAGTGGG - Intergenic
1088631368 11:111776774-111776796 GTAACCACCTAGACCAGATTTGG - Intergenic
1089462966 11:118663469-118663491 GTCACCACCACCACCCCATTAGG + Intronic
1090843059 11:130509242-130509264 GGCACCACCAAGACCCCTGCAGG - Intergenic
1090899391 11:131013955-131013977 GTCACCATTGACACCACAGTGGG - Intergenic
1091086994 11:132730766-132730788 TTGACCACCAAGACCCCAGTTGG + Intronic
1095721249 12:45403789-45403811 GTCACCAACAATAGCCCAGTAGG - Intronic
1096418483 12:51434716-51434738 GACACCACAGAGAACACAGTGGG - Intronic
1097150893 12:56979111-56979133 GGTGCCAGCAAGACCACAGTGGG - Intergenic
1097907346 12:64933740-64933762 GTCACCACCAGTAGCAAAGTAGG + Intergenic
1102237751 12:111304868-111304890 GTCATCACCAGGACTGCAGTGGG + Intronic
1102577456 12:113864949-113864971 GTCATCACCATTCCCACAGTGGG + Intronic
1103337027 12:120197292-120197314 GATCCCACCAGGACCACAGTGGG - Intronic
1103848259 12:123914644-123914666 GGCATCACCAGGACCACAGTTGG + Intronic
1107530452 13:41277802-41277824 GTCACCAGAAAGACCAAGGTAGG - Intergenic
1110584003 13:77166331-77166353 GGCAACACCAAAACCATAGTAGG + Exonic
1113886293 13:113660305-113660327 GTCTCCACTGACACCACAGTGGG - Intergenic
1115683304 14:35766138-35766160 GAAACCAACAAGCCCACAGTAGG - Intronic
1121034796 14:90692887-90692909 ACCACCACCAAGAGCTCAGTTGG - Intronic
1123130772 14:105983643-105983665 GTCACCACCAACATAAAAGTGGG - Intergenic
1123581004 15:21714865-21714887 GTCACCACCAACATAAAAGTGGG - Intergenic
1123617653 15:22157488-22157510 GTCACCACCAACATAAAAGTGGG - Intergenic
1124042970 15:26121822-26121844 GACACTACCAAGAGCACAGAGGG - Intergenic
1124371606 15:29107475-29107497 TCCAGCACCAAGACCACAGCAGG - Intronic
1126234338 15:46365253-46365275 GTCACCACAAGGAACACAGTGGG + Intergenic
1126352931 15:47764030-47764052 GTAAACACCCCGACCACAGTGGG - Exonic
1129512717 15:76136870-76136892 GTTGCCACCATGACCACGGTTGG - Intronic
1131315103 15:91328948-91328970 GGCACCAGCTTGACCACAGTGGG - Intergenic
1131400283 15:92119820-92119842 GTGAAAACCAAGACCCCAGTTGG + Intronic
1132492434 16:240111-240133 GTCACCACCAAGAACACGCTGGG - Intronic
1132903909 16:2272452-2272474 GTCTCCACCACAGCCACAGTGGG + Intergenic
1136221961 16:28834808-28834830 GACACCGCCAATACCACAGAGGG - Intronic
1136414455 16:30095229-30095251 GTAACCAACCAGGCCACAGTGGG - Intronic
1139003373 16:62541163-62541185 GTCACCACAAAGACCAAGGGAGG - Intergenic
1141270809 16:82539752-82539774 CTCTCCATCAAGACAACAGTGGG - Intergenic
1141474698 16:84264998-84265020 CTCACTACCATGAACACAGTAGG + Intergenic
1141668282 16:85477506-85477528 GTGACCACCGAGAGCCCAGTAGG - Intergenic
1141860322 16:86711934-86711956 AGCACCACCAAGCACACAGTAGG + Intergenic
1142590308 17:1001972-1001994 GTCACCAAGATGACCACAGCAGG - Exonic
1146496308 17:33325546-33325568 GTCAACATCAAGATCACAGAAGG + Intronic
1147507151 17:41029947-41029969 GCCACCACCAATGCCACAGCCGG + Exonic
1149478452 17:56982954-56982976 GTCAGCACCATGTCCTCAGTAGG - Intronic
1150615080 17:66764215-66764237 GTAACCAACATCACCACAGTAGG - Intronic
1152532268 17:80925581-80925603 ATCACTACCACGACCACAATGGG - Intronic
1153359483 18:4177159-4177181 GTCACTAGCTAGACCACATTAGG - Intronic
1153608958 18:6862354-6862376 GTCACCCCCAAGACTTCAGGGGG + Intronic
1156126648 18:33913951-33913973 GTCATTACCAAGCACACAGTGGG - Intronic
1160366421 18:78329702-78329724 TTCAGCACCAAGACCACACGTGG - Intergenic
1160583231 18:79899505-79899527 GTCATCTCCATGACCACCGTGGG + Exonic
1161428142 19:4215903-4215925 GTCCCCACCAAGACTCCAGTGGG - Intronic
1162262543 19:9544569-9544591 TTCCCCACCCAGACCACACTTGG + Intergenic
1163677673 19:18663423-18663445 GCCAGCCCCAAAACCACAGTGGG - Intronic
1164259050 19:23553375-23553397 TTCCCCACCCAGACCACACTTGG + Intronic
925715659 2:6782315-6782337 GTCAGTACCAAGCCCACAGTCGG + Intergenic
926217315 2:10913519-10913541 ATCATCACCATGACCACCGTCGG + Exonic
926516539 2:13853351-13853373 TTCACTACCAAGAGAACAGTAGG + Intergenic
928984602 2:37168525-37168547 GTCACCTCCCACACCACAGATGG - Intronic
931821855 2:65959981-65960003 CTCACCTCCAGGACGACAGTAGG - Intergenic
935536007 2:104295271-104295293 GTCACCAGAAAGACCATAGTGGG - Intergenic
939475647 2:142682746-142682768 GTCACCACAATGCCCCCAGTAGG - Intergenic
1170073209 20:12391322-12391344 CTCCCCACCATGCCCACAGTGGG + Intergenic
1172228661 20:33322371-33322393 GTCATCTCCAAGGCCACAGATGG + Intergenic
1172698255 20:36836847-36836869 TGCACCAACAAGACCACAGGGGG + Intronic
1173227007 20:41168006-41168028 TTCTCCACAAAGACCACAGATGG - Intronic
1174503845 20:51004304-51004326 GTCATCACCATGACGACGGTGGG - Exonic
1175306524 20:57979523-57979545 CTGGCCACTAAGACCACAGTGGG - Intergenic
1175306533 20:57979569-57979591 CTGGCCACTAAGACCACAGTGGG - Intergenic
1176860514 21:14009316-14009338 GCCCCTACCAAGACCTCAGTGGG - Intergenic
1177408559 21:20701384-20701406 ACCACCACCGAAACCACAGTAGG + Intergenic
1178511831 21:33211853-33211875 GTCACCCCTGAGACCTCAGTCGG + Intergenic
1179088860 21:38245059-38245081 GACACCTCCATGACCACAGAAGG + Intronic
1179166799 21:38941578-38941600 TTCACCACCATGAGAACAGTAGG - Intergenic
1180247335 21:46557030-46557052 GGCAAAACCAAGGCCACAGTAGG - Exonic
1182663845 22:31943760-31943782 CTCACTACCCAGCCCACAGTGGG - Intronic
1183899848 22:40996788-40996810 GACTCCACCAGGACCACTGTGGG - Intergenic
952980163 3:38727800-38727822 GACCCCACCATGACCAGAGTGGG + Intronic
958604234 3:96337889-96337911 TTCACTACCAAGAGAACAGTAGG - Intergenic
961319693 3:126064099-126064121 GTCACCACCAAGACTTAAGCTGG + Intronic
962304108 3:134270643-134270665 GTATCCACCATGACCAGAGTTGG + Intergenic
962738952 3:138348974-138348996 GCCACGACCAAGACCCCAGTGGG + Intronic
963111615 3:141693375-141693397 TTCCCCACCCAGACCACACTTGG - Intergenic
963692270 3:148519390-148519412 GGTACCAGCAAGACTACAGTGGG + Intergenic
967402775 3:189082455-189082477 GTCAGAAGCAAGACAACAGTTGG + Intronic
968570545 4:1338224-1338246 GTCTCCACCGAGGCCTCAGTGGG + Intronic
968763927 4:2458487-2458509 GTTCCCCCCAAGACCACACTGGG + Intronic
971160882 4:24132838-24132860 GCCACCACCAAGACAGCACTAGG - Intergenic
983267510 4:165522886-165522908 GTCTTAACCAAGACCTCAGTTGG - Intergenic
989660144 5:43789735-43789757 TTCTCCACCAAGACCAAACTTGG + Intergenic
992784819 5:80159613-80159635 GTCACCAGAAAGACCAAGGTAGG + Intronic
992994406 5:82318313-82318335 GCCCCCACCATGTCCACAGTGGG + Exonic
994325195 5:98438881-98438903 TTCCCCACCCAGACCACACTTGG + Intergenic
995128127 5:108600501-108600523 GGCACCAAGAAGACCAAAGTGGG + Intergenic
995255253 5:110038448-110038470 CTCACCTCCTAGACCGCAGTGGG + Intergenic
995623375 5:114052432-114052454 GTCACCAGCATCACCAAAGTTGG - Intergenic
998559050 5:143154104-143154126 ACCACCACCAGGCCCACAGTAGG - Intronic
999312324 5:150559388-150559410 CTCACCAGCAAGAACACAGCTGG + Intergenic
999728161 5:154454216-154454238 GTCATTACCAACACCAGAGTAGG - Intronic
1001315198 5:170636965-170636987 TCCACCTCCAAGTCCACAGTGGG + Intronic
1001862113 5:175066291-175066313 GTCACACCAAAGACCACAGAAGG - Intergenic
1003345344 6:5261172-5261194 GTCTCCGCCAAGACCCCAGACGG - Exonic
1005996266 6:30933308-30933330 GACAACAGGAAGACCACAGTGGG + Intergenic
1006572492 6:35017461-35017483 GTCCACTCCAAGACCACAGGCGG + Exonic
1007206251 6:40154104-40154126 TGCACAACCAATACCACAGTAGG + Intergenic
1007230158 6:40342676-40342698 GCCACCTCCAAGACAAAAGTGGG + Intergenic
1007801452 6:44397153-44397175 GTCACCAGAAAGACCACGGCAGG - Intronic
1012566193 6:100656265-100656287 GTCATCACCAAAACCACAGAGGG + Intronic
1013062679 6:106652253-106652275 GAAACCAACAAGCCCACAGTGGG - Exonic
1013301629 6:108809643-108809665 GTCCCCACCAAGATCCCAGATGG + Intergenic
1013789208 6:113816728-113816750 AACACTTCCAAGACCACAGTAGG - Intergenic
1015439148 6:133227533-133227555 GTCTCCATCAAGAACACAGCTGG - Intergenic
1018024163 6:159790751-159790773 GGCACTGCGAAGACCACAGTAGG + Intronic
1018085584 6:160298495-160298517 TGCAACACCAAGCCCACAGTGGG + Intergenic
1018343935 6:162881937-162881959 CTCTCCACCAAGACCAGAGATGG + Intronic
1018791997 6:167155753-167155775 GTCACCACCATGCCCAGAGGAGG - Intronic
1019400366 7:848713-848735 GCCAGCACCAAGACCACAGGAGG - Intronic
1019643398 7:2116497-2116519 GTCCCCAGCAAGACCCCAGGTGG + Intronic
1021046141 7:15925245-15925267 GACACCAGCTTGACCACAGTGGG + Intergenic
1022319445 7:29275076-29275098 GTAACCATCAAGATCACAGGGGG - Intronic
1023742219 7:43290823-43290845 GTCTCCACCATGACAACAGCTGG - Intronic
1024027003 7:45419701-45419723 GTCACCAGCAATACTGCAGTAGG - Intergenic
1025194578 7:56922956-56922978 GTCACCTCCACCACCACAGAAGG - Intergenic
1025677373 7:63653987-63654009 GTCACCTCCACCACCACAGAAGG + Intergenic
1028073078 7:86476720-86476742 GACAACCCCAAGACCACAATTGG - Intergenic
1028604613 7:92642293-92642315 GTCACCACAAAGGCCAGAGCTGG - Intronic
1034734373 7:153414492-153414514 GTAGCCACCACCACCACAGTGGG + Intergenic
1035404728 7:158589448-158589470 ATCACCACCAAGCCCACATTTGG - Intergenic
1037124604 8:15331917-15331939 GTCACCAACAAGAATCCAGTTGG + Intergenic
1037665586 8:20966886-20966908 TTAACCAACAAAACCACAGTGGG + Intergenic
1037757080 8:21717817-21717839 GACACAACCAAGACCTCAGGGGG + Intronic
1041419664 8:57652324-57652346 CTTACCACTAAGACCACAGGTGG - Intergenic
1043103842 8:76083022-76083044 GCCACCCCCAAGACCCCAGAAGG - Intergenic
1046659478 8:116933733-116933755 TTCACCACCAAGATCAAAGGGGG - Intergenic
1047159615 8:122363154-122363176 TTCACTACCATGACTACAGTAGG + Intergenic
1047752463 8:127892075-127892097 GTGGCGGCCAAGACCACAGTTGG + Intergenic
1048182418 8:132208309-132208331 GTCACCACCAAGAGCTTAGTAGG - Intronic
1048589087 8:135804419-135804441 GTCTCCACCAACACCAGAGTAGG - Intergenic
1050149857 9:2608704-2608726 GTAACCACAGAGCCCACAGTAGG - Intergenic
1055752531 9:79522674-79522696 GGCACTACCCAGATCACAGTGGG + Intergenic
1057180474 9:93027028-93027050 CTCACACCCAAGACCACAGTGGG - Intronic
1060492276 9:124093673-124093695 CACACCACCAAGACCACAGATGG - Intergenic
1060778103 9:126391513-126391535 GTCACCATCAATACCTCAGTAGG - Intronic
1061292038 9:129655904-129655926 GTCACACGCAAGCCCACAGTGGG + Intergenic
1061595986 9:131629335-131629357 GTGACCAGGAAGAACACAGTGGG + Intronic
1186366907 X:8905094-8905116 GCCACCACAATGACGACAGTTGG + Intergenic
1188140796 X:26548180-26548202 GACACCAGCATGGCCACAGTGGG - Intergenic
1189261337 X:39680817-39680839 GTCCTCACCAAGGACACAGTTGG + Intergenic
1189515230 X:41706872-41706894 GACAGCTCCAAGACCAAAGTGGG + Intronic
1190088803 X:47419632-47419654 GACTCCACCAAGGCCTCAGTGGG - Intergenic
1193224163 X:78962102-78962124 GTGACAACCAAGAACACAATAGG - Intergenic
1196346187 X:114661783-114661805 GTCAAGAACAAAACCACAGTTGG - Intronic
1199077169 X:143537023-143537045 TTCACCACCATGAGCACAGTTGG + Intergenic