ID: 1077466630

View in Genome Browser
Species Human (GRCh38)
Location 11:2736613-2736635
Sequence CTGTGTAACTGGGGGGTGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 515
Summary {0: 1, 1: 0, 2: 2, 3: 38, 4: 474}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077466630_1077466639 7 Left 1077466630 11:2736613-2736635 CCTCCCACCCCCCAGTTACACAG 0: 1
1: 0
2: 2
3: 38
4: 474
Right 1077466639 11:2736643-2736665 ACCCCAACCTAGCCCCTTCCAGG 0: 1
1: 0
2: 2
3: 17
4: 196

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077466630 Original CRISPR CTGTGTAACTGGGGGGTGGG AGG (reversed) Intronic
900307156 1:2016292-2016314 CTGTGTGACTGGGGCCTGTGTGG - Intergenic
900640271 1:3685103-3685125 CTGAGCAACTTGGGGTTGGGAGG - Intronic
901039458 1:6355239-6355261 CTGTGCATCTGGGGTTTGGGTGG - Intronic
901209480 1:7516371-7516393 CTGTGGAATTGGGGGCTGGGAGG + Intronic
901240937 1:7692849-7692871 GTGAGTTCCTGGGGGGTGGGGGG - Intronic
902214553 1:14925842-14925864 GTGTGTAACTGGGGAGAAGGTGG - Intronic
902605171 1:17565143-17565165 CTGTGTCCCTGCGTGGTGGGAGG + Intronic
902772581 1:18654197-18654219 GTGTGGAGCTGGCGGGTGGGGGG - Intronic
903846194 1:26280940-26280962 CTGGGGGACGGGGGGGTGGGGGG + Intronic
904035586 1:27557023-27557045 CTGTGTGGCTGGGGGTAGGGTGG - Intronic
904466443 1:30710895-30710917 CTGTGAGGCTGGGGGTTGGGGGG - Intergenic
905046545 1:35007809-35007831 CTGTCTGGCTGGGGGATGGGGGG + Intronic
905068349 1:35203837-35203859 CTGTCTTAGTGGGGGGGGGGGGG - Intergenic
905348612 1:37328711-37328733 CTGTGGGACTGGGGGTTGGGTGG - Intergenic
906712930 1:47945035-47945057 CTGGGGAAGTTGGGGGTGGGTGG + Intronic
907262126 1:53227011-53227033 GTGTGGACATGGGGGGTGGGTGG - Exonic
907285787 1:53378644-53378666 CTCTGTATGTGGTGGGTGGGTGG - Intergenic
907696287 1:56732797-56732819 TAGTGTAAGTGGTGGGTGGGGGG - Intronic
908082282 1:60593985-60594007 CTGTATAATTGGGGGGGTGGGGG - Intergenic
908518945 1:64922183-64922205 GTAACTAACTGGGGGGTGGGGGG - Intronic
908564636 1:65341781-65341803 GTGTGTGCCTGTGGGGTGGGTGG + Intronic
908799417 1:67864162-67864184 CTGTGAGAATGGGGGTTGGGAGG + Intergenic
910497587 1:87849603-87849625 GTGTGCAGCGGGGGGGTGGGGGG + Intergenic
911711137 1:101074711-101074733 CTATGTACCTTAGGGGTGGGAGG - Intergenic
912708717 1:111934165-111934187 CTGTAAAAGTGGGAGGTGGGAGG + Intronic
913173731 1:116255480-116255502 AAGTGTGGCTGGGGGGTGGGGGG - Intergenic
914416795 1:147491375-147491397 CTGTGGAACTGGGAAGTGGTGGG + Intergenic
914903894 1:151728472-151728494 CGGGGTAGGTGGGGGGTGGGGGG + Intronic
915443124 1:155958901-155958923 CAGTGTGGGTGGGGGGTGGGGGG + Intronic
915516114 1:156413617-156413639 CTTTGTACTTTGGGGGTGGGGGG + Intronic
915729002 1:158039575-158039597 ATGAGTAAGTGTGGGGTGGGAGG - Intronic
916564652 1:165963258-165963280 CTGAGTAACTGAGTGGAGGGTGG - Intergenic
916697405 1:167253377-167253399 CTGTGTGTTTGGGGGGGGGGGGG - Intronic
916809828 1:168295747-168295769 CTGGGAAACGGGGTGGTGGGGGG + Intronic
918065705 1:181100089-181100111 CTCTGGAACGTGGGGGTGGGGGG + Intergenic
918958856 1:191244851-191244873 CTGTGGAGCAGGGCGGTGGGAGG - Intergenic
919640479 1:200040397-200040419 CTGAGTGAGTTGGGGGTGGGAGG + Intronic
919733328 1:200928507-200928529 GGGGGTTACTGGGGGGTGGGTGG + Intergenic
919972504 1:202590317-202590339 CTGTGGAACTGTGGGGAGTGTGG - Exonic
920295619 1:204954421-204954443 CTGGGTAAATGGAGAGTGGGGGG + Intronic
921706898 1:218332489-218332511 ATGTGCAACTGGGTGGTAGGAGG - Exonic
921712133 1:218383522-218383544 GTGTGTATGTGGGGGGTGTGGGG + Intronic
922130463 1:222772228-222772250 CTGTGTAAGTGTTGTGTGGGGGG + Intergenic
922629033 1:227085186-227085208 GAGTGTATGTGGGGGGTGGGAGG - Intronic
923014133 1:230112784-230112806 GTGTGTGGCAGGGGGGTGGGGGG + Intronic
923018055 1:230142153-230142175 CTGTGGAGGTGGGGGGAGGGTGG + Intronic
924406645 1:243754761-243754783 CTGTGAACCTGGGTGGTGTGTGG - Intronic
924649962 1:245917136-245917158 CTGGGAAGCTGAGGGGTGGGAGG - Intronic
924784513 1:247183132-247183154 CTGTCTGAGTGTGGGGTGGGAGG - Intergenic
1063590927 10:7394850-7394872 CTGTGTAACAGAGGGAGGGGAGG - Intronic
1064827623 10:19423449-19423471 ATGTTTTTCTGGGGGGTGGGAGG - Intronic
1065021669 10:21507100-21507122 GTGTGTATGTGGGGGGTGGGAGG - Intergenic
1065287995 10:24203555-24203577 CTGTGGAGGTGGGGGTTGGGGGG - Intronic
1065519398 10:26556783-26556805 ATGTCTGAGTGGGGGGTGGGTGG + Intronic
1065674756 10:28162928-28162950 CTGTGTAACGGGGAAGTAGGAGG - Intronic
1065719413 10:28611648-28611670 CTGGGTAATATGGGGGTGGGGGG + Intronic
1067092224 10:43273669-43273691 CTGTGCAAGGGGGCGGTGGGTGG + Intergenic
1067435355 10:46272952-46272974 CTGGGAAACTGGTGGGAGGGAGG - Intergenic
1067696072 10:48536488-48536510 CTGAGTAACTAGCAGGTGGGGGG - Intronic
1068344402 10:55754716-55754738 CTGGGAAGCTGGAGGGTGGGAGG + Intergenic
1069852837 10:71421362-71421384 CTGTGTGCCTGGGGAGTGGGTGG + Intronic
1070156779 10:73840146-73840168 CTGTGTCTCTGAGGGGTTGGGGG - Intronic
1070628186 10:78066153-78066175 TTTTGTCACTGGGTGGTGGGAGG - Intergenic
1070711209 10:78684510-78684532 CTGTGGAGCTAGGGGGTGGGAGG + Intergenic
1070713443 10:78700288-78700310 TTGTGTACTGGGGGGGTGGGAGG - Intergenic
1071104284 10:82076552-82076574 GTTTGTATCAGGGGGGTGGGTGG + Intronic
1071473770 10:86007295-86007317 CAGTGTCAGTGGGGGGTGGGAGG - Intronic
1071527103 10:86365285-86365307 CAGGGAAACTGGGGGTTGGGAGG - Intronic
1072359752 10:94647867-94647889 CAGTGCCACTGGGGGCTGGGGGG + Intergenic
1072737602 10:97889440-97889462 CTGTGGAACTTGGTGGGGGGGGG + Intronic
1073959803 10:108912638-108912660 GTGTGTGTCGGGGGGGTGGGGGG + Intergenic
1074223920 10:111464732-111464754 CTGTGTAACTGGAGTGCAGGAGG + Intergenic
1074252460 10:111765173-111765195 ATGTGTGTGTGGGGGGTGGGGGG - Intergenic
1074872938 10:117591436-117591458 GTGTGTAACAAGGGGTTGGGTGG + Intergenic
1075577357 10:123587307-123587329 CTGACCAACTTGGGGGTGGGAGG - Intergenic
1075874228 10:125793329-125793351 TTGTGTGACTTGGGGGTGGGTGG + Intronic
1076370290 10:129948613-129948635 GGGGGAAACTGGGGGGTGGGGGG + Intronic
1076896989 10:133317810-133317832 CTCTGTGTCTGGGGGGGGGGGGG - Intronic
1076931314 10:133533674-133533696 CTGTGGAGCTGGGAGGTGGCTGG + Intronic
1077039343 11:511845-511867 CTGTGTGTGTGGGGGGTGGCTGG - Intergenic
1077160438 11:1110121-1110143 CCGAGTACCTGGGGGGAGGGCGG - Intergenic
1077367702 11:2167796-2167818 CGCTGGACCTGGGGGGTGGGAGG - Intronic
1077466630 11:2736613-2736635 CTGTGTAACTGGGGGGTGGGAGG - Intronic
1078907880 11:15704372-15704394 CTGGAAAACTGGAGGGTGGGAGG - Intergenic
1080329225 11:31115972-31115994 CTGTGGCAGTGGGGGGGGGGGGG + Intronic
1081646501 11:44793968-44793990 TTGAGGAACAGGGGGGTGGGGGG + Intronic
1081789551 11:45773395-45773417 CTGTGTAAGTATGAGGTGGGTGG - Intergenic
1082762544 11:57141728-57141750 TTGTGCAACTGGGTGGAGGGCGG + Intergenic
1082821176 11:57545791-57545813 CTGTGGGGCTGGAGGGTGGGTGG - Intronic
1083050235 11:59770323-59770345 GTGTGTATATGGGGTGTGGGTGG + Intronic
1083633146 11:64105960-64105982 GAGTGTATCTGTGGGGTGGGCGG + Intronic
1084515701 11:69637120-69637142 CTTTGGCACTTGGGGGTGGGTGG - Intergenic
1085503664 11:77043280-77043302 CTGTGTCACTGCATGGTGGGAGG + Intergenic
1086735083 11:90296461-90296483 CTGGGTGGCAGGGGGGTGGGTGG + Intergenic
1089644689 11:119871027-119871049 GTGAGTATCTGGGGTGTGGGGGG + Intergenic
1089866178 11:121634173-121634195 CTGTGGAACTGGGTGGGGGAGGG + Intergenic
1090181492 11:124704128-124704150 CTGTGTGAGTGGAGGCTGGGTGG - Intergenic
1090467403 11:126946858-126946880 TTGTGTAACTAGGGTGTGGTGGG + Intronic
1091590542 12:1840433-1840455 ATGTGGAAGAGGGGGGTGGGTGG + Intronic
1091823286 12:3491884-3491906 GTGTGTTGGTGGGGGGTGGGGGG + Intronic
1092843216 12:12562461-12562483 TTGTGAAAGTGGGGGTTGGGGGG + Intergenic
1094429413 12:30350317-30350339 CTGTGTGGGTGGGGGGGGGGCGG + Intergenic
1094535962 12:31323693-31323715 GTGTGTTTCTAGGGGGTGGGGGG - Intronic
1095962644 12:47845069-47845091 CTGTGTGGGTGGGGGGTGGTGGG - Intronic
1096077283 12:48813829-48813851 CTGAGCAACTTGGAGGTGGGTGG + Intronic
1096084577 12:48857225-48857247 CTTTGGAATTGGGGGGAGGGGGG - Exonic
1096200100 12:49675330-49675352 CTGCGTAACTGGGGAGTGTGTGG - Intronic
1096491575 12:52015612-52015634 CTGTGTGTGTGGAGGGTGGGGGG - Exonic
1096790924 12:54044413-54044435 CTTTGTGACTGAGGGGTTGGGGG - Intronic
1097175140 12:57138260-57138282 CTGTGTATCTGCGGTGGGGGTGG - Intronic
1098791800 12:74833574-74833596 CTGAGGAATGGGGGGGTGGGAGG + Intergenic
1099343495 12:81468884-81468906 GTTTATCACTGGGGGGTGGGGGG + Intronic
1100445533 12:94656432-94656454 ATGTGGCACTGGGGGGGGGGGGG + Intergenic
1101917884 12:108910363-108910385 CAGTGGAGCTGGGGGCTGGGGGG - Intergenic
1102572707 12:113836904-113836926 GTGTGTATGTGGGGGGGGGGGGG - Intronic
1103080125 12:118017043-118017065 CTGGGTAGCTGGGGGGTGTCGGG - Intronic
1103602086 12:122060629-122060651 GTGTGTTACTGGGGGTGGGGTGG + Exonic
1103911140 12:124353108-124353130 GTGTGTAACTGGGAGGTTCGAGG + Intronic
1103921817 12:124403169-124403191 CTGTAAAACGGGGAGGTGGGGGG + Intronic
1104037476 12:125107522-125107544 CGGTGTGCCTTGGGGGTGGGGGG + Intronic
1104346273 12:128002054-128002076 CTGTGGAAATGAGGGATGGGAGG + Intergenic
1104801104 12:131555847-131555869 GTGTGTATGTGGGGGGGGGGTGG - Intergenic
1105281297 13:18964143-18964165 ATGTGGAACACGGGGGTGGGGGG + Intergenic
1105473600 13:20712851-20712873 CTGTGGAATTTGGGGATGGGAGG + Intronic
1106004531 13:25756458-25756480 CTGAGCAACTGGGCCGTGGGTGG - Intronic
1106063697 13:26322499-26322521 ATGTGTAATTGGGGGTGGGGTGG + Intronic
1108800068 13:54084095-54084117 CTGTGTGACTGGCAGGTGGTCGG - Intergenic
1109358001 13:61257438-61257460 CTGTGTATGTGGGAGGGGGGTGG - Intergenic
1110677503 13:78266846-78266868 CTGTGGAACAGGGGGCTAGGTGG + Intergenic
1111968237 13:94882798-94882820 GTGTGTGTTTGGGGGGTGGGGGG - Intergenic
1112791066 13:103002608-103002630 CTGTGTAATTGTGGAGTAGGAGG + Intergenic
1113436641 13:110297209-110297231 CTCTGAAGCTGCGGGGTGGGGGG + Intronic
1113468933 13:110530787-110530809 CTGTGTAGAGGTGGGGTGGGTGG - Intronic
1113683439 13:112261165-112261187 CTCTGCACCTGGGGGCTGGGTGG - Intergenic
1113683456 13:112261229-112261251 CTCTGCACCTGGGGGCTGGGTGG - Intergenic
1114984014 14:28203285-28203307 GGGTGTGACAGGGGGGTGGGGGG + Intergenic
1115183709 14:30659573-30659595 CAATGTATCTGGTGGGTGGGAGG + Intronic
1115566386 14:34629051-34629073 GTGTGTATGTGGGGGGTGAGTGG + Intronic
1115755632 14:36524344-36524366 GAGTGTAACTGGGCGCTGGGGGG + Intergenic
1117503363 14:56376053-56376075 CTGTGAAAGAAGGGGGTGGGGGG - Intergenic
1117963990 14:61188581-61188603 GTGTGTGTCGGGGGGGTGGGGGG + Intronic
1118292207 14:64537598-64537620 TTGTGTAGTTTGGGGGTGGGGGG - Intronic
1118764234 14:68899425-68899447 GTGTGTGTCTGGGGGGTGTGGGG - Intronic
1118815468 14:69310474-69310496 CTGTTTAACTACAGGGTGGGTGG + Intronic
1119419796 14:74501686-74501708 CTGTGGAACTGTGGGGGTGGGGG + Intronic
1119470950 14:74898812-74898834 CTGTGGAGCTGGGGGAGGGGAGG - Intronic
1120300745 14:82703183-82703205 TTGTGTTTCTGTGGGGTGGGTGG + Intergenic
1121101434 14:91253097-91253119 CGGAGTAGTTGGGGGGTGGGGGG + Intronic
1121328548 14:93035640-93035662 CTGTGACACTGGTGAGTGGGAGG + Intronic
1121530789 14:94651714-94651736 CCCTGTGCCTGGGGGGTGGGGGG + Intergenic
1122358092 14:101136340-101136362 CTGTGCAGGTGGGGGCTGGGAGG - Intergenic
1122542063 14:102504210-102504232 CTGGGCACCTGGTGGGTGGGTGG + Exonic
1122572747 14:102718567-102718589 CTGTATGACTGAGGGTTGGGTGG + Intronic
1122631051 14:103107923-103107945 CTGTGGGGCTGGGGGGTGGAGGG + Intronic
1123114913 14:105890273-105890295 GTGTGCAGATGGGGGGTGGGGGG + Intergenic
1123713344 15:23007609-23007631 CTATGTCACAGGGGGGCGGGAGG + Intronic
1125427322 15:39562265-39562287 TTGAGAATCTGGGGGGTGGGAGG - Intergenic
1127537601 15:59904522-59904544 CTGTGAAATTGGGGGCGGGGCGG + Intergenic
1128028280 15:64458141-64458163 CTGTGGAACAGTGGGGTGGTGGG + Intergenic
1128220312 15:65964227-65964249 CTTTGGAAGTGGGGGGTGGAGGG + Intronic
1128267612 15:66280368-66280390 GTGTGTACCCGGGGGGAGGGGGG - Intergenic
1128707266 15:69845711-69845733 CTGTGTATGTGTGGGGAGGGAGG + Intergenic
1128715967 15:69908255-69908277 ATGAGTGAGTGGGGGGTGGGTGG - Intergenic
1129675405 15:77630577-77630599 CTGTGTGACTGGGAGGGAGGTGG - Intronic
1129999978 15:80037853-80037875 AAATGTAACTGGGGGGAGGGAGG - Intergenic
1130027805 15:80284960-80284982 CTGTTTTATTGGGGGGAGGGGGG + Intergenic
1131026477 15:89146402-89146424 GTATGTATATGGGGGGTGGGAGG + Intronic
1131493100 15:92880066-92880088 CAGTGTGACTTGGGGGTGGGAGG + Intergenic
1131678877 15:94700961-94700983 CTGTGTCAATAGAGGGTGGGTGG + Intergenic
1131757729 15:95583843-95583865 CTTTGAAACTGGGGGGAGAGGGG + Intergenic
1132045178 15:98557625-98557647 GTGTGTAATGGCGGGGTGGGGGG + Intergenic
1132546575 16:536006-536028 CTGAATAACCGGGGGGGGGGGGG - Intronic
1132561499 16:596658-596680 CTGTGGAACTGGCGGGTGTCAGG + Intronic
1132879653 16:2156405-2156427 CTGTCTAGATGGGGGATGGGGGG - Intronic
1133234733 16:4382559-4382581 CTGGGTGACTGGGGCGTGGTTGG - Exonic
1133314250 16:4872448-4872470 TTGTGTGTGTGGGGGGTGGGTGG + Intronic
1133641041 16:7717586-7717608 GTGTGAAGATGGGGGGTGGGGGG + Intergenic
1134237725 16:12480679-12480701 TTGTGTAACTGGGGGGCTTGAGG - Intronic
1134572560 16:15303846-15303868 CGGAGGAAGTGGGGGGTGGGGGG - Intergenic
1134729822 16:16452176-16452198 CGGAGGAAGTGGGGGGTGGGGGG + Intergenic
1134937609 16:18259720-18259742 CGGAGGAAGTGGGGGGTGGGGGG - Intergenic
1135763574 16:25157370-25157392 TTGTATAGATGGGGGGTGGGCGG - Intronic
1135944945 16:26857516-26857538 CTGCCAGACTGGGGGGTGGGCGG - Intergenic
1135964535 16:27024866-27024888 CTGTGTGTGTGGGGGGGGGGGGG - Intergenic
1136222438 16:28836866-28836888 CTGGGGAACGGGGGGATGGGGGG - Exonic
1137789746 16:51165132-51165154 CTGTAAAAGTTGGGGGTGGGGGG - Intergenic
1137932552 16:52602857-52602879 GTGTGTATATGTGGGGTGGGGGG - Intergenic
1138234929 16:55374093-55374115 GTGTGTAAGTGTCGGGTGGGAGG - Intergenic
1138456340 16:57123184-57123206 CTGTGTATCTGTGGGGTGTGGGG + Intronic
1138595704 16:58027861-58027883 CTGTGTGAATGGGGTGGGGGAGG - Intronic
1138810624 16:60145607-60145629 ATGTTTAACTGGGGGCTGGGGGG + Intergenic
1139570141 16:67806554-67806576 TTGTGTCACTGGGGGCGGGGAGG + Exonic
1141118845 16:81335135-81335157 CTGTGTGACTATGGGGTGGGGGG + Intronic
1141162796 16:81640287-81640309 CTGGGGAATTGGGGGGGGGGGGG - Intronic
1141266156 16:82499168-82499190 GTGTGTGTCGGGGGGGTGGGGGG - Intergenic
1141616138 16:85210682-85210704 CTGTGTAAGTTGAGGCTGGGAGG + Intergenic
1142142705 16:88479699-88479721 CTGGGTAGCAGGTGGGTGGGGGG - Intronic
1142399506 16:89852016-89852038 CAGGGGATCTGGGGGGTGGGGGG - Intronic
1203141176 16_KI270728v1_random:1767805-1767827 CTGTGTTACTGGTGGGAGGAGGG + Intergenic
1142690875 17:1605554-1605576 CTGGGGAGCTGGGTGGTGGGTGG + Intronic
1142690885 17:1605580-1605602 CTGCGGAGCTGGGAGGTGGGTGG + Intronic
1142690897 17:1605606-1605628 CTGGGGAGCTGGGTGGTGGGTGG + Intronic
1143060426 17:4196033-4196055 CTGTGTGGGTGGGGGGTGGTGGG - Intronic
1143250119 17:5517352-5517374 CTGTGTATGTGGGAGGGGGGGGG - Intronic
1143482581 17:7236191-7236213 CTGTATCACTGGGGGGTGCCTGG + Exonic
1143576723 17:7798142-7798164 CCGTGTGACTGGGGGTGGGGTGG - Exonic
1143841680 17:9737220-9737242 GTGTGTGTGTGGGGGGTGGGGGG + Intergenic
1145864208 17:28229525-28229547 CTGTGTGGGTGGGGAGTGGGAGG + Intergenic
1145924938 17:28639787-28639809 CAGTGTAACTGGGGAGTGGAAGG - Intronic
1146128383 17:30248284-30248306 CTGTGGAACTGGGGATTGGGTGG - Exonic
1146572898 17:33968272-33968294 CTTTGGAATTGGGGGTTGGGGGG - Intronic
1147170653 17:38616956-38616978 CTGTGTGGCTGGGGTGTTGGTGG - Intergenic
1148051710 17:44772842-44772864 CGGCGGACCTGGGGGGTGGGTGG - Exonic
1148744060 17:49908657-49908679 CTGTGGGAATGGGGAGTGGGCGG + Intergenic
1149524101 17:57340644-57340666 CTGTGGTTCTGGGGGATGGGAGG + Intronic
1149547042 17:57511388-57511410 CTGGGTAAGTGTGGGGTGGGTGG - Intronic
1150422919 17:65055519-65055541 CTAAGTAACTGGGGGCTGGCAGG - Intronic
1151293492 17:73166434-73166456 CTATGTAAAAGGGGGGCGGGGGG + Intronic
1151408672 17:73906423-73906445 CTGTGTAACTAGAGGGGGGCAGG - Intergenic
1152197529 17:78925950-78925972 CAGTTTAGTTGGGGGGTGGGGGG + Intergenic
1152231179 17:79114812-79114834 CTGGGGCTCTGGGGGGTGGGTGG + Intronic
1152778995 17:82218213-82218235 CTCAGTCACTGGGGGGTGGACGG + Intergenic
1153980896 18:10309535-10309557 CTGTGTAATTGAGGGGAGGAGGG + Intergenic
1154297303 18:13162190-13162212 CTGGCTGTCTGGGGGGTGGGAGG - Intergenic
1156856655 18:41790308-41790330 CTGTGTTAGTGGTGGCTGGGAGG + Intergenic
1157804524 18:50648323-50648345 CTGTGTGGCTGTGGTGTGGGGGG + Intronic
1158581675 18:58689670-58689692 ATAGATAACTGGGGGGTGGGAGG + Intronic
1159028557 18:63208582-63208604 TGGTGTATCTGGGGGCTGGGGGG + Intronic
1159821000 18:73143329-73143351 CTTTGCTACTGTGGGGTGGGGGG + Intergenic
1160745721 19:709902-709924 CTGTGTGTGTGGGGGGGGGGTGG + Intronic
1160953190 19:1677285-1677307 CTGAGGATCTGGGGGGTGGAGGG + Intergenic
1161218235 19:3105383-3105405 CTGTGGATTTGGGGGGTTGGGGG + Intronic
1161407968 19:4101074-4101096 CTGTGTGACTTCGGGGTGAGCGG - Exonic
1162063429 19:8110713-8110735 CAGTCTTGCTGGGGGGTGGGGGG - Intronic
1162926044 19:13930938-13930960 CAGGGGAACCGGGGGGTGGGTGG - Intergenic
1163184127 19:15624364-15624386 CTTTGTAAATTGGGGGTGTGGGG + Intronic
1163258645 19:16173260-16173282 CTGTGTGAGTGTGGGGTGGAGGG - Intronic
1163598818 19:18235774-18235796 CAGTGTGGCTGGAGGGTGGGAGG - Intronic
1163811219 19:19432996-19433018 CTGAGTGACTGGGTGGTGGGTGG + Intronic
1164458206 19:28426737-28426759 CTGTGGTGGTGGGGGGTGGGGGG - Intergenic
1164902364 19:31938921-31938943 CTGTGGGATTGGGGGGTTGGGGG + Intergenic
1166852153 19:45766181-45766203 CTGTGCAGCTGGAGGGCGGGCGG + Intronic
1167288843 19:48613761-48613783 CTGTGTGACTGGTGGGTTGGAGG - Intronic
1167642012 19:50687233-50687255 CTCTGTTATTGGGGGTTGGGGGG + Intronic
1168058190 19:53875224-53875246 GTGTGTGTTTGGGGGGTGGGGGG + Exonic
1168251952 19:55146637-55146659 GTCTGGAGCTGGGGGGTGGGGGG - Intronic
1168472330 19:56649734-56649756 CAGTGTGGCTGGAGGGTGGGAGG + Intronic
1168589931 19:57624812-57624834 CTGTGTTGCTGGGGGGTTCGGGG - Intergenic
924997234 2:373312-373334 CTGTGTAACTGGATGGGGGTTGG + Intergenic
925155000 2:1642212-1642234 GTGTGTACCTGTGGGGTGTGTGG - Intronic
925195435 2:1920239-1920261 CTGTATAAATGGGGGTTGGGTGG - Intronic
927081568 2:19635834-19635856 CTCTGCACCTGGGGGATGGGTGG - Intergenic
927391461 2:22600133-22600155 CTGTGGAACTAGGAGGTGGAGGG + Intergenic
927507913 2:23626648-23626670 CTCAGTAAGTGTGGGGTGGGAGG + Intronic
927868112 2:26605996-26606018 CTGAGTAACTGCGGGCTGGCAGG - Intronic
927904834 2:26848696-26848718 GTGTGTATCTGGGTGGTGTGTGG - Intronic
928314536 2:30235298-30235320 TTGTTAAACTGGGGGGAGGGAGG + Intronic
929305457 2:40356139-40356161 CTGTTTAACTGGGGGTGGGTAGG - Intronic
929437665 2:41940701-41940723 CTGGGGCAGTGGGGGGTGGGGGG - Intronic
930027563 2:47038646-47038668 CTGTGTGTCGGGGGGGTGGGTGG - Intronic
931117910 2:59184403-59184425 CTGAGTCACTCTGGGGTGGGAGG + Intergenic
931748049 2:65307946-65307968 CTGTGTGAATGGGGGGGGCGGGG - Intergenic
932617659 2:73244963-73244985 CTGTGTCAGTGGGTGGTGGAGGG + Intronic
932807048 2:74793295-74793317 CTGTCTAACAGGAGGGTGGGTGG + Intergenic
933775791 2:85770434-85770456 CTGGGGAAAAGGGGGGTGGGTGG + Intronic
935182717 2:100704886-100704908 CAGTGTAGCTGTGGGTTGGGGGG + Intergenic
935335559 2:102012491-102012513 CAGGGTATGTGGGGGGTGGGAGG + Intronic
935433600 2:103004283-103004305 ATGTGTGACTGGGGGCAGGGTGG + Intergenic
935634405 2:105238608-105238630 TGGTGTAGCTTGGGGGTGGGAGG + Intergenic
935821291 2:106895502-106895524 CTGAGTGACCAGGGGGTGGGTGG - Intergenic
935969780 2:108519518-108519540 AAGGGAAACTGGGGGGTGGGAGG + Intergenic
936065135 2:109325526-109325548 CTGTGTCACTGGGGGAAGCGGGG - Intronic
936083874 2:109453295-109453317 CTGTGTAACTTGTGGGTGTTGGG - Intronic
936225835 2:110650187-110650209 ATGTGTAACAAGGGGGTGGGCGG + Intronic
936233927 2:110726716-110726738 TTGTGGAGATGGGGGGTGGGGGG + Intergenic
936865582 2:117072847-117072869 CTGTCCTCCTGGGGGGTGGGGGG - Intergenic
938739196 2:134214894-134214916 CTGTGTATCTGGTGGTTAGGTGG - Intronic
939538179 2:143459324-143459346 CTGGTTAAATGGGGGGTGGGGGG + Intronic
939979465 2:148761336-148761358 CTCTGTAACTGGGGGCTGGATGG - Intronic
940507653 2:154577066-154577088 CTGTGTGACTGGTGAGTGAGTGG - Intergenic
940626041 2:156176385-156176407 CAGAATAACTGAGGGGTGGGGGG - Intergenic
941185189 2:162313965-162313987 CTGTGTAAATGGAAGGTGTGTGG + Intronic
942169210 2:173273506-173273528 CTGGGAAGCTGGGGGTTGGGTGG - Intergenic
942307735 2:174625148-174625170 CTGTGCAACTGAGGGTTGAGTGG + Intronic
942413812 2:175737677-175737699 GTGTGGATGTGGGGGGTGGGGGG - Intergenic
944605542 2:201348625-201348647 GTGTGTAAGGGGGTGGTGGGGGG - Intronic
945999701 2:216471114-216471136 CTAAATAATTGGGGGGTGGGAGG + Intronic
946024883 2:216665729-216665751 CAGTATAACTCAGGGGTGGGTGG - Intergenic
946054701 2:216890573-216890595 CTGTATAACTAGGGGTTAGGTGG + Intergenic
946325453 2:218982516-218982538 TTGTGGAACTTGGGGGTTGGGGG + Intronic
946894696 2:224311444-224311466 GTGTGTAGCTGGGGTGTGGCTGG - Intergenic
947510725 2:230752031-230752053 GTGTGTATGTGGGGGGGGGGGGG - Intronic
947731305 2:232433065-232433087 CTCTGTCCCTGGGGGGTGGCCGG + Intergenic
948101042 2:235373546-235373568 GTGGGGAGCTGGGGGGTGGGGGG - Intergenic
948268730 2:236657481-236657503 CAGGGAAACTGGGGGCTGGGGGG + Intergenic
948682307 2:239643676-239643698 GTGTGTATCTGTGGGGTGTGTGG + Intergenic
948861038 2:240752696-240752718 CTGGGAAAATGTGGGGTGGGTGG - Intronic
1168992899 20:2109845-2109867 CTATGTAATTGGGGGATTGGGGG + Intronic
1169978234 20:11354451-11354473 GTGTGTAGCTGGGGGATGGCTGG - Intergenic
1170549397 20:17463659-17463681 GTGTGTGTGTGGGGGGTGGGGGG - Intronic
1172102006 20:32490338-32490360 CTGGGGGACTGGGGGGTGAGAGG + Intronic
1172450303 20:35017974-35017996 CTGCTTAACTGGGGGTGGGGAGG + Intronic
1172883573 20:38217093-38217115 CTGTGCAAGTGGGTGGGGGGGGG + Intronic
1172906137 20:38370871-38370893 CTCTGTAGCTGGTGGGAGGGGGG + Intronic
1173675931 20:44835775-44835797 GTGTGTATGTGGGGGGTGGGGGG - Intergenic
1173729613 20:45319135-45319157 CTGGGTGACTGGGTGGTGTGGGG - Intergenic
1173881015 20:46412332-46412354 CTGGGACCCTGGGGGGTGGGAGG - Intronic
1174822378 20:53737887-53737909 ATCTGAAACTGGGGGGTGGGGGG - Intergenic
1175118697 20:56702231-56702253 CTTTAGAAGTGGGGGGTGGGGGG - Intergenic
1175691897 20:61071521-61071543 CTGAGTAAGTGGAGGGTGAGAGG + Intergenic
1175726504 20:61322248-61322270 CTGTGTATGTGGGGAGTTGGAGG - Intronic
1175948734 20:62571394-62571416 CTGTGTGATTGTGTGGTGGGGGG - Intergenic
1175950432 20:62580691-62580713 CTGTGGAGCAGGGAGGTGGGAGG + Intergenic
1176185110 20:63774060-63774082 CTGAAAAACTGGGGGGGGGGGGG - Intronic
1176348759 21:5773486-5773508 CTGTGTTACTCCCGGGTGGGCGG - Intergenic
1176355573 21:5894070-5894092 CTGTGTTACTCCCGGGTGGGCGG - Intergenic
1176496068 21:7550969-7550991 CTGTGTTACTCCCGGGTGGGCGG + Intergenic
1176543080 21:8171556-8171578 CTGTGTTACTCCCGGGTGGGCGG - Intergenic
1176562031 21:8354601-8354623 CTGTGTTACTCCCGGGTGGGCGG - Intergenic
1176591264 21:8652389-8652411 CTGTGCGGCTGTGGGGTGGGGGG + Intergenic
1179114122 21:38474449-38474471 CTGTGTCACCCAGGGGTGGGAGG - Intronic
1179236696 21:39553822-39553844 CTGTTTAAGTGGGAGGTGGTTGG + Intergenic
1179518815 21:41928688-41928710 CTGCGGGATTGGGGGGTGGGGGG - Intronic
1179572354 21:42285119-42285141 CTGTTAAAATGGGGGGAGGGGGG + Intronic
1180274112 22:10629500-10629522 CTGTGCGGCTGTGGGGTGGGGGG + Intergenic
1180999414 22:19981142-19981164 CTCTGTAGTTGGGGGGTGGAGGG + Intronic
1181068169 22:20316357-20316379 CTGGGTGACAGTGGGGTGGGAGG - Intronic
1181861557 22:25823212-25823234 CTGTGAAATTGGGGGATGGTTGG - Intronic
1182144788 22:27990719-27990741 CAGGGGAACTCGGGGGTGGGTGG + Intronic
1182472743 22:30558565-30558587 CTGTACCACTGTGGGGTGGGTGG - Intronic
1182941564 22:34282133-34282155 TTGTGTAACTGGGTGGAGGGTGG - Intergenic
1183328808 22:37208491-37208513 CTGTGAACCTGGGGGGCAGGTGG + Intronic
1183330255 22:37216190-37216212 CTGTGGGATGGGGGGGTGGGAGG - Intergenic
1183548643 22:38468616-38468638 GGGTGTAACTGGTGGGAGGGAGG - Intronic
1184116131 22:42423406-42423428 CTCTGTTACTGGGAGGTGGTAGG - Intronic
1184203909 22:42988323-42988345 ATGTGTGAGTGAGGGGTGGGGGG + Intronic
1184887556 22:47355575-47355597 GCATGTCACTGGGGGGTGGGGGG + Intergenic
1185276044 22:49950548-49950570 CTGTGTTATAGGGGGGTGGGGGG + Intergenic
1185346814 22:50314014-50314036 CTCGGTGTCTGGGGGGTGGGTGG - Intronic
949357810 3:3200391-3200413 CTGCAAAACTGGGGGCTGGGGGG + Intergenic
950568614 3:13786417-13786439 CTGGGCATCTGGGGTGTGGGTGG + Intergenic
950655428 3:14433428-14433450 CTGAGAACCTGCGGGGTGGGTGG - Intronic
952093583 3:29921486-29921508 CTGTTTGGCAGGGGGGTGGGGGG + Intronic
952196421 3:31080336-31080358 ATATGTAAGTGGGAGGTGGGTGG - Intergenic
953385747 3:42504747-42504769 CGGTGTGACGGCGGGGTGGGGGG + Intronic
953532308 3:43749635-43749657 CTCTGTAAATGGTGGGGGGGGGG - Intergenic
954109921 3:48428281-48428303 CTGTGTAAGTTGGGGATGTGAGG - Intronic
955221417 3:57026424-57026446 CTGTGCAAGCGTGGGGTGGGAGG - Intronic
957079958 3:75628903-75628925 CTGTGTCAGTGTGGGGTGGTGGG + Intergenic
961665736 3:128492400-128492422 CTGTGTGACTGGGGTGCGTGTGG - Intronic
961768404 3:129229933-129229955 CTTTTTAACTGGTGTGTGGGGGG - Intergenic
962317577 3:134368374-134368396 CTGGGTGAGTGGGGGGTGGGGGG - Intronic
962806238 3:138929586-138929608 CTTCGTAGGTGGGGGGTGGGAGG - Intergenic
964809474 3:160647909-160647931 CTGAGTAACTAGGGGATGGTGGG - Intergenic
965160730 3:165129749-165129771 CTTTGTAACCTGGGGTTGGGAGG + Intergenic
966355517 3:179074465-179074487 GTGTGTGGCTGGTGGGTGGGTGG - Intergenic
966810998 3:183844430-183844452 CTGTATACCTGGGGGATAGGGGG + Intronic
966880116 3:184345316-184345338 CTGTGTGAGGGTGGGGTGGGAGG + Intronic
966890855 3:184406512-184406534 CTGTGTGAGTGGGGTGCGGGGGG + Intronic
967307665 3:188074817-188074839 CTGGGCAACGGCGGGGTGGGGGG + Intergenic
967333600 3:188317974-188317996 CTGTGTATCTGGAGTGTGGGAGG + Intronic
967921713 3:194619059-194619081 CTCTGTAACATGGTGGTGGGTGG - Intronic
968086771 3:195877376-195877398 CTGTGCCTCTTGGGGGTGGGTGG - Intronic
968578537 4:1379058-1379080 CTGTGGACCTGGGGTGAGGGCGG + Intronic
969232787 4:5843222-5843244 CTGTCTAACCAGGGGGTTGGAGG - Intronic
969327437 4:6452077-6452099 CTGTGTAAGTGTGGGGAGGTTGG + Intronic
969832169 4:9806664-9806686 CTGTGTGCATGGGGGGTGGGAGG + Intronic
970038176 4:11763781-11763803 GTGTGGAGGTGGGGGGTGGGGGG + Intergenic
970579741 4:17464408-17464430 CTGAGTGACTAGTGGGTGGGTGG - Intronic
970897302 4:21118646-21118668 CAGTGCAAGTGGGTGGTGGGGGG + Intronic
972254146 4:37335280-37335302 CCCTCTGACTGGGGGGTGGGCGG + Intronic
972595664 4:40527754-40527776 GTGTGTGTTTGGGGGGTGGGGGG + Intronic
974372983 4:61041836-61041858 CTGTGGAAGTGGGGGCTGGTAGG - Intergenic
974985718 4:69024085-69024107 CTGAATATCGGGGGGGTGGGGGG - Intronic
975102566 4:70531194-70531216 CTGTGCCACTGGGAGTTGGGAGG - Exonic
975409750 4:74036890-74036912 GTGGGGAACTGGAGGGTGGGGGG - Exonic
977304885 4:95310791-95310813 TTGTGTAACTGGGTTGGGGGGGG + Intronic
979609413 4:122673489-122673511 CTGTGTACTTGGAGGATGGGTGG - Intergenic
981874948 4:149530801-149530823 GTGTGTATGTGGGGGGGGGGTGG - Intergenic
982070021 4:151686657-151686679 CCAGGAAACTGGGGGGTGGGGGG - Intronic
982316893 4:154041180-154041202 CTGTGAAAATGGGTGGTGTGTGG - Intergenic
983530546 4:168805680-168805702 CTCTGTAACAGGGGAGTCGGGGG - Intronic
984776354 4:183484300-183484322 CTGTGTAACCAGGCTGTGGGAGG + Intergenic
985109816 4:186537245-186537267 ATGTGTGCCTGGGGGGTGTGTGG + Intronic
985668787 5:1195874-1195896 CTGTGTCCCCAGGGGGTGGGAGG - Intergenic
985668805 5:1195966-1195988 CTGCGTGCCTGGGAGGTGGGAGG - Intergenic
985668848 5:1196146-1196168 CTGCGTGCCTGGGAGGTGGGAGG - Intergenic
985705596 5:1399877-1399899 CTGCGTGCCTGGGAGGTGGGTGG - Intronic
988313564 5:29593881-29593903 AAATGTTACTGGGGGGTGGGGGG + Intergenic
990309495 5:54524388-54524410 CTGAGTTACTGGGAGGAGGGTGG - Intronic
990923572 5:60994292-60994314 CTCTGTAACTGTGGCTTGGGTGG + Intronic
993828351 5:92721961-92721983 GTGTGTGTGTGGGGGGTGGGGGG - Intergenic
993881080 5:93361757-93361779 CTCTGGAGCTGTGGGGTGGGTGG - Intergenic
994720658 5:103376192-103376214 CTGTTTGACTGGGGGATGGGGGG + Intergenic
995632045 5:114144798-114144820 CTCTGTGAATGTGGGGTGGGGGG + Intergenic
996106519 5:119510936-119510958 CTCTGTAAGTGGGGGCTGGATGG - Intronic
996168925 5:120264378-120264400 GTGTGTTCCTGGGGGATGGGAGG + Intergenic
996832411 5:127754525-127754547 CTGTGTGTGTGTGGGGTGGGGGG - Intergenic
996869080 5:128165921-128165943 ATTTTTAACTGGGGGGGGGGGGG - Intronic
997655775 5:135553214-135553236 CTGAGTCACTAGGAGGTGGGTGG + Intergenic
998406131 5:141875888-141875910 CTGTGTTTGTAGGGGGTGGGGGG - Intronic
998988681 5:147791016-147791038 CAGTGACACTGGGGGGTGTGAGG + Intergenic
1000123730 5:158223331-158223353 CAGTGTAACTTGGAGGTGAGAGG - Intergenic
1001180941 5:169520133-169520155 CCGTCTAAGTGGGGGGGGGGTGG - Intergenic
1001315402 5:170638023-170638045 GGGTGTGTCTGGGGGGTGGGGGG + Intronic
1002849825 6:983692-983714 CTGGGCTATTGGGGGGTGGGGGG + Intergenic
1003173577 6:3738533-3738555 CTGTGTCACTGGGGGTGGGCTGG - Intronic
1003426115 6:5999404-5999426 CTGTCTAAAGCGGGGGTGGGGGG + Intronic
1003875004 6:10427192-10427214 CTGTGTTATTGGGGGTGGGGGGG - Intergenic
1004468305 6:15906144-15906166 CTGAGTATATGGGGGATGGGGGG - Intergenic
1006177036 6:32128658-32128680 CTGTGAGATTTGGGGGTGGGGGG - Intergenic
1006444535 6:34071906-34071928 CTGTGTATCTGTGTGGTGTGTGG - Intronic
1006611366 6:35296332-35296354 CTGTGTGATTTGGGGGTGGCTGG - Intergenic
1006795844 6:36731915-36731937 GGGTGCAGCTGGGGGGTGGGAGG - Intronic
1007234480 6:40380382-40380404 CTGTGCATCTGGGAGGTGGTAGG + Intergenic
1007897529 6:45377929-45377951 CTGTGTGACGGGGCGATGGGGGG + Exonic
1008786370 6:55174150-55174172 CTGTTTTTTTGGGGGGTGGGGGG - Intronic
1009231714 6:61071009-61071031 CTTTGTAACTGGGTAGTGGGCGG + Intergenic
1009951570 6:70402936-70402958 CTGTGTGTGGGGGGGGTGGGGGG - Intergenic
1010717231 6:79243701-79243723 ATGTGTGAGTGGGAGGTGGGAGG + Intergenic
1011017035 6:82768236-82768258 GTGGGAAAATGGGGGGTGGGGGG + Intergenic
1012546083 6:100420951-100420973 CTGTGTCTCTGCAGGGTGGGAGG + Exonic
1013402837 6:109815498-109815520 CTCATTAACGGGGGGGTGGGGGG - Intronic
1014189268 6:118474370-118474392 CTGTCTAACTAGGGTCTGGGAGG - Intronic
1014797153 6:125738672-125738694 CTGATAAACTTGGGGGTGGGGGG + Intergenic
1015429151 6:133110066-133110088 GTGGGGAAGTGGGGGGTGGGGGG + Intergenic
1017415828 6:154219573-154219595 CTGTGTAAGTGGGATGTGGAAGG - Intronic
1017993498 6:159510404-159510426 CTGACCTACTGGGGGGTGGGGGG + Intergenic
1018194329 6:161341821-161341843 CTGTGAGACTCGGGGGTGGCAGG - Intergenic
1018620834 6:165728053-165728075 GTGTGTATGTTGGGGGTGGGTGG - Intronic
1018676824 6:166229476-166229498 CTGTGTGGGTGGGGGGAGGGAGG + Intergenic
1018840612 6:167514123-167514145 CAGTGTGACTGGGGGGTGGGGGG + Intergenic
1019571985 7:1717215-1717237 CTGTGATACTGGAGTGTGGGTGG - Intronic
1019681431 7:2352322-2352344 ATGTGAAACTGGGGGTCGGGGGG - Intronic
1019707827 7:2504920-2504942 CTGTGGAGCCGGGGGGGGGGGGG - Intergenic
1019739631 7:2666168-2666190 CTGTGTATGTGGGCGGGGGGGGG + Intergenic
1020073127 7:5240448-5240470 CTGTGTCCTTGGGGGCTGGGCGG + Intergenic
1020094674 7:5361746-5361768 CTGTGACGCTGGGGGGCGGGCGG + Intronic
1021303110 7:18996831-18996853 GTGTGTGGCTGGGAGGTGGGGGG - Intronic
1022298223 7:29077566-29077588 CTGTGTAGCTGGGGAGAGTGGGG - Intronic
1022755898 7:33289231-33289253 GTGTGGAACTGAGGGGTGGAAGG + Intronic
1023012716 7:35938058-35938080 CTGTATATCTGGGGGCTTGGGGG + Intergenic
1024078414 7:45835789-45835811 CTGTATATCTGGGGGCTTGGGGG - Intergenic
1024802903 7:53101415-53101437 CCGTGTATATGGGGGGCGGGGGG + Intergenic
1025869884 7:65421831-65421853 CTGTGTCACTCCAGGGTGGGTGG - Intergenic
1026808180 7:73441000-73441022 CAGTGTCGGTGGGGGGTGGGAGG - Exonic
1029620450 7:101687098-101687120 CTGTGTGACTAGGGGGTTGGAGG - Intergenic
1030064433 7:105648600-105648622 CTGTGTGTATGGGAGGTGGGGGG - Intronic
1032117190 7:129127142-129127164 CTGTGTGACTTCGGGGTGAGCGG + Intergenic
1032156091 7:129469499-129469521 CTTTGTCAGTGGGAGGTGGGTGG + Intronic
1032703067 7:134398936-134398958 CTTGGTGGCTGGGGGGTGGGGGG - Intergenic
1032774349 7:135095168-135095190 CTGTCTCACTGGAGGGTTGGAGG + Intronic
1032824779 7:135558252-135558274 CAGTGAAACTTGGGGGTGAGGGG - Intronic
1033422781 7:141218077-141218099 CTGTGTGTCTGCGGGGTTGGGGG - Intronic
1034030898 7:147762714-147762736 ATGTATAAGTGGGGGGAGGGAGG + Intronic
1036040695 8:5077090-5077112 CTGTGTGTGGGGGGGGTGGGGGG - Intergenic
1036662073 8:10715179-10715201 CTGTGTCAGTGGGGCTTGGGAGG + Intergenic
1037041651 8:14243806-14243828 CTGAGGAACTGAAGGGTGGGAGG - Intronic
1037436954 8:18872861-18872883 GTGTGTTACAGGGTGGTGGGAGG - Intronic
1037816678 8:22116235-22116257 CTGTGGCACAGGGAGGTGGGAGG + Intronic
1038389613 8:27183211-27183233 ATGATTAATTGGGGGGTGGGTGG + Intergenic
1038609096 8:29042855-29042877 TTTTGTAACTGATGGGTGGGGGG + Intronic
1039839927 8:41286007-41286029 CTATGGAACTGGGCGGGGGGAGG + Intronic
1040792707 8:51251843-51251865 CTGTGTGTCTGTGTGGTGGGGGG + Intergenic
1041983359 8:63890101-63890123 CTGGGTAACTGGGGGATGAAAGG + Intergenic
1042041366 8:64594101-64594123 GTGTGTATGTGGGGGGTGGGTGG + Intronic
1042317352 8:67437912-67437934 CTTTTTTTCTGGGGGGTGGGGGG + Intronic
1042939127 8:74089739-74089761 ATGGATAAATGGGGGGTGGGGGG + Intergenic
1044238251 8:89856656-89856678 CTATGTCACTGGGGGGTGGGGGG - Intergenic
1047012452 8:120686581-120686603 ATGTGAATTTGGGGGGTGGGGGG + Intronic
1047929631 8:129713758-129713780 CTGTGTAACTAAGGAGTGAGCGG + Intergenic
1047987990 8:130256392-130256414 CAGAGGATCTGGGGGGTGGGGGG + Intronic
1049406966 8:142455896-142455918 CTCTGTGACAGGAGGGTGGGTGG + Intronic
1049708682 8:144054146-144054168 CTGAGTCACTGGGTGGTGGGTGG - Intronic
1049775004 8:144400078-144400100 CTGGGTGCCTGTGGGGTGGGTGG + Exonic
1049790257 8:144469203-144469225 CTGCGGAGGTGGGGGGTGGGAGG - Intronic
1049806931 8:144545302-144545324 GAGTGGAACTTGGGGGTGGGCGG + Exonic
1049860752 8:144896890-144896912 CTTTGTAACCAGTGGGTGGGAGG - Intronic
1050174404 9:2854847-2854869 AGGTGGAAGTGGGGGGTGGGAGG + Intergenic
1050483869 9:6114191-6114213 AACTGTGACTGGGGGGTGGGGGG - Intergenic
1052840751 9:33289474-33289496 GTGTGGGTCTGGGGGGTGGGGGG + Intergenic
1052997804 9:34560341-34560363 TTGTGTAACTGTAGGATGGGAGG + Intronic
1053360489 9:37483112-37483134 CTGTGTAACTGGGATGGGGCAGG - Intergenic
1054161081 9:61672360-61672382 CTGGGACCCTGGGGGGTGGGGGG + Intergenic
1055986002 9:82056861-82056883 ATGTGTAGGTGGGGGGTGGGGGG - Intergenic
1056177643 9:84051061-84051083 CTCTCAAACTGTGGGGTGGGTGG - Intergenic
1056391263 9:86143725-86143747 CTGTGATTCTGGGGGATGGGTGG + Intergenic
1056585334 9:87924270-87924292 ATGTGTAGGTGGGGGGCGGGGGG + Intergenic
1056611547 9:88128670-88128692 ATGTGTAGGTGGGGGGCGGGGGG - Intergenic
1056640499 9:88365967-88365989 CTGTGGAAGTGTGAGGTGGGTGG - Intergenic
1058099734 9:100905686-100905708 CTGTGTGTGTGGGGGGGGGGGGG + Intergenic
1059305885 9:113352753-113352775 CTGGCTAGCTGGGGGGTTGGGGG + Intronic
1060439575 9:123626345-123626367 CTGTGTGTCTGGGGGGAGAGGGG + Intronic
1060969576 9:127730472-127730494 CTGGGTCGCTGGGGGCTGGGCGG + Intronic
1060977927 9:127776353-127776375 CTGTGCACCTGGGGTGGGGGTGG + Intronic
1061839855 9:133352321-133352343 ATGTGTATATGGCGGGTGGGAGG - Intronic
1062365691 9:136207969-136207991 CTGTGGACCTGGGGGTTGGAAGG - Exonic
1187423891 X:19160211-19160233 CTGTCTGACTGGGGGGTGGTGGG + Intergenic
1189646402 X:43137513-43137535 CTGTTGAAGTTGGGGGTGGGGGG - Intergenic
1189988045 X:46571278-46571300 TTGTTTGTCTGGGGGGTGGGGGG + Intergenic
1190332042 X:49242152-49242174 CTGGGTGTCTGGGGTGTGGGCGG + Intronic
1192196003 X:69028649-69028671 CTAGGTAACTGGGGGAAGGGGGG - Intergenic
1192656664 X:73001101-73001123 CTGAGTCACTGTGGGGTGCGAGG - Intergenic
1192665456 X:73081900-73081922 CTGAGTCACTGTGGGGTGCGAGG + Intergenic
1193384493 X:80854636-80854658 CTGGGTGACTGGGGGCTGAGTGG - Intergenic
1194390604 X:93312947-93312969 CTGAGAAACGGCGGGGTGGGGGG + Intergenic
1195869333 X:109469790-109469812 CTGTGTAAGAGGAAGGTGGGAGG + Intronic
1195995178 X:110724534-110724556 GTGTGTATCTCGGGGGTGGGGGG + Intronic
1197270351 X:124418355-124418377 ATGAATATCTGGGGGGTGGGGGG - Intronic
1197508940 X:127346680-127346702 CTGTGCAGCTTGGGGTTGGGGGG + Intergenic
1198791786 X:140354349-140354371 CTGTGTCTGTGGGGAGTGGGGGG - Intergenic
1199193775 X:145003179-145003201 CTGGGTTACTGGGGGCAGGGTGG - Intergenic
1199435098 X:147804244-147804266 GTGTGTGAGTGAGGGGTGGGTGG + Intergenic
1199864276 X:151828881-151828903 CTGAGTAATTTGTGGGTGGGTGG - Intergenic
1200149990 X:153946678-153946700 CTGTGTCATGTGGGGGTGGGGGG - Intergenic