ID: 1077468077

View in Genome Browser
Species Human (GRCh38)
Location 11:2743166-2743188
Sequence GGGCATTCCCAGAAATCACA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 204
Summary {0: 1, 1: 0, 2: 1, 3: 20, 4: 182}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077468072_1077468077 2 Left 1077468072 11:2743141-2743163 CCAGTTGTCATGTTTGAGAGGGA 0: 1
1: 0
2: 0
3: 5
4: 137
Right 1077468077 11:2743166-2743188 GGGCATTCCCAGAAATCACAGGG 0: 1
1: 0
2: 1
3: 20
4: 182
1077468070_1077468077 3 Left 1077468070 11:2743140-2743162 CCCAGTTGTCATGTTTGAGAGGG 0: 1
1: 0
2: 0
3: 8
4: 141
Right 1077468077 11:2743166-2743188 GGGCATTCCCAGAAATCACAGGG 0: 1
1: 0
2: 1
3: 20
4: 182
1077468068_1077468077 11 Left 1077468068 11:2743132-2743154 CCTGGAGACCCAGTTGTCATGTT 0: 1
1: 0
2: 0
3: 9
4: 166
Right 1077468077 11:2743166-2743188 GGGCATTCCCAGAAATCACAGGG 0: 1
1: 0
2: 1
3: 20
4: 182

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077468077 Original CRISPR GGGCATTCCCAGAAATCACA GGG Intronic
904649696 1:31995588-31995610 TGGCATTCCCAGGAATCAGCTGG + Intergenic
904947948 1:34213129-34213151 TGGGATTCCCAGGAATGACAGGG - Intronic
904966484 1:34378323-34378345 GGGCCTTCCTAGAAGTCACCTGG - Intergenic
904983509 1:34526008-34526030 GAGCATTGCCAGAAATTCCAGGG - Intergenic
905330300 1:37190455-37190477 GGGGATTTCCAGAGATCTCAGGG - Intergenic
905468154 1:38171404-38171426 GGGAATTCCCAGAAACTTCAAGG - Intergenic
909750156 1:79149424-79149446 TGGCATTCCTAGAAATGCCAGGG - Intergenic
910669144 1:89755903-89755925 GGGGAATAACAGAAATCACAGGG - Intronic
912952126 1:114127440-114127462 GGGCAGTCCCAGAAAAGTCAAGG + Intronic
913003906 1:114609246-114609268 GGGAATGCCATGAAATCACAGGG + Intronic
913692707 1:121294346-121294368 GGGTCTTCCCACAATTCACAGGG - Intronic
914144849 1:144985744-144985766 GGGTCTTCCCACAATTCACAGGG + Intronic
915090146 1:153418568-153418590 GTGCTTTCCCAGTAATCTCAGGG - Intronic
915095347 1:153458525-153458547 GTGCTTTCCCAGTAATCTCAGGG + Intronic
915364802 1:155309132-155309154 GGGGATTCCAGGAAAGCACAAGG - Intronic
920179185 1:204122137-204122159 GAGCATACCCAGAACACACAAGG - Intronic
920480028 1:206312707-206312729 GGGTCTTCCCACAATTCACAGGG - Intronic
920547231 1:206828405-206828427 GGGCATGCCCAGAAAGCAGGAGG - Intronic
922960520 1:229642113-229642135 AGACATTCGCACAAATCACAGGG + Intronic
1062844864 10:696137-696159 GCGGGTCCCCAGAAATCACAAGG - Intergenic
1069682841 10:70297535-70297557 GGGCATTTCCAGAACTCATATGG - Intergenic
1070402428 10:76065386-76065408 GGGCATTCCCAGGAGTCCTAGGG + Intronic
1070715194 10:78715317-78715339 GCGCATTCCCAGAAGACCCAAGG + Intergenic
1073478314 10:103768893-103768915 GGGCATGTGCAGAGATCACAGGG + Intronic
1073640282 10:105245610-105245632 GGGCATTCCCAGCAGCCACCTGG - Exonic
1074489628 10:113927592-113927614 GGATTTTCCCAGAAATCTCAGGG + Intergenic
1075174473 10:120146430-120146452 AGGCACACCCAGAAACCACAGGG + Intergenic
1076365916 10:129921026-129921048 GGTCCTGCCCAGAGATCACAAGG - Intronic
1076616527 10:131758901-131758923 GGGCATGAAAAGAAATCACAAGG + Intergenic
1076829425 10:132986572-132986594 GCACATTCCCAGGAAACACAGGG + Intergenic
1077468077 11:2743166-2743188 GGGCATTCCCAGAAATCACAGGG + Intronic
1083332832 11:61906956-61906978 GGGCGGTCCCAGAACTCTCATGG - Intronic
1083341699 11:61962423-61962445 GGGCCTGCCCAAAAACCACAAGG + Exonic
1083894150 11:65611788-65611810 GGGGATTCCCCGAAGGCACAGGG - Intronic
1084098426 11:66928843-66928865 GGGCAATTTCAGAAATCAAAAGG + Intronic
1084497971 11:69516307-69516329 AGGCAGTGCAAGAAATCACATGG - Intergenic
1084553420 11:69862523-69862545 CGGCATTCCCAGAGACTACAAGG + Intergenic
1087456400 11:98392570-98392592 GGCCATTCTCAGAAATTAAATGG + Intergenic
1090213360 11:124938738-124938760 GGGAATTCCCAGAAATAACCGGG + Intergenic
1090230571 11:125100191-125100213 GGGCAGTCCCAGAGAGCTCATGG - Intronic
1090885487 11:130872673-130872695 TGGGAGTGCCAGAAATCACAGGG - Intergenic
1091014421 11:132037281-132037303 CGGCATGTGCAGAAATCACAGGG - Intronic
1095982985 12:47983272-47983294 GGACATTCCCAGGCCTCACAGGG + Intronic
1097012201 12:55961239-55961261 GGGCATTCCCTGAGCTCACTGGG + Intronic
1099425911 12:82522623-82522645 GGGAGTTCCCAGAAATTAAAAGG - Intergenic
1100699806 12:97135181-97135203 TGGCATTCACAGAAATCTTAAGG + Intergenic
1101960562 12:109246337-109246359 GGGCATTCCCAAAATTTACGTGG + Exonic
1103676683 12:122661352-122661374 GGGCAGTCCCAGCAACCTCAGGG - Intergenic
1104503660 12:129310273-129310295 GGGCCTCCCCAGAAAACAGAAGG + Intronic
1104617374 12:130281841-130281863 GGCCATCCCCAAGAATCACACGG - Intergenic
1108461275 13:50669877-50669899 TGGCATGTGCAGAAATCACATGG - Intronic
1109440108 13:62358389-62358411 GGGCATTCCAAGAAATTCAAGGG - Intergenic
1110327485 13:74233799-74233821 TGGCATTCCAATAAATAACATGG + Intergenic
1110462408 13:75759739-75759761 GGGGATTCCGGGAAAGCACAAGG - Intronic
1113038171 13:106074350-106074372 GGGGATTCCCAGGAATAACTAGG - Intergenic
1114082263 14:19211220-19211242 GAGCATTCCCAGGATGCACAGGG - Intergenic
1114276893 14:21154827-21154849 GGGCATGCCCAATATTCACAGGG + Intergenic
1116734515 14:48671553-48671575 GTGCATTCCCAGTGATCAGAGGG + Intergenic
1118402306 14:65391201-65391223 GGGGCTACCAAGAAATCACAGGG + Intergenic
1119116212 14:72024155-72024177 GGTCACTACCAGAAATGACAGGG - Intronic
1120179464 14:81328837-81328859 TGGCATGCACAGAAGTCACATGG - Intronic
1120249520 14:82045824-82045846 GGTCACTTCCAGAAATAACAAGG - Intergenic
1120754800 14:88232814-88232836 GGGCTTTCCCAAAAATCAGAAGG - Intronic
1126182722 15:45801634-45801656 GGAGATTCCCAGAAATAACTGGG - Intergenic
1129649063 15:77467240-77467262 TCCCATTTCCAGAAATCACAAGG + Exonic
1130208459 15:81900675-81900697 TGGCCTTTCCAGATATCACACGG + Intergenic
1131670561 15:94615276-94615298 GGGCATGCCAAGAAAGCACCTGG + Intergenic
1134349008 16:13418953-13418975 GGGCATTCCCAGAAATAAAGTGG + Intergenic
1134750797 16:16623398-16623420 GCTCATTCCTAGAAAACACAGGG - Intergenic
1134994660 16:18730190-18730212 GCTCATTCCTAGAAAACACAGGG + Intergenic
1138932442 16:61677211-61677233 CGTCTTTCCCAGAAAACACAGGG + Intronic
1139243388 16:65417278-65417300 AGGACTTTCCAGAAATCACAGGG - Intergenic
1139801142 16:69523919-69523941 CGGCCTAGCCAGAAATCACAGGG - Intergenic
1140944465 16:79754962-79754984 GGGATTTCCCAGAAATCCCTGGG - Intergenic
1144817501 17:18046092-18046114 GGGCATTCCCAGCATTCGGAGGG - Intronic
1145032351 17:19514093-19514115 CGGCAAGCCCAGGAATCACAGGG + Intronic
1148328053 17:46795364-46795386 GGGGAGCCCCAGAAGTCACAGGG - Intronic
1149251208 17:54771718-54771740 GTACATACCCAGAAAGCACAGGG - Intergenic
1152186807 17:78862267-78862289 GGGGCTAACCAGAAATCACAGGG - Intronic
1152543299 17:80987927-80987949 GGGCGTTCACAGCAATCAGATGG + Intergenic
1153232325 18:2950717-2950739 GGGAAATCCCAGAGATGACATGG + Intronic
1154122856 18:11665579-11665601 GGACATTCCCAGAAAGCATCTGG + Intergenic
1158772785 18:60541365-60541387 GGTCATTGTCTGAAATCACAGGG - Intergenic
1160595462 18:79970630-79970652 AGCCCTCCCCAGAAATCACACGG + Exonic
1164899657 19:31907580-31907602 GGGCAATTCCAGAATTCAAATGG - Intergenic
1165427960 19:35756081-35756103 GGGCAATCCCAGATATTACAGGG - Intronic
1165603401 19:37078212-37078234 GGGCACTCCCAGAAACCTCCGGG + Intronic
1167920756 19:52781419-52781441 GGGCCTTCCAGGCAATCACATGG - Intronic
1168361893 19:55748227-55748249 AGGCAGTCCCAGAAATTTCATGG - Intergenic
925412043 2:3645379-3645401 CGGCACTCACAGAGATCACATGG + Intergenic
926159317 2:10476477-10476499 GGGCAGTCCATGAAATCACGTGG - Intergenic
927110257 2:19859378-19859400 GGGCATTTCCAGAATCCCCAAGG + Intergenic
928485837 2:31729930-31729952 GGGCTTTCCCAGAATTCAATGGG - Intergenic
930395535 2:50819165-50819187 GGTGAATACCAGAAATCACATGG - Intronic
932474632 2:71995010-71995032 GAGCCTTCCCTGAAGTCACATGG + Intergenic
933401216 2:81797932-81797954 GGGGATTCCCACAATGCACATGG - Intergenic
933787971 2:85858903-85858925 GGTCATTCTTAGAAATCACTAGG + Intronic
937127227 2:119482385-119482407 GGGCAGTCCCAGGAGCCACAAGG + Intronic
938719740 2:134055930-134055952 GGAGACTCCCAGAAATCACTGGG + Intergenic
940415321 2:153412902-153412924 GGGCCTAAGCAGAAATCACATGG + Intergenic
943451736 2:188050956-188050978 GGGCATTGCCAGAATAAACAAGG + Intergenic
944187422 2:196964529-196964551 GGGGATACTCAGAAGTCACAGGG + Intergenic
944484077 2:200185085-200185107 GGGCATTCTCTGAAAACACCAGG + Intergenic
945301990 2:208223060-208223082 TGGCATTCATAGAAATCACCTGG + Intergenic
1169399039 20:5264221-5264243 GGGCATGTGCAGAGATCACATGG + Intergenic
1171973843 20:31581448-31581470 GTGCTTTCCCAGGATTCACATGG + Intergenic
1174734258 20:52949954-52949976 GGGCATTCCCATAAAGCACAGGG + Intergenic
1175911209 20:62406388-62406410 GGGCATGTCCAGAACCCACAGGG + Intronic
1176013040 20:62910738-62910760 GGGCACCCACAGAAATCCCAGGG - Intronic
1179404034 21:41110797-41110819 GGGCAGTCCGACAAATCACAAGG + Intergenic
1179428089 21:41297567-41297589 TGGGATTGCCAGAAATCATATGG - Intergenic
1179575922 21:42308407-42308429 GGGCATTCCCACCAGACACAGGG + Intergenic
1179972659 21:44844875-44844897 GGGCATTCCCGGAAGTAAGAGGG + Intergenic
1180498512 22:15911450-15911472 GAGCATTCCCAGGATGCACAGGG + Intergenic
1182501179 22:30748773-30748795 GGGCATCCTCAGAAAGCAAAAGG + Intronic
950192816 3:10989837-10989859 GCCCATTGACAGAAATCACAAGG + Intergenic
957972300 3:87398082-87398104 GGACATTTCCAGAAGTCAAAGGG + Intergenic
958445970 3:94215561-94215583 TGGCATACCCAGAGAGCACATGG + Intergenic
959339096 3:105105557-105105579 GGGCAGTCCAAGACACCACAGGG + Intergenic
961068358 3:123896249-123896271 GGGCAGTCCGGGGAATCACATGG - Intergenic
961324119 3:126100064-126100086 GGTCATTCCCACAAAGAACAGGG + Intronic
962437099 3:135377173-135377195 GTGCAGTCTCAGAAACCACAAGG + Intergenic
962893804 3:139696341-139696363 GCGCATGTCCTGAAATCACAGGG + Intergenic
963880057 3:150519018-150519040 TGGCATTCCCTGAAGCCACAAGG - Intergenic
964469035 3:157031914-157031936 GGGCATCCCCAGAAACAGCAAGG + Intronic
967977620 3:195044325-195044347 AGGCATTCCCTGAGTTCACAGGG - Intergenic
968872784 4:3250126-3250148 GGGTATTTCCAGAAATCACCAGG + Intronic
969085102 4:4650640-4650662 AGGCCTTCTCAGAAATCCCAGGG + Intergenic
969167630 4:5330544-5330566 TGGCAACCCCAGATATCACATGG - Intronic
970412743 4:15825318-15825340 TGGCATTTACAGAGATCACATGG + Intronic
971036360 4:22697132-22697154 GAGCCTTCCCTGAAATCACCGGG - Intergenic
972106368 4:35494046-35494068 GGGCCTTCCCAGAGAGCACAGGG - Intergenic
973059287 4:45700029-45700051 GAGCATTCCAAAAAATAACACGG - Intergenic
974160748 4:58135003-58135025 GTTCATTCCCACAATTCACACGG + Intergenic
974580115 4:63787508-63787530 GGGCATTCCCAAACATCACCAGG - Intergenic
975540335 4:75503217-75503239 AGGCATTGCCAGATATCACCTGG + Intronic
975559566 4:75696351-75696373 TGGCATTCTCAGAAATCACCTGG + Intronic
975989133 4:80238730-80238752 GGGGATTCCCAGATATCAGCAGG + Intergenic
976922170 4:90454343-90454365 GGGCAGCCCCAGACATCAGAAGG - Intronic
977682580 4:99812264-99812286 AGCCCTTCCCAGAAATCACTGGG - Intergenic
987747052 5:21988603-21988625 GGACATTCCCAGAAACATCAAGG + Intronic
991014589 5:61917289-61917311 AGGAATTCCCAGAAATTACTTGG + Intergenic
991767227 5:69998367-69998389 GGGCATTCCCAGAAACATCAAGG + Intergenic
991846461 5:70873445-70873467 GGGCATTCCCAGAAACATCAAGG + Intergenic
992272183 5:75076478-75076500 TGGCATGCCCAGAGATCGCATGG - Intronic
994349927 5:98733674-98733696 GGGAATTTGCAGAAATCTCAAGG - Intergenic
995017835 5:107331848-107331870 GGGCCTTCCCACAATTCAGACGG + Intergenic
996463309 5:123771924-123771946 GGGCTTTCCAAGAAATCAAAGGG + Intergenic
996914572 5:128696903-128696925 GGGGATTCAAAGAAATCCCAGGG + Intronic
997861983 5:137426722-137426744 GGGGACTCCCAGAAATAACTGGG - Intronic
998427313 5:142039795-142039817 GGGCACTCTCAGAACTCACTGGG - Intergenic
1005567829 6:27114288-27114310 GGGAAATCACAGAAACCACATGG + Intergenic
1009037820 6:58139210-58139232 GGGCATGTGCAGAAATCACATGG - Intergenic
1009213606 6:60892847-60892869 GGGCATGTGCAGAAATCACATGG - Intergenic
1010258075 6:73783145-73783167 AAGCATTCCCAGGAGTCACAGGG + Intronic
1010784047 6:79979109-79979131 GGGCAGTCCCAGAACTAACCTGG - Intergenic
1011463748 6:87633502-87633524 GGTCATTACCTGAAAGCACATGG - Intronic
1012759397 6:103279535-103279557 GGGCATCCTCAGAAAGCAAAAGG - Intergenic
1012955888 6:105569401-105569423 GGGCATTGCCAGAAAACAATAGG + Intergenic
1013734079 6:113205482-113205504 GGGATTCCCCAGTAATCACAAGG - Intergenic
1016776239 6:147907683-147907705 GGGCAATCCAAGATATCACAGGG - Intergenic
1017636569 6:156449776-156449798 GGGCTCTCTCAGAAATGACAAGG - Intergenic
1018839202 6:167506733-167506755 GGGCACCTCCAGGAATCACAGGG + Intergenic
1019803550 7:3105991-3106013 GTGCATTCCAAGAAATCAGGTGG - Intergenic
1022030915 7:26491204-26491226 GAGCATTCCCAGAAGCCACTCGG - Intergenic
1022107612 7:27208123-27208145 GTGCAGTTACAGAAATCACAGGG - Intergenic
1023564306 7:41508258-41508280 GGGCATCCCCAGTAATCACTGGG + Intergenic
1027414730 7:77963071-77963093 CAGCATGCACAGAAATCACATGG + Intergenic
1027589651 7:80101565-80101587 GAGCATTCCAAGAAATAGCAAGG + Intergenic
1031214267 7:118870394-118870416 GGGCATTTTCAGAGATCTCAGGG + Intergenic
1032444587 7:131971327-131971349 GTGGATTTCCAGACATCACAAGG - Intergenic
1035101499 7:156401405-156401427 GGGCATTCCAAGAAGACACCGGG + Intergenic
1039015237 8:33140867-33140889 GGGCATGTACAGAGATCACATGG + Intergenic
1039861443 8:41462164-41462186 GGGCATTCTCATACATCTCAGGG + Intergenic
1043303969 8:78770911-78770933 GGGAATTTTCAGAAATTACATGG - Intronic
1043629982 8:82318685-82318707 GGGCATTACTTTAAATCACAAGG - Intergenic
1045814394 8:106262408-106262430 GGGCCTTCCCAGAAACCAACAGG + Intergenic
1047078847 8:121436810-121436832 AGGCTTTCCCAGAAATTACTGGG - Intergenic
1047573740 8:126130683-126130705 TAGGATTGCCAGAAATCACAAGG + Intergenic
1047807053 8:128371630-128371652 GGGCTTGCCCTGAAATCACACGG - Intergenic
1047891490 8:129316368-129316390 GGTCATGCCCAGAAATAACGTGG + Intergenic
1048094152 8:131273318-131273340 AGTCACTTCCAGAAATCACAAGG + Intergenic
1050029113 9:1366527-1366549 ATGCATTCTCAGAAATCAGAAGG - Intergenic
1051457737 9:17279970-17279992 AGGCAGTGCCAGACATCACATGG - Intronic
1052200853 9:25778010-25778032 AGGCATTAACAGAAATAACATGG - Intergenic
1052891976 9:33709908-33709930 GGGTATTCTCAGAAAGCACATGG + Intergenic
1053455750 9:38232060-38232082 TGGCATCTCTAGAAATCACAAGG - Intergenic
1054823683 9:69549025-69549047 GGGCATGCAGGGAAATCACAGGG + Intronic
1055615960 9:78073446-78073468 TGTCATTGCCAGAAATTACAAGG + Intergenic
1056871674 9:90287686-90287708 GGGAATCCCCAGAAAGCTCAGGG + Intergenic
1058315057 9:103554593-103554615 GGGCATTCACAGAAGTGGCAGGG - Intergenic
1060279385 9:122205859-122205881 TTGCATTCCCAGATCTCACAGGG + Intronic
1061134448 9:128725104-128725126 GGGCAGTCCCTCCAATCACATGG - Intergenic
1062293858 9:135813153-135813175 AGGCCTTCCCAGGAATCTCAGGG + Intronic
1062404706 9:136390019-136390041 TTGAATTCCCAAAAATCACAAGG + Intronic
1186906212 X:14113491-14113513 GGCCAATCCCAAAAATTACATGG + Intergenic
1189898526 X:45681938-45681960 GGGCAGTCTCAGAAGTCAGATGG + Intergenic
1190810421 X:53878064-53878086 GGGCTTTTCCTGAAATTACAAGG - Intergenic
1190923232 X:54877281-54877303 GGGGATTCCCTTAAATCACAAGG + Intergenic
1198481789 X:137047926-137047948 AGGCATTTCCAGAAATGATATGG + Intergenic
1198843691 X:140886231-140886253 TGGCATATGCAGAAATCACATGG - Intergenic
1199819065 X:151426724-151426746 GGGCATTCATAAAAATCGCAAGG + Intergenic
1199896527 X:152132177-152132199 GGGCATTTCCCAGAATCACATGG - Intergenic
1200494050 Y:3859415-3859437 AGGAAATCCCAGACATCACATGG + Intergenic