ID: 1077468244

View in Genome Browser
Species Human (GRCh38)
Location 11:2743961-2743983
Sequence CGGATCAGGCCAGAACGGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 54
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 52}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077468244_1077468251 -5 Left 1077468244 11:2743961-2743983 CCTGCCCGTTCTGGCCTGATCCG 0: 1
1: 0
2: 0
3: 1
4: 52
Right 1077468251 11:2743979-2744001 ATCCGGGGCCTCTTGACTGCAGG 0: 1
1: 0
2: 1
3: 7
4: 84
1077468244_1077468255 6 Left 1077468244 11:2743961-2743983 CCTGCCCGTTCTGGCCTGATCCG 0: 1
1: 0
2: 0
3: 1
4: 52
Right 1077468255 11:2743990-2744012 CTTGACTGCAGGTCTCTCGTGGG 0: 1
1: 0
2: 0
3: 7
4: 94
1077468244_1077468256 20 Left 1077468244 11:2743961-2743983 CCTGCCCGTTCTGGCCTGATCCG 0: 1
1: 0
2: 0
3: 1
4: 52
Right 1077468256 11:2744004-2744026 TCTCGTGGGCTCTCAGCCCCAGG 0: 1
1: 1
2: 2
3: 15
4: 191
1077468244_1077468254 5 Left 1077468244 11:2743961-2743983 CCTGCCCGTTCTGGCCTGATCCG 0: 1
1: 0
2: 0
3: 1
4: 52
Right 1077468254 11:2743989-2744011 TCTTGACTGCAGGTCTCTCGTGG 0: 1
1: 0
2: 1
3: 6
4: 92

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077468244 Original CRISPR CGGATCAGGCCAGAACGGGC AGG (reversed) Intronic
902333626 1:15742822-15742844 CCGATCAGGCCTGAGGGGGCGGG - Exonic
902777467 1:18684046-18684068 CGGGTCAGGCCAGGAAGAGCGGG - Intronic
912365108 1:109126944-109126966 CGGATCAGGGCAGATGGGCCGGG + Intronic
922976164 1:229785236-229785258 CTGACCAGGCCAGCATGGGCAGG - Intergenic
1067806244 10:49395348-49395370 CAGAGCCGGCCAGAAAGGGCCGG - Intronic
1071595089 10:86916205-86916227 GGGACCAGGCCAGATCAGGCAGG + Intronic
1077468244 11:2743961-2743983 CGGATCAGGCCAGAACGGGCAGG - Intronic
1078126199 11:8565918-8565940 CGGAACAGGCCAGGACAGGGAGG - Intronic
1083551494 11:63593501-63593523 CAGACCAGGCCAGACCAGGCCGG + Intronic
1089599686 11:119605664-119605686 CGGACCAGGCCAGAGAGGCCTGG + Intergenic
1114645366 14:24253009-24253031 AGGATCAGGCCCAGACGGGCTGG + Intronic
1120466212 14:84860889-84860911 TGGTTCAGTCCAGAAAGGGCGGG + Intergenic
1124388252 15:29227543-29227565 CGCTGCAGGCCAGAAAGGGCTGG + Intronic
1132681572 16:1144600-1144622 CGGGACAGGGCAGAACAGGCCGG - Intergenic
1138622382 16:58222493-58222515 CGGACCAGGCCAGAACTATCAGG - Intergenic
1142270494 16:89086614-89086636 TGGATCAGGCCAGGAGGTGCTGG - Intergenic
1144143807 17:12377365-12377387 AGAATCAGTCCAGAAAGGGCAGG + Intergenic
1147585467 17:41651751-41651773 GGGAACAGGCGAGAACAGGCTGG - Intergenic
1149595542 17:57862601-57862623 CTGATGAGGCCAGACGGGGCAGG + Exonic
1149910010 17:60558424-60558446 TGGAGCAGGCCAGAAGGGTCTGG + Intergenic
1151748145 17:76022508-76022530 CTGCGCAGGCCAGTACGGGCCGG - Exonic
1152571662 17:81123767-81123789 CGCCTCAGGCCAGCATGGGCAGG + Intronic
1152817152 17:82414868-82414890 CGGAGCAGGTCTGACCGGGCCGG - Intronic
1160309268 18:77773456-77773478 CAGACCAGGCCAGGACCGGCAGG + Intergenic
1160309330 18:77774470-77774492 CAGACCAGGCCAGGACGGGCAGG - Intergenic
1160782614 19:884518-884540 GGGGACAGGCCAGACCGGGCAGG - Intronic
1161256642 19:3313582-3313604 CGGGTGAGGCGAGAAGGGGCTGG - Intergenic
1161680736 19:5678510-5678532 CTGCCCCGGCCAGAACGGGCAGG - Exonic
1165433451 19:35784800-35784822 CGGATCAGGCGGGAGCAGGCGGG - Intronic
1167376396 19:49114515-49114537 CGGGTCAGGCCAGTGCGGGTGGG + Intronic
1167722575 19:51188452-51188474 CCTAACAGGCCAGAACGTGCAGG - Intergenic
936108416 2:109645355-109645377 GGGATTTGGCCAGAAGGGGCTGG - Intergenic
942453439 2:176122523-176122545 CGGGCCAGGCCAGGTCGGGCCGG + Intergenic
1168897999 20:1337132-1337154 CGGAGCAGGGCAGAACAGGAAGG + Intronic
1169081458 20:2799911-2799933 CAAAACAGGCCAGAACTGGCAGG - Intronic
1172228638 20:33322276-33322298 AGGATCAGTGCAGAAAGGGCTGG - Intergenic
1174075147 20:47930029-47930051 GGGGCCAGGCCAGAAGGGGCAGG + Intergenic
950912752 3:16611888-16611910 CAGACCAGGCCATAAAGGGCTGG + Intronic
953890796 3:46750472-46750494 CGGAGGAGGCCAGAGAGGGCAGG + Intronic
966927561 3:184655315-184655337 AGGAACAGGGCAGAACAGGCTGG + Intronic
968729273 4:2262026-2262048 CGGAGCCGGCCGGAGCGGGCCGG - Exonic
976717259 4:88136163-88136185 CAGATCTGGCCAAAGCGGGCGGG - Intronic
990165533 5:52989466-52989488 AGGATGGGGCCAGAACGGACAGG + Exonic
1006273248 6:32980719-32980741 GGGGTCAGGCCAGATGGGGCAGG + Exonic
1007464794 6:42044178-42044200 AGGCTCCGGCCAGAACGTGCAGG - Intronic
1012815420 6:104017590-104017612 GGGAGCAGCCCAGAAGGGGCGGG - Intergenic
1029612355 7:101633833-101633855 CTGGCCAGGCCAGAAAGGGCAGG - Intergenic
1031039705 7:116826716-116826738 ATGATCAGCCCAGAATGGGCTGG + Intronic
1032819332 7:135510126-135510148 CTGATCCGGCCAGGAGGGGCGGG + Exonic
1036287773 8:7459798-7459820 GGGCTCAGGCCAGAGCAGGCAGG + Intronic
1036333703 8:7851730-7851752 GGGCTCAGGCCAGAGCAGGCAGG - Intronic
1040942034 8:52844026-52844048 AGGATCATGCCAGACAGGGCAGG - Intergenic
1187037679 X:15559214-15559236 GTGATCAGGCCAGAAATGGCAGG - Intergenic
1187700430 X:21959921-21959943 AGGAGCAGGCAAGAAGGGGCCGG + Intronic