ID: 1077468434

View in Genome Browser
Species Human (GRCh38)
Location 11:2745209-2745231
Sequence AAATTTAACCTGCAAATTCG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 161
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 155}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077468434_1077468438 28 Left 1077468434 11:2745209-2745231 CCTCGAATTTGCAGGTTAAATTT 0: 1
1: 0
2: 0
3: 5
4: 155
Right 1077468438 11:2745260-2745282 CGTTTTCTCCTCCAAGAACAAGG 0: 1
1: 0
2: 0
3: 18
4: 225

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077468434 Original CRISPR AAATTTAACCTGCAAATTCG AGG (reversed) Intronic
900202251 1:1414407-1414429 AAATGTAACCTTAAAATTTGAGG - Intergenic
900723094 1:4192537-4192559 AAATATAAATTGCAAATTCTAGG - Intergenic
905057930 1:35113986-35114008 AAATTTTATCTTCAAATTAGTGG - Exonic
906464321 1:46062608-46062630 AAATTTAACCTGAAGATTTTTGG - Intronic
909031907 1:70551543-70551565 AAATGTATACTGCAAATTCAAGG + Intergenic
909839846 1:80306284-80306306 AAATTTGAGCTGCAAATCTGTGG - Intergenic
911347780 1:96718729-96718751 AAATCTAAGCTACAAATTTGTGG + Intergenic
912079463 1:105916815-105916837 AAATTTCACCTCAAAATTAGGGG + Intergenic
912586808 1:110774392-110774414 TATTTTAACCAGCAAATTTGGGG + Intergenic
912673975 1:111659792-111659814 AAATGTATACTGCAAATTCAAGG - Intronic
912914977 1:113805677-113805699 AAATTTAATCTGTAAATGCTAGG - Intronic
912919749 1:113854609-113854631 AAATTTCACCAGCAGATTTGAGG + Intronic
913177426 1:116287687-116287709 AAATGTAACATTCAAATTCTGGG - Intergenic
921614245 1:217248055-217248077 AAATATAACTTGCAATTTCTAGG - Intergenic
922787962 1:228292687-228292709 AAATGTGAGCTGCAGATTCGTGG + Exonic
923560455 1:235036315-235036337 AAATGTACACTGCAAATTCTAGG - Intergenic
1063199616 10:3775425-3775447 AAATTTAGACTGTACATTCGGGG + Intergenic
1068801364 10:61144427-61144449 AAATTTAAAATACAAATTAGGGG - Intergenic
1069308825 10:67007183-67007205 AGATTTTACCTTCAAATTCTTGG + Intronic
1071400662 10:85266445-85266467 AATTTTGACCTGCAATTTGGAGG + Intergenic
1071586424 10:86826572-86826594 AAATATAACCAGCAAATTGTGGG - Intronic
1073909020 10:108319007-108319029 ATATTTATCCTGAAAATTCAAGG + Intergenic
1074329737 10:112493792-112493814 AAATTTATCCTACGAATACGAGG - Intronic
1075542608 10:123328205-123328227 AAATGTATCCTGCAAATAAGAGG + Intergenic
1077468434 11:2745209-2745231 AAATTTAACCTGCAAATTCGAGG - Intronic
1077572081 11:3347644-3347666 GAATTTAACCTCCAAATGCCAGG + Intronic
1078791588 11:14547897-14547919 AACTTGAACCTGCAAATGGGAGG + Intronic
1079610825 11:22430724-22430746 AAATTTAAGCTCCAAAATTGAGG - Intergenic
1079939638 11:26663295-26663317 AAACTTAACATGCAAATTATAGG - Intergenic
1085895104 11:80629548-80629570 AAATTTAACTTACAAAATGGTGG + Intergenic
1086642699 11:89179202-89179224 AAATTAAAAATGCAAATTCCTGG + Intronic
1086843034 11:91712028-91712050 AATTTTAACATACAAATTTGGGG + Intergenic
1087246035 11:95838427-95838449 AAATTCAGCCTGCAAATTTAGGG - Intronic
1091416384 12:289733-289755 AAATTTAATCTGCATATTTTGGG + Intronic
1094407499 12:30133297-30133319 AAATTTAACCTCCAAAGTACTGG - Intergenic
1095133144 12:38567172-38567194 AATTTTAATATGTAAATTCGGGG - Intergenic
1099948867 12:89277573-89277595 AATGTTAACATGCAAATTTGTGG - Intergenic
1100145663 12:91674540-91674562 AAATTAAACCTGGAAATAAGAGG - Intergenic
1100327034 12:93549630-93549652 AAAATTAAACTTCAGATTCGAGG + Intergenic
1108389335 13:49932888-49932910 AAAGTTAACCCCCAAATTCTGGG + Intronic
1109952797 13:69522705-69522727 AAATTTTACATGCAAATTTTGGG + Intergenic
1110023177 13:70502021-70502043 AATTTTATCCTGCATATTCAAGG - Intergenic
1111221096 13:85206282-85206304 AAATATAACCCCCAAATTCATGG + Intergenic
1112222501 13:97505285-97505307 AATTTTTACCTCCAAATTCTGGG + Intergenic
1113672836 13:112186570-112186592 AAATTTAACAGACAACTTCGAGG + Intergenic
1115745386 14:36431496-36431518 AAATTTAAACTGCAAAACCTTGG + Intergenic
1115819115 14:37195012-37195034 AAATTTAACATGGAAAGTGGTGG - Intergenic
1117754551 14:58960202-58960224 AATTTCAACCTGTAAATTTGGGG - Intergenic
1121295564 14:92819057-92819079 AATTATAACCTGCAATTTCAGGG + Intronic
1121476528 14:94212493-94212515 AAATTTAACCTTCAGATGAGTGG - Intronic
1127250808 15:57235758-57235780 AAATTTAACCTGCATTTTGGGGG + Intronic
1131148504 15:90031896-90031918 AAATTAAACCTGCAGATACTTGG + Intronic
1136346875 16:29681399-29681421 CAATTTCACCTGCAAATTCTGGG - Intronic
1136986541 16:35111597-35111619 GAATTTAACCTCAAAATTCCGGG + Intergenic
1138320808 16:56110034-56110056 AAATTTTATCCCCAAATTCGGGG - Intergenic
1138928878 16:61627808-61627830 AGCTTTAACCTGCAAATTAGAGG - Intergenic
1138931157 16:61658026-61658048 AAATTTTACCTGCCAGTTCCAGG + Intronic
1143188739 17:5025902-5025924 CAATCTAACCTGCAAAATCCTGG - Exonic
1148897644 17:50849065-50849087 AAATTTGACATGCAATTTGGTGG + Intergenic
1149207144 17:54261501-54261523 TGATTTAAGCTGCAAATTTGTGG - Intergenic
1150665426 17:67131529-67131551 AGATTTAACATGCAAATTTCAGG - Intronic
1152456830 17:80421636-80421658 AGATGTACCCTGCAAATTGGTGG - Intronic
1153822490 18:8844219-8844241 AAATTTCCCCTGCAAAGACGAGG + Intergenic
1155188236 18:23406224-23406246 AAAGTTAATCTGCAAATTGCTGG - Intronic
1155420061 18:25646248-25646270 AAATTTAACCTGCAGTGTGGTGG + Intergenic
1156101420 18:33600730-33600752 GAATTTCATCTGCAAATTCAGGG + Intronic
1156202794 18:34853373-34853395 AAATTTGACCTGAGAATTTGGGG + Intronic
1158130127 18:54143402-54143424 GAATTTAACCTGAAAATGCCAGG - Intergenic
1159503631 18:69306330-69306352 AAATTTACCCTACAACTTAGTGG + Intergenic
1160448363 18:78944498-78944520 AAATTGAAACTGCAAATAGGTGG - Intergenic
1160564518 18:79778773-79778795 AAGGTTAAGCAGCAAATTCGAGG - Intergenic
1164215920 19:23147915-23147937 AAATTTAACCTCGAAATCCCAGG - Intergenic
1165593735 19:36993273-36993295 AAATTTATCCTACAAATGCAAGG - Intronic
925521313 2:4748821-4748843 ACATTTAACCTTCATATTCAAGG + Intergenic
929022598 2:37568379-37568401 AATTTTAATCTGTAAATTTGGGG - Intergenic
929643837 2:43608011-43608033 AATTTGAACATGCAAATTTGGGG - Intergenic
931154366 2:59611077-59611099 TAATTTAACTTTTAAATTCGGGG + Intergenic
935613504 2:105051524-105051546 AAATTTCATATGAAAATTCGAGG - Intronic
937860650 2:126706335-126706357 AAATTTCACCTGCATATTAAGGG + Intergenic
941320258 2:164046139-164046161 GAAGTTAACCTCCAAATTCTTGG + Intergenic
944881523 2:204017788-204017810 ATGTTTAACCTGGAAATTCAGGG + Intergenic
947320723 2:228915177-228915199 AAAGTTGACCTGGAAATTTGTGG - Intronic
1170435953 20:16328903-16328925 AAATTTAACCTACAATTTGTTGG - Intronic
1171327688 20:24310164-24310186 TAGTTTAGCCTGCAAATTCAAGG + Intergenic
1173270165 20:41526866-41526888 AATTTTGAACTGCAAATTCCTGG + Intronic
1173675866 20:44835202-44835224 AAATTTAACCCTCACATTTGTGG - Intergenic
1177995676 21:28094151-28094173 AAATTTAATTTCCAAATTAGGGG - Intergenic
1181049463 22:20231708-20231730 GAATTTGACTTGCAAAGTCGGGG - Intergenic
949379334 3:3427871-3427893 AAACTGAACCTGCACATTCACGG + Intergenic
957676163 3:83368363-83368385 AAATGTAAATTGCAAATTCTAGG + Intergenic
957923371 3:86776309-86776331 CAATTTAGCCTGGAAATTAGAGG - Intergenic
962623377 3:137200648-137200670 AAATTACACCTGCCAATTCAAGG - Intergenic
964450560 3:156808917-156808939 AAAATTGACCAGCATATTCGGGG - Intergenic
969661193 4:8529241-8529263 AAATTTAACCTCCAAGATTGTGG - Intergenic
970845977 4:20537868-20537890 AAATTTCACCTGCAATGTCAAGG - Intronic
972217924 4:36917632-36917654 AAATCCAACCTTCAAATTCTAGG - Intergenic
976068523 4:81216013-81216035 GAATTTCACCAGCAAATTCACGG + Intergenic
977587959 4:98795793-98795815 AAATTTAGTCTGCATATTCCAGG - Intergenic
977863353 4:101993839-101993861 AAGCTTAAACTGCAAATTCTTGG - Intronic
981427759 4:144623220-144623242 AAATTTACTCTGCAATTTAGAGG + Intergenic
983856599 4:172654133-172654155 AAAATTAACCTTCAGATTAGTGG + Intronic
984280826 4:177668848-177668870 ATATTTAACAGGCAAATTCATGG - Intergenic
984315140 4:178119701-178119723 AAAGTTAGACTGCAAATTAGTGG + Intergenic
985167531 4:187113201-187113223 ACATTTAACCTGCACATTAAAGG + Intergenic
986470757 5:8071960-8071982 AATTTTAACCTTCTAATTTGAGG + Intergenic
989227989 5:39052603-39052625 AAATATAAACTGCAAATTATGGG - Intronic
989755006 5:44941404-44941426 AATTTTAACATGTAAATTGGCGG + Intergenic
990310267 5:54531062-54531084 AAATTTAAACTGCGAGTTCCTGG + Intronic
993229988 5:85222683-85222705 AAATTTATTCTGCAAATTAATGG - Intergenic
995932422 5:117463694-117463716 AAATAAAGGCTGCAAATTCGAGG - Intergenic
999879449 5:155845265-155845287 AATTTTAACCTAGAAATTCCAGG + Intergenic
1001393479 5:171399606-171399628 GTATTTAACCTGTATATTCGGGG + Intronic
1001813636 5:174649553-174649575 AAATTTAGCCAGCCATTTCGTGG + Intergenic
1004216347 6:13707666-13707688 AAATTTAAAATGAAAATTCCAGG + Intronic
1004572043 6:16855914-16855936 AAAATTAACCTGGAAGTTCAAGG - Intergenic
1008288593 6:49684687-49684709 AATTTTAACATGTAAATTAGGGG + Intergenic
1009516267 6:64622432-64622454 AAATTTAACCTGGATATAAGTGG - Intronic
1009935489 6:70230126-70230148 AAATTTAAGTTTCAAATTGGTGG + Intronic
1011390869 6:86851636-86851658 AAATTTAACCTGCAGGTTATAGG + Intergenic
1011670784 6:89681137-89681159 AAATTTAAACTGTTAATTAGGGG - Intronic
1015207911 6:130661517-130661539 AAATTTAACAAGGAAATTCAGGG + Intergenic
1020919066 7:14238512-14238534 AAATGTAGCCTGGAAATTCCTGG - Intronic
1022408376 7:30114860-30114882 AATTTGAACCTCCAAATTTGAGG + Intronic
1027848420 7:83416402-83416424 AAATTTAACTTTTAAATTCTTGG + Intronic
1028870049 7:95760711-95760733 AAATCTAACATGCAAGTTGGTGG + Intergenic
1029892289 7:103943452-103943474 AAATTAAATGTGCAAATTTGGGG + Intronic
1030465220 7:109892988-109893010 AAATTTAACATGCCAATTACTGG - Intergenic
1031150042 7:118043083-118043105 TCCTTTAACCTGCAACTTCGGGG + Intergenic
1031201845 7:118698337-118698359 AAGTTTCATCTGCAAATTCTTGG + Intergenic
1032778263 7:135138497-135138519 AAATGTATCCTGTAAATTCAAGG + Intronic
1033493458 7:141868382-141868404 AAATTTAACCACCAAACTCAAGG - Intergenic
1035329490 7:158087013-158087035 TTATTTACCCTGCAAAATCGGGG + Intronic
1036540855 8:9708598-9708620 AAAATTAACATGCAAATTCCTGG - Intronic
1036990733 8:13590680-13590702 AAATATAAACTGCAAATTTTTGG - Intergenic
1038236582 8:25763896-25763918 AAATTTCACCTTAAAATTTGTGG + Intergenic
1039691364 8:39868106-39868128 AAATTCAACATGAAATTTCGAGG + Intergenic
1043341368 8:79243913-79243935 AAATTTAACTTGCCAATTAATGG + Intergenic
1044536130 8:93358064-93358086 ATATTTTACCTGCAAATTCCTGG + Intergenic
1044996873 8:97845728-97845750 AAATTTGGCCTGCAATTTCAGGG + Intronic
1045013140 8:97976050-97976072 GAATTAAACCTGCAAATACTAGG + Intronic
1045356504 8:101394050-101394072 AAATTTATCTTGAAAATTTGGGG + Intergenic
1045912488 8:107426537-107426559 AAAATTAACCAGCATATTCTAGG - Intronic
1047293145 8:123547464-123547486 AAATTTAACCTACAAATCGACGG - Intergenic
1050654694 9:7814245-7814267 AAATATAACCTGAAAATATGCGG - Intronic
1051994185 9:23194485-23194507 AAATTTAGCCTTCAGATTCTAGG + Intergenic
1052526319 9:29624310-29624332 ACTTTAAACCTGGAAATTCGTGG + Intergenic
1053003239 9:34589392-34589414 AAACTTTGCCTGCAAACTCGGGG - Intronic
1057530133 9:95837797-95837819 AAACTTGTCCTGCAAATTCTAGG + Intergenic
1058997156 9:110310373-110310395 AAATTTAATATGCAAATTTAAGG + Intronic
1059992676 9:119879905-119879927 AAATTTATCTTGCAAAATGGTGG - Intergenic
1186815011 X:13227687-13227709 AAACTTGACCAGCAAATTTGGGG - Intergenic
1188475783 X:30590272-30590294 AAATTAAACCTGCATAATCTTGG + Intergenic
1188534982 X:31186637-31186659 AAATTTAACTTGTAAGTTCAGGG - Intronic
1188813867 X:34687005-34687027 GAATTTAACCTGCCATTTCATGG - Intergenic
1191192041 X:57677896-57677918 AAATGTAACCTGCAATATCTCGG - Intergenic
1192774175 X:74224434-74224456 AAAATTAATCTACAAATTCAGGG + Intergenic
1194841341 X:98747422-98747444 AAATTTATCCTACAGATTCAAGG - Intergenic
1195953435 X:110302940-110302962 AAATTTATACTTCAAATTTGGGG + Intronic
1197960749 X:132003536-132003558 AAATTTAAACTGCAAATATTAGG - Intergenic
1199444351 X:147904098-147904120 AAATATATACTGCAAATTCTAGG + Intergenic
1201386946 Y:13451471-13451493 AAACATAACCTGTAAATTGGTGG - Intronic