ID: 1077470658

View in Genome Browser
Species Human (GRCh38)
Location 11:2758848-2758870
Sequence CTGTAGGGATGGAGATCAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 274
Summary {0: 1, 1: 0, 2: 3, 3: 28, 4: 242}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077470652_1077470658 6 Left 1077470652 11:2758819-2758841 CCGTATAGATAACATTCTCAAAG 0: 1
1: 1
2: 7
3: 70
4: 351
Right 1077470658 11:2758848-2758870 CTGTAGGGATGGAGATCAGATGG 0: 1
1: 0
2: 3
3: 28
4: 242

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077470658 Original CRISPR CTGTAGGGATGGAGATCAGA TGG Intronic
901015376 1:6226416-6226438 CTGTTTGGCTGGAGATCAGTGGG - Intronic
901436606 1:9250605-9250627 CTGCAGGGGTGGAGAGCAGCTGG - Intronic
903670272 1:25031262-25031284 CTGGAGGGATGGAGACTAGAGGG + Intergenic
903791832 1:25898498-25898520 CGCTAGGGATGGAGAAAAGATGG - Intronic
903830294 1:26170395-26170417 CTGTAGGAATGGAAGTGAGAAGG - Intronic
904437711 1:30509528-30509550 CTGCAGGGAGGGAGACCAGATGG + Intergenic
905234757 1:36538311-36538333 CTTAGGGGATTGAGATCAGAAGG + Intergenic
905473204 1:38208169-38208191 CTGCTGGGATGGAGACCAGAGGG + Intergenic
905541683 1:38765088-38765110 ATGGAAGGATGGAGATAAGAGGG - Intergenic
906065145 1:42975222-42975244 GGGTAGGGAGTGAGATCAGAGGG + Intergenic
906090498 1:43175468-43175490 CTGGAAGGATGGAGTTGAGATGG - Intronic
906273012 1:44496286-44496308 TTGTGAGGATGGAAATCAGAGGG + Intronic
907188685 1:52631766-52631788 CTGGAGGCCTGGAGATCAGCTGG - Intergenic
907463741 1:54621695-54621717 CTGGAGGGCTGGAGGGCAGAGGG + Intronic
908047920 1:60191996-60192018 CTGTAAGGGTGGAGATCTAATGG - Intergenic
909865739 1:80667953-80667975 CTGGAGGAATAGAGATAAGATGG + Intergenic
911113083 1:94212686-94212708 AGGTAGGGATGAAGATAAGATGG - Intronic
911500559 1:98680035-98680057 CTATAGGGATGGAGCTCTCATGG - Intronic
912095735 1:106140700-106140722 CTGGAGAGATAGATATCAGAAGG + Intergenic
914199579 1:145472936-145472958 CAGTTGCTATGGAGATCAGATGG + Intergenic
914478694 1:148046069-148046091 CAGTTGCTATGGAGATCAGATGG + Intergenic
915253028 1:154603962-154603984 AGGTAGGGATGGAGATCACTGGG - Intronic
915526008 1:156476717-156476739 CAGGAGGGATGGGGATTAGATGG - Intronic
915937114 1:160096083-160096105 CTGAAGGGAGAGAGATGAGAAGG - Intronic
917136656 1:171794522-171794544 CTGAAGGTATGGAGAACAAAAGG + Exonic
918208978 1:182334114-182334136 CTGTAGTGATGGAAACAAGAAGG - Intergenic
918763131 1:188440740-188440762 TTTTAGGGTTGGAGATCATATGG + Intergenic
919614273 1:199785734-199785756 CTGTAGAGATGGGGATTGGAGGG + Intergenic
919902954 1:202057370-202057392 CTGTAGGGAAGGAAACCAGACGG - Intergenic
920052870 1:203174095-203174117 CTGGAGAGATTGAGATTAGATGG + Intronic
920538495 1:206758626-206758648 CTGTAGGGATGTAGAGCGGTAGG - Intergenic
920754400 1:208715320-208715342 CTGTATGGATAAAGACCAGATGG + Intergenic
921902259 1:220463305-220463327 CTGCAGGGATGGGGATGAGGGGG - Intergenic
922566617 1:226605582-226605604 CTGAGGGGATGGAGAAGAGATGG - Exonic
922907754 1:229187711-229187733 CTGTAGGGATGAAGAGAAGTAGG - Intergenic
923128443 1:231053573-231053595 CTGTCAGGATGGAGAAGAGAGGG + Intergenic
1062776082 10:149220-149242 GTGCAGGGATGGAGATCCAAAGG - Intronic
1063478934 10:6353983-6354005 CTGAATGGATTGAGATCAGTTGG + Intergenic
1065567337 10:27026625-27026647 GTGTAGAAATGAAGATCAGAAGG - Intronic
1074072173 10:110083263-110083285 ATGGACGGATGGAGATGAGAGGG + Intronic
1074650976 10:115524058-115524080 GTGTAGAGATCGAGATCACATGG + Intronic
1075914833 10:126158120-126158142 CTGGAGGGATGGGGCTGAGAGGG + Intronic
1076128113 10:127992128-127992150 CAGGAGGGGTGCAGATCAGAGGG + Intronic
1077470658 11:2758848-2758870 CTGTAGGGATGGAGATCAGATGG + Intronic
1078213680 11:9293074-9293096 CTGTAGGGAGAGAGATAAAATGG - Intronic
1079139558 11:17799019-17799041 CTGAAGGGATTCAGATCCGAAGG - Intronic
1081455945 11:43222927-43222949 CTGTAAGGAAGGAAAGCAGATGG + Intergenic
1081612499 11:44570975-44570997 CTGCAGGGTAGGAGGTCAGAGGG - Intronic
1081627032 11:44662320-44662342 CTGAAGGGAGGAAGATGAGAAGG - Intergenic
1082823566 11:57561476-57561498 CGGTAAGGAAGGAGATGAGAGGG + Intronic
1082890210 11:58131113-58131135 CTGCAGGGCTAGAGCTCAGAAGG + Intronic
1086345674 11:85893417-85893439 CTGTAGGGAAGGAGATCTGCAGG - Intronic
1086743390 11:90395765-90395787 CTTTAGGGATGGAGAACAGCTGG + Intergenic
1088245843 11:107817336-107817358 CATTAGAGATGGAGATAAGAGGG + Intronic
1090192038 11:124778512-124778534 CTGTAGGGATAGAGGTCAGGAGG + Intronic
1090311557 11:125745844-125745866 CTCTAGGAATGGAGAAGAGAGGG - Intergenic
1090694479 11:129224560-129224582 CTGTGGAGCTGCAGATCAGAGGG - Intronic
1091305093 11:134531588-134531610 CTGTAGGGAAGGAAACCAGAGGG - Intergenic
1091869001 12:3871876-3871898 CAGAAGGGCAGGAGATCAGAGGG - Intronic
1092090698 12:5801500-5801522 CTGTAGGGCTGATGTTCAGATGG - Intronic
1092920279 12:13224875-13224897 CTGTAGGGGTGGACATGGGAGGG + Intergenic
1094232500 12:28122983-28123005 CTCTGGGGGTGGAAATCAGATGG - Intergenic
1096039761 12:48503619-48503641 CTGTAGGTCTTGACATCAGATGG - Intergenic
1096185384 12:49577058-49577080 CTGCAGGGTTGGGGATGAGAAGG + Intronic
1096521608 12:52187711-52187733 CAGTAGGGATGGAGGTCAAGAGG + Intronic
1097052842 12:56233821-56233843 CTGTTGAGAGGGAGATTAGATGG + Intronic
1097268768 12:57761392-57761414 CAGTAGGGAAGGAGTTGAGAAGG + Intergenic
1098188735 12:67925619-67925641 ATGTAAGGTTGGAGCTCAGAAGG - Intergenic
1098797052 12:74902918-74902940 GTGCAGGGATGCAGATGAGAGGG - Intergenic
1101323955 12:103698284-103698306 CTGTGGGGAAGGAGAGGAGAAGG - Intronic
1106499346 13:30312092-30312114 CTGAAGGGCTGGAGATCAAAGGG - Intergenic
1108416876 13:50206550-50206572 CTGTAGGAATGGTGTTGAGAGGG + Intronic
1109035951 13:57260476-57260498 CAGTTGCTATGGAGATCAGATGG - Intergenic
1112158540 13:96844750-96844772 CTGTAGGGATGGAGACAAGCAGG - Intergenic
1113239660 13:108322725-108322747 CTGTAGAGAGGGAGGTTAGAGGG + Intergenic
1113297291 13:108973004-108973026 CTGTAGAGATGGGGATCCCATGG + Intronic
1113595134 13:111526065-111526087 ATGAATGGATGGATATCAGATGG + Intergenic
1116348151 14:43822828-43822850 CCATGGGGATGGAGATGAGATGG + Intergenic
1117081540 14:52157114-52157136 CTGCAGAGATGGTGATGAGATGG - Intergenic
1118606690 14:67509190-67509212 CAGTAGGGAAGTAGACCAGATGG - Intronic
1120284136 14:82475958-82475980 CTGGATGGTTGGAGATGAGAAGG - Intergenic
1121360169 14:93249838-93249860 CTGTAGGGCTGGAGAGGGGATGG + Intronic
1126955330 15:53927338-53927360 CTGTAGGCAAGGAGAACAGTTGG + Intergenic
1127461594 15:59204246-59204268 GCGCAGGGATGGAGAGCAGAGGG + Intronic
1128799760 15:70489940-70489962 CTGTAGGGGTGGGGAGCTGAGGG + Intergenic
1129652179 15:77498831-77498853 GTGGAGAGATGGAGATCCGAAGG - Intergenic
1129654472 15:77514882-77514904 CTGTGGGGATGCAGAGCAGCAGG + Intergenic
1129914679 15:79258450-79258472 CAGCAAGGATGGAGACCAGAGGG + Intergenic
1131528122 15:93168294-93168316 CTATAGGGACAGAGAACAGATGG - Intergenic
1132376603 15:101332283-101332305 CTGCTGGGATGGAGGTCAGCCGG + Intronic
1133080160 16:3312263-3312285 CAGAAGGAATTGAGATCAGATGG + Intronic
1136643854 16:31591686-31591708 GTGTAGGGGTGGGGAGCAGAAGG - Intergenic
1136661751 16:31769084-31769106 GTGTAGGGGTGGGGAGCAGAAGG + Intronic
1137425833 16:48380002-48380024 CTGTAAGGCTGGAGACCAAAAGG + Intronic
1137539102 16:49349847-49349869 CAGTAGGGAGGGAGCTCTGAGGG - Intergenic
1138510932 16:57508089-57508111 CTGGAGGGCTGGAGTGCAGAGGG + Intergenic
1139594041 16:67947944-67947966 CTGTGGGGAGGGAGATTATAGGG - Intronic
1140302667 16:73773390-73773412 CAGTGGAGATGGAGAACAGATGG + Intergenic
1141178000 16:81733365-81733387 CTGGATGGATGGAGAATAGATGG - Intergenic
1141660163 16:85437175-85437197 CCGCAGGGAGGGAGATCAGATGG - Intergenic
1142493731 17:294984-295006 CTGTAGAAATGGAAAGCAGAGGG + Intronic
1143032259 17:3974297-3974319 CTGTAGAGATGGAGGCAAGAGGG - Intergenic
1144192155 17:12856401-12856423 CTGTAGGGAAGCAGAGAAGAAGG - Intronic
1144472606 17:15558183-15558205 CTGTTGGGATCGAGAGCAGAAGG - Intronic
1144558907 17:16305691-16305713 CTGGCTGGATGGATATCAGAAGG - Intronic
1144923875 17:18786508-18786530 CTGTTGGGATCGAGAGCAGAAGG + Intronic
1145923032 17:28625717-28625739 CAGTGGGAATGGAGATAAGATGG - Intronic
1147199292 17:38789225-38789247 CTGAAGGGATGAAAGTCAGAAGG - Intronic
1148686086 17:49502040-49502062 CTGGATGGAGGGAGATCGGAGGG - Intronic
1148806478 17:50266557-50266579 CAGCAGGGATGGGGATGAGATGG - Intergenic
1149656648 17:58312633-58312655 CTGGAGGGAGGGAGGTCAGGAGG + Exonic
1150851274 17:68705842-68705864 CTGTAAGGCTGGAGATGAGTTGG + Intergenic
1151967826 17:77440861-77440883 CTGCAGGCATGGAGATCAGCAGG - Intronic
1152756189 17:82088043-82088065 CGGGAGAGTTGGAGATCAGAGGG + Intronic
1155578645 18:27277917-27277939 CTGTGGGGATGGAGAAAAGTTGG - Intergenic
1156983393 18:43320796-43320818 CAGGAGGGAGGGACATCAGAAGG - Intergenic
1156983407 18:43320844-43320866 CAGGAGGGAGGGACATCAGAAGG - Intergenic
1157258158 18:46156678-46156700 CAGTGAGGATGGAGAACAGAGGG + Intergenic
1157598050 18:48875684-48875706 CTGCAGAGATGGAGACTAGATGG - Intergenic
1158387846 18:57014948-57014970 CAGTAGAGATGGAGAACAGCTGG - Intronic
1159107548 18:64020472-64020494 TAGTTGGGATGGAAATCAGAAGG - Intergenic
1159122671 18:64188960-64188982 CTGTAAGGAAGGAGATCACAAGG + Intergenic
1159946202 18:74446532-74446554 CTGGAGGGAAGGAAATGAGAAGG - Intronic
1160135077 18:76264781-76264803 CAGGAGGGCAGGAGATCAGATGG + Intergenic
1160702741 19:516139-516161 CTGCAGGGAGGGAGACCAGAGGG + Intronic
1161101674 19:2424720-2424742 CTGCAGGGCTGGAGGTCAGAAGG + Intronic
1161329203 19:3678369-3678391 ATGGAGGGATGGAGAATAGATGG + Intronic
1166173377 19:41048194-41048216 TTGGAGGGATGGTGAGCAGAGGG - Intergenic
1166850732 19:45759393-45759415 CGCTAGGGAGGGAGACCAGAGGG - Exonic
1167615370 19:50530099-50530121 CTGTGGGGATGGAGAGGAAATGG - Intronic
1168276883 19:55283893-55283915 CTGGAGGGATGGAGAGGAGGTGG - Intronic
1168340683 19:55621588-55621610 CGCTAGTGATGGAGAGCAGAGGG - Exonic
1168490902 19:56808155-56808177 GGGCAGGGATGGTGATCAGAAGG + Intronic
1168575205 19:57503446-57503468 CTGTGGGGATAGACATGAGATGG + Intronic
925443524 2:3908410-3908432 CTGTAGGGGTGGGGATCTCATGG - Intergenic
927142134 2:20137720-20137742 CTGGAGGGTTGGGGGTCAGAAGG - Intergenic
929303116 2:40328831-40328853 CTGGAGGCAAGCAGATCAGATGG - Intronic
930715357 2:54588717-54588739 CTGTAGAGATGGAGAGTAGCAGG + Intronic
931193492 2:60027997-60028019 CTTTAGGGATGGAAAACAGTGGG - Intergenic
931940637 2:67248050-67248072 TTGAAGGGATGTAGAACAGATGG - Intergenic
932052496 2:68412693-68412715 CTGTAGTGAAGGAGAGCAGAGGG - Intergenic
932891734 2:75602800-75602822 CTGTACAGCTGGAGAACAGAGGG + Intergenic
935979548 2:108613487-108613509 GTGTAGGGAGGGAGGGCAGAAGG - Intronic
936712007 2:115142445-115142467 CCCCAGGGATGGAGATCAGATGG + Intronic
937103108 2:119286740-119286762 CTGCAGGGAAGGACACCAGACGG + Intergenic
937478786 2:122238584-122238606 CTGAAGGGATAGGGAACAGAAGG - Intergenic
938953571 2:136278883-136278905 CTGAAGCCATGGAGATCTGATGG + Intergenic
939148779 2:138448374-138448396 CAGTTGGGCAGGAGATCAGAAGG + Intergenic
939786237 2:146516692-146516714 CAGTAGAGATGGAGATAAGCGGG + Intergenic
940719886 2:157270609-157270631 ATGAATGGATGGAGATGAGATGG - Intronic
942175794 2:173333526-173333548 CAGAAAGCATGGAGATCAGAAGG - Intergenic
942758429 2:179369355-179369377 CAGTAGGGATGGAGGACCGAGGG - Intergenic
944679372 2:202062972-202062994 TCCTAGGGATGGAGATGAGAAGG - Intergenic
947618497 2:231573986-231574008 CTAGAGGGCTGGTGATCAGAGGG + Intergenic
948391737 2:237616348-237616370 CTGTAAGGATGGATATTGGACGG - Intergenic
1170537885 20:17359472-17359494 GTGTGGGAATGGAGCTCAGATGG - Intronic
1170687689 20:18584345-18584367 CAGGAGGGATGGAGAGAAGAGGG + Intronic
1171721092 20:28564065-28564087 CTGAAGTGATGGAGCTCAGTGGG - Intergenic
1172323421 20:34015801-34015823 CTGTAGGGATGGGGAAAAGTAGG - Intronic
1172811983 20:37654684-37654706 CTGCAGGGATGGAGCTCTCATGG - Intergenic
1173614550 20:44394324-44394346 ATGGGGAGATGGAGATCAGAGGG - Intronic
1174339834 20:49888775-49888797 TGGTGGGGAGGGAGATCAGATGG - Exonic
1175283485 20:57820971-57820993 CTGTAGGGATGGATTGCAGAGGG + Intergenic
1176457823 21:6928780-6928802 CTCTGGGGACGGAGAGCAGAGGG + Intergenic
1176835995 21:13793864-13793886 CTCTGGGGACGGAGAGCAGAGGG + Intergenic
1177089093 21:16743660-16743682 CAGTAGGCATGGAGATCACCTGG - Intergenic
1178644336 21:34373028-34373050 CTGTCTGGATGCAGAGCAGAGGG - Intergenic
1179838955 21:44057947-44057969 GTGCAGTAATGGAGATCAGAAGG + Intronic
1181548561 22:23620981-23621003 CTGTGAGGATGGAGTTCAGCGGG - Intronic
1182464640 22:30506737-30506759 CTGCAGGGGTGGAGATCCTAGGG + Intergenic
1182966465 22:34526208-34526230 CTGTAGAGATGGAAAGCATATGG - Intergenic
1183399348 22:37592871-37592893 CTGTGGGGATTGAGAAAAGAGGG - Intergenic
950634678 3:14306555-14306577 CTGCAGGGAGGGAGAGTAGAAGG - Intergenic
952102668 3:30032950-30032972 CTGAGGGGATGGAGGTAAGAGGG + Intergenic
953726105 3:45400590-45400612 GTGCTGGGGTGGAGATCAGATGG + Intronic
953931011 3:47005653-47005675 GTGTAGGGATGGAGAGCAGATGG + Intronic
954225305 3:49177338-49177360 CTGTAGAGAGGAAGATTAGAGGG - Intergenic
955202694 3:56865133-56865155 CTGTGGGGATGGCGAGCACATGG + Intronic
955579171 3:60400449-60400471 CTGGAGGTATAGAGATAAGAGGG - Intronic
955822455 3:62910380-62910402 CTGTAGGGAGAGAGATGACAAGG - Intergenic
956136060 3:66100268-66100290 CTGTGGGGATGGAGAGCATGAGG - Intergenic
956520057 3:70094196-70094218 CGATAGGGATGGAGAGCAGCAGG - Intergenic
958756268 3:98252904-98252926 CCGTAGGGAGGGAGAGCATAAGG + Intergenic
960519939 3:118643101-118643123 CTGTAGGCATGGAGGTCTGAGGG - Intergenic
961978547 3:131052766-131052788 CTGTAGGGCTTTAGGTCAGAGGG - Intronic
963704163 3:148665196-148665218 CTGTAGGGGTGTAGATGAGGAGG - Intergenic
964434732 3:156639664-156639686 CTGTAGGGAATGAGATCAGAGGG - Intergenic
965725635 3:171712298-171712320 TTCTAGGGATGGAGACGAGAGGG + Intronic
965768634 3:172157588-172157610 ATTTAGAGATGGAGAACAGATGG - Intronic
968627623 4:1634308-1634330 GGGCAGGGATGGAGCTCAGAGGG - Intronic
968953929 4:3708655-3708677 CTGAAGGGATGGAGGTCCGCAGG + Intergenic
969195354 4:5558889-5558911 CTGTTGGAATGGAGAGGAGAAGG + Intronic
975621342 4:76299884-76299906 GTGCAGGGATGGAGAACAGCAGG + Intronic
977424815 4:96854061-96854083 CTCTAGGGATGGATATGAGCAGG - Intergenic
978684619 4:111424528-111424550 TTGCAGGGATGGAGAACAGGTGG - Intergenic
981862568 4:149375188-149375210 CTGTTGGGAAGAATATCAGAAGG + Intergenic
982101682 4:151974683-151974705 CTGTACGGATTGAGCACAGATGG - Intergenic
982916308 4:161213960-161213982 GTGTAGGGAAGTAGATAAGAAGG + Intergenic
984823355 4:183903849-183903871 GGGTAGGGTTGGAGAGCAGAAGG + Intronic
986228372 5:5838614-5838636 CTGCAGGGAGAAAGATCAGAGGG + Intergenic
989082496 5:37638167-37638189 GTATAGGGATACAGATCAGATGG - Intronic
989304203 5:39932611-39932633 ATGTAAGGGTGGAGATGAGAGGG + Intergenic
990708740 5:58559610-58559632 CTGTAGGGCTGGATATCAGGAGG - Intergenic
994607112 5:101982009-101982031 CGGTAGAGATGGAGATGAGCAGG + Intergenic
996496749 5:124166299-124166321 CTTTAGTGATGGAACTCAGATGG + Intergenic
998149553 5:139748966-139748988 CTGTTGGGATGGAGTGCAGGTGG + Intergenic
1000707776 5:164533001-164533023 TGGTATGGAGGGAGATCAGAAGG + Intergenic
1001404437 5:171465949-171465971 AGGAAGGGAAGGAGATCAGATGG + Intergenic
1002079458 5:176728735-176728757 CTGTCGGGATGGAGAGAAGAAGG + Intergenic
1002258632 5:177978587-177978609 CTGTGGGACTGGAGAGCAGACGG + Intergenic
1002501229 5:179648959-179648981 CTGTGGGACTGGAGAGCAGACGG - Intergenic
1003360540 6:5421051-5421073 CTGTAGGGGTGGAGTTCTCATGG - Intronic
1003480057 6:6522993-6523015 CTGAAGGCATGGAGAACAGGAGG + Intergenic
1005257676 6:24021516-24021538 ATGTAGGGAATGAGATTAGAAGG + Intergenic
1005928859 6:30466068-30466090 CCCTAGGGATGGAGAACAGAAGG + Intergenic
1007715940 6:43856229-43856251 GAGCAGGGATGGAGATGAGAGGG + Intergenic
1008508716 6:52256215-52256237 ATGTGGGGCTGGAGAGCAGATGG - Intergenic
1011092413 6:83620260-83620282 AAGAAGAGATGGAGATCAGAAGG - Intronic
1012823870 6:104123755-104123777 CTGCAGGGATGGAGATTTCATGG + Intergenic
1015216157 6:130752078-130752100 CTGAATGGATGCAGAACAGAGGG + Intergenic
1016117389 6:140303776-140303798 CTGCAGAGAAGGAGAGCAGAGGG - Intergenic
1020034050 7:4953135-4953157 CTGTAGGGATGGAGGAAACAGGG - Intronic
1021264173 7:18498437-18498459 CTGTAGGGCTAGGGAACAGATGG + Intronic
1021667400 7:22998649-22998671 CTGTGGAGATGGAGAGCAGATGG - Intronic
1023218845 7:37897347-37897369 CTGGAGGGATGGAGACAACAGGG + Intronic
1024346947 7:48322882-48322904 CTATAGTGATAGAGAACAGATGG - Intronic
1028068720 7:86421970-86421992 TTCTAGGGATAGAGATCACATGG - Intergenic
1030124116 7:106138532-106138554 CTGTGGAGAGGGAGATGAGAGGG + Intergenic
1030194530 7:106840635-106840657 CTGTAGGCCTGGAGATGAGGTGG - Intergenic
1030559089 7:111063092-111063114 CTGTAGGGGTGGAGCTCTCATGG - Intronic
1032998881 7:137480937-137480959 AGGTAGGGATGGAGAACAGAAGG - Intronic
1035477521 7:159153691-159153713 CTGTAGCTCTGGAGAACAGAAGG + Intergenic
1038834701 8:31106449-31106471 CAGTAGAGAATGAGATCAGAGGG - Intronic
1039845316 8:41321612-41321634 CGGTGGGGCTGGAGAGCAGAGGG + Intergenic
1041078070 8:54187274-54187296 CAGCAGGGATGGAGTGCAGAGGG - Intergenic
1041477130 8:58278938-58278960 CAGTAGGGGAGGAGAGCAGAAGG - Intergenic
1041753561 8:61288261-61288283 CGGGAGGGATGGAGTGCAGAGGG - Intronic
1044220418 8:89663371-89663393 CTGTAGGGGTGGAGCTCTCATGG - Intergenic
1044429878 8:92095942-92095964 CTGTTTGGATGGAGGTGAGATGG - Intronic
1045215292 8:100143521-100143543 CTGAGAGGATGTAGATCAGAAGG - Intronic
1046550459 8:115709384-115709406 CTTTAGGGAGGAAGACCAGAGGG - Intronic
1047576277 8:126159209-126159231 CTGCAGGGCTGGACGTCAGAAGG - Intergenic
1048856915 8:138693945-138693967 CTGTAGAAATGTAGCTCAGAGGG + Intronic
1052332119 9:27280871-27280893 CAGTAGGGAGGTAGATCAGGAGG + Intergenic
1053105537 9:35405006-35405028 CTATAGGGTTGAATATCAGAGGG - Exonic
1053599355 9:39594320-39594342 CTGTTGGTATGGAGGACAGAAGG + Intergenic
1053857060 9:42348506-42348528 CTGTTGGTATGGAGGACAGAAGG + Intergenic
1056010176 9:82320953-82320975 ATGTAGGAATGGAGGCCAGAAGG - Intergenic
1058843747 9:108934964-108934986 CAGTAGGGATGGCGAGAAGAGGG + Intronic
1059759003 9:117320736-117320758 CTGTAGGTAAGGAAATCAAAGGG - Intronic
1059985376 9:119815720-119815742 CTGAAAGGAGGGAGACCAGAGGG - Intergenic
1060411033 9:123400419-123400441 ATGGAGGGATGGACATCAGCTGG + Intronic
1060865050 9:126988928-126988950 CTTTAGGGAGGGAGGCCAGAAGG + Intronic
1061644250 9:131987336-131987358 CTGTAGATGTGGAGATGAGAAGG + Intronic
1062480274 9:136747840-136747862 CTGGAGGGCTGGAGAACTGAAGG - Intronic
1062480338 9:136748089-136748111 CTGTAGGGCTGGAGAACTGGAGG - Intronic
1186503219 X:10068703-10068725 CTGCAGAGATGGAGATAAGATGG - Intronic
1187270025 X:17771657-17771679 ATGTAGGAATGAATATCAGAAGG - Intergenic
1187567035 X:20461021-20461043 CTGTAGAGATGGAGAACAGATGG - Intergenic
1188246640 X:27842709-27842731 CTGTAATGATGGATATGAGACGG - Intergenic
1189960559 X:46320820-46320842 CTGGAGGTATAGAGATGAGAAGG + Intergenic
1192226887 X:69235043-69235065 CTGTAAGGATTGAGAGAAGAAGG + Intergenic
1194259707 X:91678005-91678027 CTGTAGGGGTGGAGTTCTCATGG - Intergenic
1195683020 X:107562871-107562893 CTTTAGGAATGAAGATCAGGAGG + Intronic
1197129506 X:122988815-122988837 CTGTAGCAATGGAGAAAAGATGG - Intergenic
1198405061 X:136304127-136304149 CTGTAGATATGGAGAGCAGATGG + Exonic
1200578407 Y:4917198-4917220 CTGTAGGGGTGGAGTTCTCATGG - Intergenic
1201720473 Y:17090723-17090745 ATGTAGAGATGGAGAGCTGATGG - Intergenic
1201759711 Y:17523413-17523435 CTGAAGGGGTGGAGAGCACAAGG + Intergenic
1201841843 Y:18382577-18382599 CTGAAGGGGTGGAGAGCACAAGG - Intergenic
1202163271 Y:21957664-21957686 CTGAAGGAATAGAGATGAGAAGG + Intergenic
1202228085 Y:22628704-22628726 CTGAAGGAATAGAGATGAGAAGG - Intergenic
1202315072 Y:23567472-23567494 CTGAAGGAATAGAGATGAGAAGG + Intergenic
1202555729 Y:26103121-26103143 CTGAAGGAATAGAGATGAGAAGG - Intergenic