ID: 1077472416

View in Genome Browser
Species Human (GRCh38)
Location 11:2770239-2770261
Sequence GACCGCCCTGTGAAGTCTGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 69
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 62}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077472416_1077472420 -7 Left 1077472416 11:2770239-2770261 CCTCCAGACTTCACAGGGCGGTC 0: 1
1: 0
2: 0
3: 6
4: 62
Right 1077472420 11:2770255-2770277 GGCGGTCTGGGTGCAGACCCTGG 0: 1
1: 0
2: 1
3: 44
4: 276
1077472416_1077472423 9 Left 1077472416 11:2770239-2770261 CCTCCAGACTTCACAGGGCGGTC 0: 1
1: 0
2: 0
3: 6
4: 62
Right 1077472423 11:2770271-2770293 ACCCTGGCACAGGCAGCCCTGGG 0: 1
1: 0
2: 5
3: 46
4: 329
1077472416_1077472421 -1 Left 1077472416 11:2770239-2770261 CCTCCAGACTTCACAGGGCGGTC 0: 1
1: 0
2: 0
3: 6
4: 62
Right 1077472421 11:2770261-2770283 CTGGGTGCAGACCCTGGCACAGG 0: 1
1: 0
2: 5
3: 41
4: 377
1077472416_1077472422 8 Left 1077472416 11:2770239-2770261 CCTCCAGACTTCACAGGGCGGTC 0: 1
1: 0
2: 0
3: 6
4: 62
Right 1077472422 11:2770270-2770292 GACCCTGGCACAGGCAGCCCTGG 0: 1
1: 0
2: 3
3: 57
4: 381

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077472416 Original CRISPR GACCGCCCTGTGAAGTCTGG AGG (reversed) Intronic
900365590 1:2310797-2310819 GGCCCCCCTGTGAGGTCAGGTGG - Intergenic
901037109 1:6343050-6343072 GCCCGCCCTGGGAAGCCTGAGGG - Intronic
904391018 1:30186025-30186047 GAGCTCCCGGGGAAGTCTGGCGG - Intergenic
907461363 1:54607583-54607605 GACAGCCCTGTGTGGGCTGGAGG + Intronic
907937420 1:59055224-59055246 GTCAGCCATGTGAAGACTGGAGG + Intergenic
913529757 1:119725355-119725377 GATAGCACTGTGGAGTCTGGTGG + Intronic
917028982 1:170669115-170669137 GACAGGCCTGTGAAGTCCGAAGG + Intronic
923107375 1:230865162-230865184 TGCCTCTCTGTGAAGTCTGGTGG - Intronic
1066211354 10:33242146-33242168 GACAGCCCTGTGTCTTCTGGGGG - Intronic
1066477879 10:35765253-35765275 GAGCGCCCTGGGAGGTCCGGGGG - Intergenic
1067062455 10:43084830-43084852 AACCGCCCTGTGAAGGATGGAGG + Intronic
1077472416 11:2770239-2770261 GACCGCCCTGTGAAGTCTGGAGG - Intronic
1077913195 11:6592307-6592329 CACAGAACTGTGAAGTCTGGAGG - Intronic
1083625700 11:64071002-64071024 GGCCGCTCTGTGAACTGTGGAGG - Intronic
1083882237 11:65554296-65554318 AAGCGCCCAGTGAAGTCCGGGGG + Exonic
1088332267 11:108666058-108666080 GACAGACCTGTGGAGTCTGGAGG - Intronic
1089306230 11:117528020-117528042 AACGGCCTTGTGAAGTCTGGAGG - Intronic
1089776228 11:120838178-120838200 CACTGGCCTGTGAAGTCAGGAGG + Intronic
1093632543 12:21426395-21426417 GAAAGCCATGTGGAGTCTGGGGG - Intergenic
1104042453 12:125139352-125139374 GAACCCGCTGTGAAGGCTGGCGG - Intronic
1106397523 13:29395266-29395288 GACCACCTTGTTCAGTCTGGAGG + Intronic
1110188308 13:72700917-72700939 TACCGCCCTGTGCTGTCTAGTGG + Intergenic
1120037855 14:79718205-79718227 GTCAGGTCTGTGAAGTCTGGGGG + Intronic
1122263287 14:100535199-100535221 GAGAGCCCTGTGAGGTGTGGAGG + Intergenic
1122969253 14:105145842-105145864 GACCACCCTGTGAGGCCTGGGGG - Exonic
1131035119 15:89217077-89217099 GACGGCCCTGGGAAGACGGGAGG - Intronic
1137574971 16:49593512-49593534 GAACCCTCTCTGAAGTCTGGCGG + Intronic
1141667560 16:85473818-85473840 GACCTCTCTGAGAAGTCTGGTGG + Intergenic
1143495243 17:7308543-7308565 AACCCTCCTGTGAAGTGTGGCGG + Intronic
1144627259 17:16850526-16850548 GAACGCCCTTTGAGGTCAGGTGG - Intergenic
1144879180 17:18422186-18422208 GAACGCCCTTTGAGGTCAGGTGG + Intergenic
1145153055 17:20522201-20522223 GAACGCCCTTTGAGGTCAGGTGG - Intergenic
1147338848 17:39742201-39742223 AACCGCCGTGTGAGGTCAGGAGG + Intronic
1148070577 17:44906387-44906409 GACTGCCCCGTGCAGACTGGAGG - Intronic
1152198193 17:78929822-78929844 GGGAGCCCTGTGAAGTATGGGGG + Intergenic
1161355499 19:3817133-3817155 GCCCGCCCCGCGAGGTCTGGTGG + Intronic
1165318076 19:35068770-35068792 CCCTGCCCTGGGAAGTCTGGGGG + Intergenic
1167851955 19:52208941-52208963 AGCCTCTCTGTGAAGTCTGGGGG - Intronic
930285018 2:49416612-49416634 CACCTCACTGTGAAGTTTGGTGG - Intergenic
931836560 2:66105112-66105134 GAACTGCCTGTGAAGTCAGGAGG + Intergenic
932404431 2:71503992-71504014 TTCCGCCCTGTGAGGCCTGGGGG + Intronic
932414168 2:71563889-71563911 GCCAGCCCTGGGAGGTCTGGGGG + Intronic
946248227 2:218399045-218399067 GGCCGCCCTGTGATTACTGGGGG - Intronic
1169045180 20:2529279-2529301 GAACGCCCTGTGACTTTTGGTGG + Intergenic
1173120604 20:40285973-40285995 GACCGCCTTTTGAGGTTTGGTGG + Intergenic
1180200103 21:46219137-46219159 GACGCCCCTGTGCAGGCTGGGGG + Intronic
1183626130 22:39003355-39003377 GACCGCCCTGGCAAGTCTGCTGG + Intergenic
953290860 3:41660637-41660659 GACCTCCCTTTGAAGTAAGGGGG + Intronic
957173449 3:76771119-76771141 GACCGTGCTGTTAAGTGTGGTGG + Intronic
960090873 3:113636926-113636948 AACAGCCCTGTGAAGTATGCAGG + Intergenic
960789113 3:121407312-121407334 AACCGCCATATGAAGTTTGGAGG + Exonic
965747221 3:171938078-171938100 GCCTGCCCTGGGAAGCCTGGTGG + Intronic
984570926 4:181392464-181392486 AACCCCCCTGTGAAGACTTGAGG - Intergenic
987815714 5:22899285-22899307 GACTCTCCTGTGAAGTCTAGTGG + Intergenic
999237203 5:150106060-150106082 GATCGCCCTGTGCAGTGTGCTGG - Intronic
1015304862 6:131696515-131696537 GTCTGCCCTGTGCAGTCTGTCGG + Intronic
1021627429 7:22608181-22608203 GCCTGCCCTGTGAATTTTGGAGG + Intronic
1021688645 7:23211546-23211568 GTCATCGCTGTGAAGTCTGGTGG + Intergenic
1026326770 7:69317344-69317366 GACCTCCCTGCCAAGTCTGCAGG + Intergenic
1034550494 7:151817516-151817538 GACAGCCTTGGGAAGCCTGGGGG - Intronic
1038173414 8:25159739-25159761 GACAGCTCTGAGAAGTCTAGAGG + Intergenic
1042681010 8:71384346-71384368 GAACAGCCAGTGAAGTCTGGGGG - Intergenic
1047203229 8:122782994-122783016 GACCGTCCTGTGATGCCTGCTGG - Intronic
1048519553 8:135140962-135140984 GACCACCATGTGGAGTCTTGGGG + Intergenic
1057116165 9:92524400-92524422 GCAATCCCTGTGAAGTCTGGTGG + Intronic
1059289175 9:113207173-113207195 GAACACCCTCTGAAGTTTGGTGG - Intronic
1062243714 9:135552794-135552816 GCCCGCCCTGTGAGGCCTGAAGG - Intergenic
1062495075 9:136827824-136827846 GACCATCCTGGGAACTCTGGGGG - Intronic
1189890808 X:45600376-45600398 GACTGGCATGTGAAGTCTTGTGG - Intergenic