ID: 1077472425

View in Genome Browser
Species Human (GRCh38)
Location 11:2770273-2770295
Sequence TGCCCAGGGCTGCCTGTGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 652
Summary {0: 1, 1: 0, 2: 7, 3: 76, 4: 568}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077472425_1077472430 0 Left 1077472425 11:2770273-2770295 CCTGGCACAGGCAGCCCTGGGCA 0: 1
1: 0
2: 7
3: 76
4: 568
Right 1077472430 11:2770296-2770318 AGTTCTTCCCCAGCTGTGAGGGG 0: 1
1: 0
2: 2
3: 16
4: 190
1077472425_1077472436 21 Left 1077472425 11:2770273-2770295 CCTGGCACAGGCAGCCCTGGGCA 0: 1
1: 0
2: 7
3: 76
4: 568
Right 1077472436 11:2770317-2770339 GGAATGAGAGCCTAAGGGTTTGG 0: 1
1: 0
2: 2
3: 18
4: 280
1077472425_1077472429 -1 Left 1077472425 11:2770273-2770295 CCTGGCACAGGCAGCCCTGGGCA 0: 1
1: 0
2: 7
3: 76
4: 568
Right 1077472429 11:2770295-2770317 AAGTTCTTCCCCAGCTGTGAGGG 0: 1
1: 0
2: 0
3: 18
4: 200
1077472425_1077472435 16 Left 1077472425 11:2770273-2770295 CCTGGCACAGGCAGCCCTGGGCA 0: 1
1: 0
2: 7
3: 76
4: 568
Right 1077472435 11:2770312-2770334 TGAGGGGAATGAGAGCCTAAGGG 0: 1
1: 0
2: 0
3: 13
4: 188
1077472425_1077472434 15 Left 1077472425 11:2770273-2770295 CCTGGCACAGGCAGCCCTGGGCA 0: 1
1: 0
2: 7
3: 76
4: 568
Right 1077472434 11:2770311-2770333 GTGAGGGGAATGAGAGCCTAAGG 0: 1
1: 0
2: 2
3: 29
4: 319
1077472425_1077472428 -2 Left 1077472425 11:2770273-2770295 CCTGGCACAGGCAGCCCTGGGCA 0: 1
1: 0
2: 7
3: 76
4: 568
Right 1077472428 11:2770294-2770316 CAAGTTCTTCCCCAGCTGTGAGG 0: 1
1: 0
2: 0
3: 26
4: 240

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077472425 Original CRISPR TGCCCAGGGCTGCCTGTGCC AGG (reversed) Intronic
900129052 1:1079978-1080000 TCCCCAGGCCTGGCAGTGCCAGG - Intergenic
900309260 1:2025451-2025473 TGCCCTGGGCTGCATGCCCCTGG + Intronic
900392771 1:2440954-2440976 TGCCAAGATCTGGCTGTGCCCGG + Intronic
900514831 1:3076674-3076696 GGGCCAGGGCTGCCTTTGCATGG + Intronic
900647847 1:3717159-3717181 TGCCCAAACCTGCCCGTGCCGGG + Intronic
900963914 1:5944380-5944402 GGCCCAGGGCGGGCTGTGGCAGG - Intronic
901050469 1:6423735-6423757 TTTCCAGTGCTGACTGTGCCAGG + Intronic
901194330 1:7432004-7432026 GGACCAGGGTTGCCTCTGCCTGG - Intronic
901323878 1:8355778-8355800 TGCCCTTGGGTGCCTCTGCCTGG + Intronic
901681638 1:10916259-10916281 GGCCCAGGCCTGCCTTTTCCTGG - Intergenic
901768661 1:11519543-11519565 GACCCAGCGCTGCCTCTGCCAGG + Intronic
902058877 1:13624799-13624821 TGGCCAGAGCTTCCTGTGCCAGG + Intergenic
902286660 1:15411711-15411733 AGCCCTGGGCTGCCTGTGCCAGG - Intronic
902449319 1:16486544-16486566 TCTCCAGGGCTGCCTTGGCCCGG + Intergenic
902505429 1:16936733-16936755 TCTCCAGGGCTGCCTCGGCCCGG - Exonic
902771137 1:18646332-18646354 TGCCCAGAGCTGCCTGTTACAGG + Intronic
902822503 1:18951767-18951789 TGGCCAGCGCTGCCTATGCCTGG + Intronic
902878222 1:19353565-19353587 CTCCCAGGGCTGCCTGATCCAGG + Intronic
902879122 1:19359456-19359478 TGCCCAGGGCTCCCTCAGGCAGG + Intronic
903349777 1:22710787-22710809 TGCCCAGCGCTGGCGGAGCCCGG + Intergenic
903573249 1:24321871-24321893 TGCCCAGGGCTGCGGGCTCCAGG - Intronic
903646379 1:24898578-24898600 TGCTCTGGGCAGCCTCTGCCAGG - Intergenic
903660032 1:24971387-24971409 AGCCAAGGGCTGCCTGAACCTGG + Intergenic
904005624 1:27361704-27361726 TGCCCAGGGCGACCAGTGCTTGG - Exonic
904058353 1:27686873-27686895 TGCCCAAGGGTGCCTCTGCCGGG - Intergenic
904489934 1:30852330-30852352 TGCCCAGGGCTGGCTCTGGATGG - Intergenic
905003075 1:34688620-34688642 TGCCCAGGTCTGTCTGGCCCTGG - Intergenic
905472938 1:38207017-38207039 AGCCCAGGGCTGCCTGATTCTGG + Intergenic
905734636 1:40316862-40316884 TGCCCCACGCTGCCTGTCCCGGG + Intronic
905789597 1:40783219-40783241 TGCCCAGTGCTGTGTGTGGCTGG - Intergenic
905897500 1:41558197-41558219 TTCCCAATGCTGCCTGGGCCGGG - Intronic
906248550 1:44293937-44293959 TTCCCAGGGCTTTCTCTGCCCGG - Intronic
906477568 1:46180363-46180385 TGCCCAGGGCTGGTGTTGCCAGG + Intronic
906780298 1:48567402-48567424 TGCCCAGCACTGCATGAGCCTGG + Intronic
907047161 1:51306285-51306307 TGCCCATGGCTGAGTGTGCCAGG - Intronic
907456832 1:54581594-54581616 TGGCCAGGTCTGCCAGGGCCTGG + Intronic
908847347 1:68338585-68338607 TGTCCAGGGCTGGCTGGGCATGG + Intergenic
911062817 1:93762545-93762567 TGGCCTGGCCTGCCTTTGCCTGG - Intronic
912384244 1:109263430-109263452 TGCCCAGGCCTGCCTCTGACTGG - Intronic
913086858 1:115446937-115446959 AGCCAATGCCTGCCTGTGCCAGG + Intergenic
915168771 1:153963434-153963456 TGCCCAGGCCTCCCCGGGCCCGG - Exonic
915530775 1:156500944-156500966 TCCCCAGGGCTGGCCGGGCCAGG + Intergenic
916122892 1:161544655-161544677 TGCCCAGGGACGCCTGTGTGTGG - Intronic
916132796 1:161626099-161626121 TGCCCAGGGACGCCTGTGTGTGG - Intronic
916497841 1:165361107-165361129 TGCCTAGGGCTGTCCTTGCCAGG - Intergenic
919452556 1:197788357-197788379 AGCCCAGGTCTGCAGGTGCCAGG + Intergenic
919674298 1:200366338-200366360 GGCCCAGGGCAGCATGTGCTGGG + Intergenic
920375177 1:205504489-205504511 TCCCCAGGGCTCCCTCTGCCCGG - Intergenic
920572911 1:207031491-207031513 CACTCAGGGCTGCGTGTGCCAGG + Intronic
920851489 1:209631026-209631048 TGCCAAGCGCTGCCTCTGACTGG - Intronic
922707542 1:227797202-227797224 TGCCCAGGGCTTCCTGTCTGTGG - Intergenic
922777173 1:228220364-228220386 TGCACAGGGCTTCCTCGGCCAGG - Intronic
922930040 1:229381881-229381903 TGCCCAAGGGTGCCAGTGCCAGG + Intergenic
923029496 1:230236166-230236188 AGCCCTGGTCTGACTGTGCCTGG - Intronic
924947805 1:248857898-248857920 TGCCCAGGGCTGAGGGTGGCTGG - Intronic
1063499001 10:6536354-6536376 TGCCCTTGACTGCCTGAGCCCGG + Intronic
1063877541 10:10495738-10495760 TGCCCAGGTCTCCCTGGGCACGG - Intergenic
1063995187 10:11611851-11611873 CGCCCAGGGCTGCAGGTGCCCGG + Intergenic
1064016113 10:11773641-11773663 TGGTCAGGGCAGCCTGTGCTTGG - Intergenic
1064030495 10:11879981-11880003 TGGTCGGGGCTGCCTGTTCCTGG - Intergenic
1064167811 10:13001627-13001649 CGCCCAGGGCTGCCCTTCCCGGG - Exonic
1064748789 10:18504357-18504379 TGTCCTGGGCTTGCTGTGCCAGG - Intronic
1064990751 10:21254820-21254842 TGCCCATGACTGCCTGACCCTGG + Intergenic
1065225648 10:23541365-23541387 TGGCAAAGGCTGCATGTGCCCGG + Intergenic
1067053169 10:43036906-43036928 TGCCCATGCCTGCGTGAGCCTGG + Intergenic
1067085353 10:43235229-43235251 TGCCCAGGTATGCTGGTGCCTGG - Intronic
1067105490 10:43363259-43363281 TGCCCCTTGCTGCCTGTGCGTGG - Intergenic
1067283524 10:44890979-44891001 CTCCCAGGGGGGCCTGTGCCTGG - Intergenic
1067337087 10:45374594-45374616 TGCCCTGGGCTCCCAGTGGCCGG + Intronic
1069034008 10:63629704-63629726 TGCCCTGAACTGCCTGTACCAGG + Intergenic
1069610994 10:69772448-69772470 TCCCCATGGCTGTCTGTGCTAGG + Intergenic
1069980037 10:72246055-72246077 TTCCCAGGGTTCCCAGTGCCTGG - Intergenic
1070564560 10:77593895-77593917 TGCCCAGAGCTGCCTTGGCTCGG + Intronic
1070832170 10:79424782-79424804 GGCCCAGGGCTCACAGTGCCCGG + Intronic
1070918379 10:80169141-80169163 TACCCAGGGGCCCCTGTGCCGGG - Exonic
1071433229 10:85622952-85622974 TGCCTAGAGCTCCCTGTGCATGG + Intronic
1072803527 10:98409616-98409638 TGGGCAAGGCTGCATGTGCCAGG + Intronic
1072959176 10:99913959-99913981 TGCCCAGAGCTGGCTGTGTGTGG + Intronic
1073574850 10:104613798-104613820 AGCCCTGGGCTGCCTGTGTGAGG - Intergenic
1074371951 10:112907343-112907365 AGCCCAGGGCTGACTTTGGCTGG - Intergenic
1074641012 10:115380537-115380559 TGCCCAGGGCTACCAGAGGCAGG - Intronic
1075333358 10:121591333-121591355 TCCCGTGGGCTGGCTGTGCCAGG - Intronic
1075800972 10:125153047-125153069 AGCCAAGTTCTGCCTGTGCCAGG + Intronic
1076604144 10:131678365-131678387 TGCCCACGGCGGCCTGTGCGGGG - Intergenic
1076857118 10:133122801-133122823 TGCCTGGGGATGCGTGTGCCTGG - Intronic
1076888133 10:133271849-133271871 CGTCCAGGGCTGCCGCTGCCAGG - Exonic
1077044940 11:540558-540580 TGCCAAGGGCTTGCTGTGACGGG + Intronic
1077091313 11:779600-779622 TTCCCAGGATTGGCTGTGCCGGG - Intronic
1077296942 11:1830819-1830841 CGCCCAGGGCCGCGTGTGACCGG + Intronic
1077297069 11:1831382-1831404 TGCCCAGGGCAGCCCCCGCCCGG + Intronic
1077355524 11:2115046-2115068 TGCCCAGGGGTGTCTGGGTCAGG - Intergenic
1077444982 11:2586687-2586709 TGCCCTCGCCTGCCTGTCCCTGG + Intronic
1077472425 11:2770273-2770295 TGCCCAGGGCTGCCTGTGCCAGG - Intronic
1077496772 11:2890457-2890479 TGCCCAGGGATGCCTGACTCTGG + Intronic
1077514797 11:2995036-2995058 TTCCCAGCGCTGCCTCTGCCAGG + Intergenic
1077522759 11:3046029-3046051 TGCCAGGGTCTGCTTGTGCCAGG - Intronic
1077541685 11:3149506-3149528 TGCCCATGTGTGCCTGTGGCAGG + Intronic
1077636436 11:3844685-3844707 TGCTCAGGCCTGCCTCTGTCAGG - Intergenic
1077673905 11:4181138-4181160 TGCCCTGATCTGCCTGAGCCTGG + Intergenic
1077991467 11:7415761-7415783 TGTACAGGGCTGCCGGTGACTGG + Intronic
1078431181 11:11290005-11290027 TCCCCAGGGCTACAAGTGCCTGG + Intronic
1078523819 11:12085612-12085634 GGCCCTGGGATGCCTGGGCCTGG + Intergenic
1079017262 11:16879663-16879685 TGCCCAGCTCTGCCTGTGCCAGG - Intronic
1081295430 11:41381072-41381094 TGCCCAGGGATGTTTTTGCCTGG - Intronic
1081617705 11:44600382-44600404 TGCCCATGGCTCCCTCTGCAGGG + Intronic
1081806030 11:45891020-45891042 TGCCCAGGACCGCCTTGGCCTGG + Intronic
1082086851 11:48057512-48057534 TACCCAAGGCTGCCCGTGACTGG - Intronic
1082243278 11:49892369-49892391 CCCCCAGAGCTCCCTGTGCCTGG - Intergenic
1083258366 11:61510006-61510028 GCCCCAGCCCTGCCTGTGCCCGG - Exonic
1083283922 11:61645555-61645577 TGCCTTGGACTACCTGTGCCAGG + Intergenic
1083678289 11:64340127-64340149 TGCCCAGGCCCGCCTGCACCCGG + Intergenic
1083815085 11:65128184-65128206 TCCCCATGGCTGCCTGGGACTGG + Exonic
1083855082 11:65389300-65389322 TGGCCTGGCCTGGCTGTGCCAGG + Intronic
1084091286 11:66880722-66880744 TGCCCCCTGCTTCCTGTGCCTGG - Intronic
1084423330 11:69071431-69071453 TCCCCAATGCTGGCTGTGCCTGG + Intronic
1084448679 11:69219281-69219303 TGGCCAGTGATACCTGTGCCTGG + Intergenic
1084544440 11:69807683-69807705 TGCTCAGGGCGGGCAGTGCCTGG - Intergenic
1084638518 11:70409967-70409989 GGCCCGCGGCTGCCTATGCCAGG + Intronic
1084730738 11:71071889-71071911 TGCCCAGGGCTCTTTGTGCCAGG - Intronic
1087774237 11:102243085-102243107 TGCCCAGGGCAGCCTGAGCAGGG + Intergenic
1088783927 11:113163805-113163827 TGCCCAGTGCTGCGGGTGCCGGG + Intronic
1089306398 11:117529018-117529040 TGTCCAGAGCTTCCTGTGTCAGG + Intronic
1089750545 11:120648318-120648340 TGCCCAGGGCAGCCTCTGGATGG + Intronic
1089897677 11:121948030-121948052 TCCCCAGGGCTGCTTATGACAGG - Intergenic
1090830700 11:130419023-130419045 TCCCCAGGGCTTCCGGAGCCAGG + Intronic
1091319680 11:134640725-134640747 TGCCCAGAGCCTCCTGTCCCTGG - Intergenic
1091420807 12:338468-338490 TACCCTGGGAAGCCTGTGCCTGG + Intronic
1091558417 12:1593454-1593476 GGCGGAGGGCTGCCTGGGCCTGG - Exonic
1091697879 12:2640290-2640312 TGCCCAGGCCAGCCTGGCCCAGG - Intronic
1091747142 12:2999684-2999706 TGGCCAGCGTTGGCTGTGCCAGG - Intronic
1092027450 12:5254615-5254637 TGCTCAGCACTGCCTGTGTCTGG - Intergenic
1092806264 12:12225906-12225928 TACCCACTGCTGCCTGTGCAAGG + Intronic
1092962217 12:13607079-13607101 TGCACAGGGCTGCCAGTGTGGGG - Intronic
1093518089 12:20014993-20015015 TCACCAGGGCTGACTGTGGCTGG - Intergenic
1094661089 12:32471231-32471253 GGCCCAGGGATGCCAGTGCCTGG - Intronic
1095277169 12:40300029-40300051 TGCACATGGCTGCCTGAGCTGGG + Intronic
1096171981 12:49479112-49479134 TGCCCAGCTCTGGCTGAGCCTGG + Intronic
1096193513 12:49634593-49634615 TGCCCAGGCCTACCTGTAACGGG - Exonic
1097102577 12:56600011-56600033 AGCCCAGGTGTGCTTGTGCCTGG - Exonic
1097225522 12:57475064-57475086 TCCTCCTGGCTGCCTGTGCCAGG + Intronic
1101082973 12:101208252-101208274 TGCCCAGGGGTGCCTCGCCCTGG + Intronic
1101156756 12:101935041-101935063 TGCACAGCTCTGGCTGTGCCAGG - Intronic
1101414842 12:104499883-104499905 AGCCCTGGGCTGGCTGTACCAGG - Intronic
1103924101 12:124414192-124414214 CTCCCCGGGCTGCATGTGCCAGG + Intronic
1103981365 12:124739012-124739034 TGCCTGGGGCTGCTGGTGCCGGG - Intergenic
1104590808 12:130083549-130083571 TGCCCAGGGAGGCCTGTGCTTGG + Intergenic
1104721556 12:131047414-131047436 GGCCCGGGGCTGCCTGCTCCTGG - Intronic
1104735667 12:131134667-131134689 TGCCCGGAGCTGTCAGTGCCAGG + Intronic
1104823853 12:131694540-131694562 TGCACACAGCTGCCTGTGCCTGG + Intergenic
1104843465 12:131835294-131835316 TGGGCGGGGCTGCCTGTCCCGGG + Intronic
1104897812 12:132172856-132172878 AGCCCAGGGCGGCCTGGACCTGG + Intergenic
1104924126 12:132305445-132305467 TGCCCAGGTCAGGCTGTGTCTGG - Intronic
1104956038 12:132466337-132466359 TTCCTGTGGCTGCCTGTGCCTGG + Intergenic
1104956121 12:132466654-132466676 TGACCAGGGACACCTGTGCCTGG + Intergenic
1104956137 12:132466718-132466740 TGACCTGGGACGCCTGTGCCTGG + Intergenic
1104956152 12:132466781-132466803 TGACCAGGGACACCTGTGCCTGG + Intergenic
1104986979 12:132602863-132602885 TGCTGAGGACTGCCCGTGCCAGG + Intergenic
1105006920 12:132727319-132727341 TGCCCAGGCCTGGCTTTGCGGGG + Exonic
1105052066 12:133063597-133063619 TTCCCAGGGCAGCCTGAGTCTGG - Intergenic
1105067649 12:133214882-133214904 AGCCCAGTGCTGCCTGGGCCTGG + Intergenic
1105068622 12:133220370-133220392 TGGCCATGGCAGCCTCTGCCTGG + Intronic
1106121000 13:26860069-26860091 AGCCCAGGGCTGGCTGAGCAAGG - Intergenic
1106170325 13:27283146-27283168 TGCTCTGGGCTGCCCGAGCCTGG - Intergenic
1106717043 13:32401269-32401291 TACCCAGGACTACCTGGGCCTGG + Exonic
1106717842 13:32409613-32409635 TGCGCTGCGCTGGCTGTGCCAGG - Intronic
1113421579 13:110175231-110175253 AGCCCTGGGATGCCTATGCCAGG + Exonic
1113448393 13:110387859-110387881 TGCCCTGGCTTGGCTGTGCCTGG + Intronic
1113848491 13:113405147-113405169 TCCCCAGGTCCGCCTGTGTCAGG + Intergenic
1113898036 13:113778001-113778023 AGCCCACAGCTGCCTGTGCCAGG + Intronic
1113946132 13:114044542-114044564 CGCCCAGGGCTGCCGGTGGGAGG - Intronic
1115652070 14:35409856-35409878 TGCGCAGGGCTGCTCCTGCCAGG + Intergenic
1118740624 14:68737010-68737032 GGTACAGGGGTGCCTGTGCCAGG + Intergenic
1119379337 14:74218591-74218613 GGGCAAGGTCTGCCTGTGCCTGG - Intergenic
1119435808 14:74597201-74597223 TGCCCGGGGCTCACTCTGCCTGG - Intronic
1121042404 14:90759852-90759874 TGCACAGGGGTGCCTGTGACGGG - Intronic
1121278404 14:92683196-92683218 TGCCCAGCCCTTCCAGTGCCAGG - Intronic
1121307686 14:92917299-92917321 TGTCCAGGGCTTGGTGTGCCTGG + Intergenic
1121410975 14:93748188-93748210 AGCCCAAGGGGGCCTGTGCCCGG + Intronic
1121449044 14:93996294-93996316 TGCCCAGGGCTGCCTCTCCATGG - Intergenic
1122023822 14:98860043-98860065 GGGCCAGGGCTGCAGGTGCCTGG + Intergenic
1122052837 14:99071734-99071756 GACCCAGGGCAGCCTGTTCCAGG - Intergenic
1122055446 14:99095079-99095101 TGCCCTGGGCCGCCTGGGCAGGG - Intergenic
1122061477 14:99139324-99139346 GGGCAAGGGCTGCCTGTCCCGGG - Intergenic
1122140000 14:99657393-99657415 TGCCCAGAGGGTCCTGTGCCAGG - Intronic
1122797312 14:104212513-104212535 TGCCAGGGGCTGTGTGTGCCAGG - Intergenic
1122899307 14:104775619-104775641 TCCCCACTTCTGCCTGTGCCTGG - Intronic
1122967593 14:105138574-105138596 TGCCCAGGGCCGCCTCAGCCAGG + Intergenic
1122973387 14:105161399-105161421 AGCCCAGGTGTGGCTGTGCCGGG - Intronic
1202904385 14_GL000194v1_random:59954-59976 TCCCCAGGACTGCATGCGCCAGG - Intergenic
1123707916 15:22963886-22963908 TTCCCGGGGCTGACTGGGCCTGG - Intronic
1123994848 15:25711350-25711372 TGCAGAGGGCTCACTGTGCCTGG - Intronic
1124372202 15:29110311-29110333 TCCCCTGGGCTGCCCCTGCCTGG + Intronic
1124666234 15:31595177-31595199 TGGACAGGGAAGCCTGTGCCTGG + Intronic
1125399649 15:39287420-39287442 TGCCCAGGGCTACCTGTTACTGG - Intergenic
1125511185 15:40293261-40293283 TGTCAAGGGCTATCTGTGCCAGG - Intronic
1125551356 15:40547320-40547342 TGCCCTGCCCTGCCTGAGCCTGG - Intronic
1125676551 15:41505230-41505252 AGCCCAGGGCTGCCACTACCTGG - Exonic
1127051633 15:55089914-55089936 TGCCCACAGCTGCCTGCCCCGGG + Intergenic
1127798159 15:62455679-62455701 TGCTCGGGGCTGCCTGTCACGGG + Intronic
1128473271 15:67974711-67974733 TCCCCAGTGCTGCCTGCCCCAGG + Intergenic
1128514003 15:68330997-68331019 TGCCAAGGGCTCCCACTGCCAGG + Exonic
1128616233 15:69112361-69112383 TGACCACCGCTGCCTATGCCAGG + Intergenic
1129171330 15:73809976-73809998 TGCCCAGGGCTGTGGGTGGCTGG - Intergenic
1129362972 15:75036077-75036099 TGCCCAGCGCTGCTTCTACCAGG + Intronic
1129364076 15:75043729-75043751 AGCCCAGCTCTGCCTGGGCCGGG - Intronic
1130183190 15:81651879-81651901 TGCCCAGCTCTGGCTGAGCCTGG - Intergenic
1130538293 15:84802522-84802544 TGCCCTGAGCTGCCAGTGCTGGG + Exonic
1130910780 15:88269552-88269574 TGCCAGGGGCTGTGTGTGCCAGG - Intergenic
1130966504 15:88701268-88701290 GGCCCAGGGGTGCCTGTCCCTGG + Intergenic
1131263535 15:90902684-90902706 CGCCCCGGCCTGCGTGTGCCCGG - Intronic
1132065659 15:98728648-98728670 TGCCCAGGGCCGCCTGGGCGGGG + Intronic
1132181196 15:99754087-99754109 TGCCCAGGCCTGCCTCTGCTAGG - Intergenic
1132230021 15:100174982-100175004 TGCCCAGGGCTGCATATTCTGGG - Intronic
1132339123 15:101066928-101066950 TGGCCATGGCTGCCTGTTTCTGG + Intronic
1132355410 15:101167984-101168006 CCCCCGGGGCTTCCTGTGCCTGG - Intergenic
1132393800 15:101457741-101457763 TGGCCAGGGCTGCCTGTGTGTGG - Intronic
1132576302 16:665943-665965 TCCCCAGAGCTGCCTCTGCCTGG + Exonic
1132602821 16:781579-781601 AGCCCAGCCCTGCCTGTGGCCGG + Intronic
1132668831 16:1094559-1094581 AGCCCAGGGGTCCCTGTGCAGGG + Intronic
1132671733 16:1104739-1104761 AGCTCAGGGCTGAATGTGCCTGG + Intergenic
1132695914 16:1201949-1201971 TGCCCGGCGCTGGCGGTGCCCGG - Exonic
1132722941 16:1325917-1325939 GGCCCTGGGCAGCCTGTGTCTGG + Exonic
1132904117 16:2273493-2273515 TGGCCTGGGCTGCCTGTATCCGG + Intergenic
1132929080 16:2449477-2449499 TTCCCAGGGATGCCTGTGTCGGG + Intronic
1132937819 16:2490522-2490544 TGCCTTGGGCTGCCTGAACCCGG + Intronic
1133201017 16:4204490-4204512 TGCCCAGGGCTGGGAGAGCCCGG - Intronic
1133384727 16:5360183-5360205 TGCCCAGGCCTGCGTGTCCACGG - Intergenic
1135101508 16:19610394-19610416 TGCCCGTGCCTACCTGTGCCGGG + Exonic
1137236747 16:46623894-46623916 TGCCCAGGTCACCCTGTGGCAGG - Intergenic
1137288234 16:47033833-47033855 AGCCCAGGGCTTCCTGGGCCTGG - Intergenic
1137798663 16:51242759-51242781 TGCCAAGAGCAGGCTGTGCCAGG - Intergenic
1137800965 16:51261903-51261925 TGCCCAGTGCTTAGTGTGCCAGG - Intergenic
1138505864 16:57478003-57478025 TGCCCAGGGCAGAGTGTGCCAGG - Intronic
1138558811 16:57788054-57788076 TGCCCAGGGCTGGCTGGTTCTGG - Intronic
1138565320 16:57828612-57828634 TGCCCAGGTCTGCCAGAGACGGG - Intronic
1139650466 16:68359660-68359682 GGCCCAGGGCCGGCTTTGCCTGG - Exonic
1139671826 16:68497431-68497453 AGCCCAGGGCAGCCTGGGGCAGG + Intergenic
1140207999 16:72949160-72949182 TGCCCATGTCGGCCTCTGCCGGG - Intronic
1140338893 16:74138110-74138132 AGGCCAGGGCTGCTTCTGCCTGG + Intergenic
1140358242 16:74323856-74323878 TGGCCAGGGCTTCCTCTGCCTGG - Intergenic
1140702021 16:77589707-77589729 TGCCCCAGGTTGCCTGTCCCAGG + Intergenic
1141604683 16:85145996-85146018 TGACCAGAGCTGCCTGTCCAGGG + Intergenic
1141624370 16:85253564-85253586 CTCCCAGGGCTCACTGTGCCAGG + Intergenic
1141667903 16:85475323-85475345 CCCTCAGGGCTGCCTGTACCTGG + Intergenic
1141669937 16:85486404-85486426 TGCCCAGGGCCGCCGTTACCTGG + Intergenic
1141889218 16:86915397-86915419 TGGCCATGGCAGGCTGTGCCTGG - Intergenic
1141983065 16:87561777-87561799 TGGCTAGGACTGCCTGTGCCTGG - Intergenic
1142309673 16:89305153-89305175 TGCTCCGGGCTGCCTGTGGAGGG + Intronic
1142866745 17:2796059-2796081 TCCCGAGGGCTGCCTGAGACAGG - Intronic
1142970646 17:3609392-3609414 GGGCCAGGCCTGCCTGAGCCTGG + Exonic
1143030387 17:3964213-3964235 AGCCGAGGGCGGCCTGAGCCCGG - Exonic
1143379452 17:6486966-6486988 AGCCCAGGTCTGCCGCTGCCAGG + Intronic
1143502427 17:7347150-7347172 TGCCCAGTGCTGCGACTGCCGGG + Exonic
1144457555 17:15431502-15431524 CACCCAGTGCTGCCTGTGCCAGG - Intergenic
1144782138 17:17813673-17813695 TGCCCTGGGCTGCTGGGGCCGGG + Exonic
1144817705 17:18047672-18047694 TCCCCAGAGTTGCCTGTTCCTGG + Intronic
1144887972 17:18476912-18476934 GGCACAGGGCTGCCTCAGCCAGG + Intronic
1144961189 17:19045053-19045075 AGCCCAGGGCTGGCTGTGTTGGG + Intronic
1144973972 17:19129471-19129493 AGCCCAGGGCTGGCTGTGTTGGG - Intronic
1145144236 17:20467391-20467413 GGCACAGGGCTGCCTCAGCCAGG - Intronic
1145175687 17:20698791-20698813 GGCACAGGGCTGCCTCAGCCAGG - Intergenic
1145252881 17:21305925-21305947 TGCCCAGGGAAGCCTGGCCCAGG + Intronic
1146497558 17:33336658-33336680 TGCTCAAGGCTGCCTGTGTCTGG + Intronic
1147042984 17:37732115-37732137 TCCCCTGGACTGCCTGTCCCCGG - Intronic
1147215053 17:38894106-38894128 TGCCCAGGCCTGGCTGAGGCAGG + Intronic
1147879059 17:43642301-43642323 TGCCCTGCCCTGCCTGTGCCAGG + Intronic
1147960071 17:44161958-44161980 TGCCCAGAGCTGCCTGCTCATGG - Exonic
1148105772 17:45118110-45118132 TGCCCAGGGATGCCGCTGCGTGG - Exonic
1148366280 17:47057982-47058004 TGCCCATGCCTGCCTGTAGCCGG + Intergenic
1148496257 17:48054982-48055004 GCCCCAGGGCAGCCGGTGCCGGG - Intronic
1148496695 17:48057153-48057175 TGAGCAGGGCAGCCTGTACCTGG + Intronic
1149606265 17:57927220-57927242 TGCCCAGGCCCGCCTGCCCCTGG - Intronic
1150007656 17:61479664-61479686 GCCCCAGTTCTGCCTGTGCCTGG + Intronic
1150211364 17:63443388-63443410 GTCCCTGGGCTGCCTGGGCCAGG - Intronic
1150476245 17:65477595-65477617 TGGGCAGAGCAGCCTGTGCCAGG - Intergenic
1151172932 17:72263197-72263219 TGTCCTGGGCTGCCTATACCTGG + Intergenic
1151541751 17:74768164-74768186 TCTCCAAGGCTGCCTCTGCCAGG - Exonic
1152013645 17:77735739-77735761 CGCCCAGGGCAGGCTGGGCCTGG - Intergenic
1152097419 17:78280067-78280089 GGCCCAGGGCTCCCTGTGCCTGG - Intergenic
1152662722 17:81550432-81550454 TGCTCTGCGCTGCCTGTGGCGGG - Exonic
1152755527 17:82085481-82085503 TGGCCAGGGCATCCTGAGCCAGG - Exonic
1152756815 17:82090456-82090478 CGCCGACGGCTGCCTGTCCCAGG - Exonic
1152765929 17:82138711-82138733 TGCCCCGGGCTGTGTGTGTCAGG + Intronic
1152807330 17:82362406-82362428 AGCCCAGGACAGCCTGTGCAGGG + Exonic
1152879285 17:82806253-82806275 TGACCTGGGCTGCCTGTTCTGGG + Intronic
1153299527 18:3580888-3580910 TGCCCTGAGCTGCCAGTGCTGGG + Intronic
1153647127 18:7205291-7205313 TGCCCAAGGCTGTGTGTGTCTGG + Intergenic
1153880529 18:9418235-9418257 AGCCCGAGGCTGTCTGTGCCTGG - Intergenic
1155921969 18:31612193-31612215 CTGCCAGGGCTGCCTTTGCCCGG - Intergenic
1156389124 18:36634279-36634301 TGCCCACTGCTTCCTGTGGCTGG - Intronic
1156445989 18:37237060-37237082 TGCCCATGGCTCCCTGAGCTGGG + Intergenic
1157506188 18:48228396-48228418 GACCCAGTGCTGTCTGTGCCAGG - Intronic
1157570459 18:48708928-48708950 TGCTCAGGGCTGAGTGTGCCAGG - Intronic
1158508100 18:58064770-58064792 TGCCTAAAGCTTCCTGTGCCAGG + Intronic
1158620368 18:59027662-59027684 TGGCCAGTGCTGCCTGTTTCAGG + Intergenic
1158885580 18:61823887-61823909 AGCCAAGGGCATCCTGTGCCAGG + Intronic
1159774405 18:72586152-72586174 TGGCCAGGGCTGCATGCTCCAGG - Intronic
1160413150 18:78688413-78688435 TGCCCAGGGCAGACTCGGCCTGG + Intergenic
1160533905 18:79581065-79581087 TCCTGAGGGCTGCCTGTGGCAGG - Intergenic
1160613144 18:80104619-80104641 TGCTCTGGTCTGGCTGTGCCAGG + Intergenic
1160720003 19:592885-592907 GGCCCAAGGCCTCCTGTGCCTGG + Intronic
1160836251 19:1126084-1126106 CGCCCAAGCCTGCCTGAGCCCGG + Intronic
1160980853 19:1815945-1815967 TGCTCTGGGCTGCCTCGGCCAGG + Exonic
1161124435 19:2547811-2547833 ATCCGAGGGCTGCCTGGGCCTGG - Intronic
1161219034 19:3109524-3109546 TGCTCAGGGCCACCTGTGGCAGG + Intronic
1161250964 19:3280091-3280113 TGCCCAGGGCTGCCTGTTGGTGG + Intronic
1161574089 19:5046336-5046358 CGCCCAGCTCAGCCTGTGCCTGG + Intronic
1161674313 19:5635624-5635646 TACCCAGGGCTGCATGTGGGTGG - Intronic
1161719507 19:5895206-5895228 TGCCCATGGATGCCAGGGCCAGG + Intronic
1162515036 19:11142666-11142688 TGCCCAGGACAGCCTGAGGCCGG - Intronic
1162929764 19:13952090-13952112 AGCCCCGGGCTGCCCGCGCCCGG - Intronic
1163251395 19:16128256-16128278 TCCCAGGGGCTGCCTGTGCTTGG - Intronic
1163399207 19:17081900-17081922 TCCACAAGGCTGCGTGTGCCTGG + Intronic
1163427507 19:17247237-17247259 GGCCCAGGGCTGGGTGTGCCTGG - Intronic
1163774041 19:19207609-19207631 TGGCCAGGTTTGCCTGTGCATGG + Intergenic
1166329648 19:42070438-42070460 TGCCCAGGGCTGCCTGGGCAGGG - Exonic
1166329852 19:42071483-42071505 TGCAGAGGGCTTCCTGTGCTGGG - Intronic
1166852424 19:45767040-45767062 TGCCCAGGGCTCCATATTCCTGG - Exonic
1167043611 19:47037507-47037529 AGCCCAGGTCTGTCTGTTCCGGG + Intronic
1167053626 19:47095244-47095266 AGCCCAGGCCTGCCTGTGGGTGG - Intronic
1167119533 19:47508236-47508258 GGCCCCCGGCTCCCTGTGCCAGG - Intronic
1167363381 19:49042238-49042260 TGCCTAGGGGTGCCGCTGCCGGG + Intergenic
1167579500 19:50333249-50333271 TGCCCAGAGCTGCCGGGGCTGGG - Intronic
1167590408 19:50401777-50401799 GGCCCAGCGCAGCCTGTGCCTGG + Exonic
1167778752 19:51581456-51581478 TGCCCAGAGATGCCTGTACCGGG + Exonic
1168107629 19:54174136-54174158 GCCCCAGGGCTGCCAGGGCCAGG + Exonic
925919367 2:8628468-8628490 CTCCCAGGGCTGACTGGGCCAGG + Intergenic
926113611 2:10197453-10197475 TTCCCAGTGCTGCCTGGGGCAGG - Intronic
926116712 2:10218079-10218101 TCCCCACTGCTGCCAGTGCCCGG + Intergenic
926391741 2:12400756-12400778 GGCCCAGGGGTGTGTGTGCCTGG - Intergenic
927148032 2:20179757-20179779 AGGGCAGGGCTGCCTCTGCCAGG - Intergenic
927712821 2:25336298-25336320 TGCAAGGGGCTGCCAGTGCCAGG - Intronic
928684464 2:33733723-33733745 TGCACTGAGCTCCCTGTGCCTGG + Intergenic
930025936 2:47029170-47029192 GTCCCAGGGCAGCATGTGCCTGG + Intronic
930618752 2:53622840-53622862 TGTCCAGGGCTGCCAGTGCCTGG - Intronic
932312050 2:70750777-70750799 TTCCCAGGGCTGCCTTTACATGG - Intronic
932739958 2:74283674-74283696 TGCCCAGGTCTGTCTCTGCATGG - Intronic
933252971 2:80049608-80049630 TGGCCGGTGCTGCCTTTGCCAGG + Intronic
934502262 2:94870447-94870469 TCCCCAGGACTGCATGCGCCAGG + Intergenic
934949297 2:98565542-98565564 AGCCCAGGCCTGGCTGTGACAGG - Intronic
935246597 2:101224267-101224289 TGTCCAGGGCAGCCTGAGCACGG - Intronic
937039986 2:118813700-118813722 TGCCCTGGGCTGGCTGGGGCTGG + Intergenic
937269301 2:120637900-120637922 TCCCCAGGGCCGCCTCTGCAGGG - Intergenic
937917230 2:127105320-127105342 GGCCCAGGGCTGCCTGCTCCAGG + Intronic
938097601 2:128473861-128473883 TGCTCAGGGCAGCCAGTACCTGG + Intergenic
938465252 2:131520779-131520801 TGCCAAGAGCCGCCTGGGCCTGG + Intergenic
943726900 2:191261189-191261211 TTCCCAGACCTGCGTGTGCCCGG + Intronic
944414018 2:199466090-199466112 TGCTGAGGGCTGCCCCTGCCAGG + Intronic
944430757 2:199630782-199630804 TGCCAAGGGTTGCCTGTGAGTGG + Intergenic
944450184 2:199834559-199834581 TGCCCGGTACTGCCTGTGACTGG + Intronic
946368732 2:219267118-219267140 TGTCAAGAGCTGGCTGTGCCTGG + Intronic
947717749 2:232350395-232350417 GGCCGAGGTCTGCCTGGGCCAGG - Intergenic
947741209 2:232485788-232485810 TGCCCAGGGGTCCCTGCGCGCGG - Intronic
947820406 2:233065024-233065046 TATCCAAGGCTGACTGTGCCGGG + Intronic
947929329 2:233950587-233950609 TGTCCGGCGCTGCCTGTGTCAGG - Intronic
948147588 2:235719680-235719702 TGCCCAAGGCTTCCTGGGTCAGG + Intronic
948518264 2:238519726-238519748 GGCCCAGGGTTGCCGGTGGCTGG - Intergenic
948908489 2:240991332-240991354 TCCCCAGGGCCGCCTGCCCCTGG - Intronic
948931924 2:241137482-241137504 TGCCCTGGGGTTGCTGTGCCTGG - Intronic
1168850456 20:973127-973149 TGTCCAGGGCCTCCTGTGTCAGG + Intronic
1169197743 20:3692557-3692579 TGCCCTGGGCATCCTGGGCCTGG + Exonic
1169273341 20:4217117-4217139 TCCCCAGGGCTGCTTGGGGCTGG - Intergenic
1169406628 20:5326687-5326709 GGCTCAGGGCTGCATCTGCCTGG - Intergenic
1169867932 20:10219731-10219753 TGGCCGGGGCTGGATGTGCCAGG + Intronic
1170261071 20:14409088-14409110 TGCCGTGGGCTGTCTTTGCCTGG + Intronic
1170907367 20:20528303-20528325 TGCACAGGTCAGCCTGTGCATGG + Intronic
1171092719 20:22301131-22301153 TGCCCAGCGCTTACTGTGCCAGG - Intergenic
1171344466 20:24455446-24455468 TTTCCAGGGCTGGCTGAGCCTGG - Intergenic
1171391895 20:24807016-24807038 GGCCCAGGGCTGCCCATGCTGGG - Intergenic
1172118324 20:32584205-32584227 GCCCCGGGGCTGCCTGTCCCGGG - Intronic
1172283978 20:33728099-33728121 TGCTCAGGGCTCACTGTGCAGGG + Intergenic
1172493338 20:35359524-35359546 TGCTCAGAGCTGCCAGTACCTGG - Intronic
1172513194 20:35514750-35514772 TGCCAAAGGCTGTCTGCGCCAGG + Exonic
1173607379 20:44341212-44341234 TGGCCAGGGCTGCCGAAGCCTGG + Exonic
1173749925 20:45469121-45469143 TGATCAGGGCTGACTGTGCCAGG - Intergenic
1174053780 20:47785026-47785048 TACCCGGGGCCGCCTGTGCTCGG + Intronic
1174111679 20:48201818-48201840 AGCCCAGAGCTGCCTGGGCAGGG - Intergenic
1174169461 20:48607014-48607036 AGCCCAGAGCTGCCTGGGCAGGG + Intergenic
1174982220 20:55408761-55408783 TTCCCAGTGCTGGCTGTGCTGGG - Intergenic
1175251873 20:57614861-57614883 GGCCCCCGGCTGCCTGTGTCTGG - Intronic
1175433517 20:58925851-58925873 TGTCCTGGGCTGCATGTGCATGG - Intergenic
1175479560 20:59301577-59301599 TGCCCAGGGCTTCCAGGGCTTGG - Exonic
1175810085 20:61853150-61853172 TCCCCAGGACTCCCAGTGCCCGG - Intronic
1175819252 20:61899826-61899848 TGCCCAGCTCAGCCAGTGCCTGG + Intronic
1175956484 20:62612314-62612336 TGCCCAAGGCCCCCTGTGCCTGG - Intergenic
1176285370 21:5016474-5016496 TTCCTGGGGCTGCCTGTGCCGGG - Intergenic
1176408432 21:6434415-6434437 TGCCCAGCTCTGGCTGAGCCTGG - Intergenic
1179099429 21:38343783-38343805 AGCCCAGGGCTGGCTGGGTCAGG - Intergenic
1179125262 21:38584614-38584636 TGCCCAGCACTGCCTGTTCCTGG - Intronic
1179165073 21:38929067-38929089 TGGACAGGGCTGCTGGTGCCAGG - Intergenic
1179349536 21:40595014-40595036 TGCCCTGTGCTGCCTGGGCTAGG - Intronic
1179581069 21:42344291-42344313 TGGCCAGGGCTGGCTGACCCTGG + Intergenic
1179683925 21:43042741-43042763 TGCCCAGCTCTGGCTGAGCCTGG - Intergenic
1179804286 21:43827067-43827089 AGCCCAGGGATGCCTAGGCCTGG - Intergenic
1179871811 21:44247001-44247023 TTCCTGGGGCTGCCTGTGCCGGG + Intronic
1179926684 21:44538766-44538788 TGCCCGGGTCTTCCTGAGCCTGG - Intronic
1180041512 21:45282718-45282740 TGCACAGGGCTGCCTCTGTCCGG - Intronic
1180137870 21:45872727-45872749 TGGCAAGGGCTGTCTGTGCCTGG + Intronic
1181107793 22:20585053-20585075 AGCCCTGGGCCGCGTGTGCCAGG + Intronic
1181174950 22:21030045-21030067 GGGCCAGGGCTGGCTGGGCCTGG + Exonic
1181305957 22:21917409-21917431 GTCCTAGGGCTGCCTGAGCCCGG - Intergenic
1181362442 22:22348409-22348431 TCCCCAGAGCAGCCTGTTCCTGG - Intergenic
1181368419 22:22397760-22397782 TCCCCAGGGCAGCCTGTTCCTGG - Intergenic
1181372075 22:22426550-22426572 TTCCTAGGGCAGCCTGTTCCAGG - Intergenic
1181726189 22:24812588-24812610 TGTGCAGGGCTGTATGTGCCAGG + Intronic
1181741981 22:24928509-24928531 TCCCCAGGTCTGGCCGTGCCAGG - Intergenic
1182117554 22:27765923-27765945 GCCCCCGGGGTGCCTGTGCCCGG + Intronic
1182515998 22:30859460-30859482 TGACCAGGTCTGCTGGTGCCTGG + Intronic
1183040816 22:35176603-35176625 TGCTCAGGGCTGTGTCTGCCCGG - Intergenic
1183364638 22:37400410-37400432 GGGCCAGGGCTGCCTGGGCAGGG + Intronic
1183411063 22:37655358-37655380 GTCCCAGGGCTGCCAGAGCCAGG - Exonic
1183540713 22:38427843-38427865 AGCCCAGGGGTGCCTGCGGCGGG - Exonic
1183780470 22:39995611-39995633 TGCTCAGGGCGGCCTGCCCCGGG - Intronic
1184093940 22:42306420-42306442 TGGGCAGGGCTGCCTGAGCCTGG - Intronic
1184138895 22:42566146-42566168 TGCCCAGGACTCCCTGTCCTGGG - Intronic
1184173446 22:42772674-42772696 AGCCTTGGGTTGCCTGTGCCTGG - Intergenic
1184178194 22:42801730-42801752 TGCAGAGGGCTTCCTCTGCCAGG + Intronic
1184206136 22:43004792-43004814 CGCCCAGGGAGGCCTGTGACGGG - Intronic
1184402615 22:44282548-44282570 TCCTCAGGGCTCCCTGTGCAGGG - Intronic
1184504576 22:44893127-44893149 TGTCCAGCCCTGCCTGTGACCGG + Intronic
1184627210 22:45744684-45744706 TCCTCTGGGCTGGCTGTGCCAGG + Intronic
1184694746 22:46133128-46133150 AGCCCAGGGCTGACTGCCCCAGG - Intergenic
1184859771 22:47166722-47166744 TGCCCAGGGCTGCCTCATGCCGG - Intronic
1184959808 22:47920798-47920820 TGACCATGTCTGCCTGAGCCTGG + Intergenic
1184968411 22:47997791-47997813 TTCCCAGGCCTGCCTGTCCCTGG - Intergenic
949892263 3:8742118-8742140 TGCCTAGAGCTGCCTGAGCCGGG + Intronic
950460598 3:13120073-13120095 TCCCCAGGTGTCCCTGTGCCAGG - Intergenic
950578987 3:13850616-13850638 TCCCCAGGGCTGCCTCTCCTGGG + Intronic
951039581 3:17974393-17974415 TGGCCAGAGCTCCCTCTGCCTGG - Intronic
952652029 3:35738414-35738436 TGCCCTGGGCTGACTGTGAGGGG + Intronic
953003623 3:38957621-38957643 TGGCCAGGGCTACCTGTCACAGG + Intergenic
953374492 3:42417250-42417272 GGCCCAGGGCTGCCACTGGCTGG - Intergenic
953494473 3:43374144-43374166 TTCCTAGGGTTCCCTGTGCCAGG + Intronic
953808211 3:46089818-46089840 GGCCCAGGCCTGAGTGTGCCAGG + Intergenic
953979828 3:47408015-47408037 GCCCCAGGGCTGCCTATGCTGGG + Intronic
954430901 3:50470396-50470418 TGTCCTGGGATGCCTGTCCCAGG - Intronic
954682865 3:52355349-52355371 TCCCCAGGGCTGCCTGAGCTTGG + Intronic
954805438 3:53217289-53217311 AGCCCAAAGCTGCCTGTCCCAGG - Intergenic
954879519 3:53823948-53823970 GCCCCAGGGCTCCCCGTGCCAGG + Exonic
954880605 3:53833503-53833525 TTCCCTGGGCTGCCTGGGCAGGG + Intronic
955239185 3:57164803-57164825 GTCCCAGGGCTGCGTGTCCCGGG - Intronic
955392538 3:58531835-58531857 TGCACAGGTCTTCCTGTGACGGG - Intronic
956857661 3:73291772-73291794 AGCTCAGGGCTTCCAGTGCCTGG - Intergenic
960676117 3:120196454-120196476 TGCCCTGTGCAGCCGGTGCCAGG - Intronic
960902257 3:122564561-122564583 TGCCCGGGGCTTCGTGTTCCTGG - Exonic
961535680 3:127569121-127569143 TCCTTAGGGATGCCTGTGCCAGG - Intergenic
961591504 3:127985027-127985049 TGCCCTGGGCTGACTCTGTCCGG + Exonic
961749867 3:129088592-129088614 TGCCCAGGTCACCCTGTGGCAGG - Exonic
962105220 3:132382812-132382834 TGCTCAGGTCTGGCTGAGCCTGG + Intergenic
962314539 3:134350924-134350946 AGCCCAGGGCTGTCAGGGCCAGG + Intergenic
963583873 3:147160107-147160129 TGCCCAGGGCTACCTACCCCAGG + Intergenic
964891393 3:161540325-161540347 AGCCCAGGGCTGCCCCTGCCTGG - Intergenic
966525144 3:180912309-180912331 TGCGCCGGGCAGGCTGTGCCTGG + Exonic
967319717 3:188183668-188183690 TACCCAGTGCTCACTGTGCCAGG + Intronic
967776118 3:193387787-193387809 GGCTCAGGGCTGCCTGGGCAGGG - Intergenic
967938759 3:194749975-194749997 TGCCCAGCGCGGCCTGCGCAGGG - Intergenic
968008576 3:195259122-195259144 TCCCCAGGCCTGCCTGAGCAGGG + Intronic
968093227 3:195910428-195910450 TGCCCAGGGCTGCCTCCGTTTGG - Intronic
968457274 4:706092-706114 TGCCAAGGGCTTCCCGGGCCAGG - Intronic
968542183 4:1173197-1173219 AGGCCAGGGATGCCTGCGCCGGG - Intronic
968642894 4:1723193-1723215 TGCCCATGGCTCCCCCTGCCAGG + Intronic
968969083 4:3784180-3784202 TGCCCTGGGCTGACGGTTCCCGG + Intergenic
968983655 4:3864189-3864211 TCCCCAGGGGTCCCTCTGCCTGG + Intergenic
969106544 4:4810953-4810975 AGCCCAGGGATTCCTGTGCAAGG - Intergenic
969329937 4:6468680-6468702 TGCCCAGGGCAGGATGTGCTTGG + Intronic
969447831 4:7255747-7255769 TGCCCTGGCCTGTCTGTGGCAGG - Intronic
969526339 4:7705983-7706005 TGCCCAGGCTGGCCTCTGCCTGG + Intronic
969840876 4:9880847-9880869 TGCCCTGGGCTGGCTGCTCCAGG + Intronic
970202909 4:13627581-13627603 TGGCCATGGTGGCCTGTGCCGGG + Exonic
970449849 4:16155991-16156013 AGTCCAGGCCTGCCTGAGCCTGG + Intergenic
971043522 4:22780204-22780226 TGCCCAGGGCATCCAGTGCTTGG + Intergenic
971267885 4:25110937-25110959 TGCCCAGGGCCTGCTGTGGCAGG + Intergenic
971357345 4:25907116-25907138 GGACCAGAGCTGCCTGTGCAGGG + Intronic
972136528 4:35901030-35901052 TGCCCAGGGCTGCATGCGTTGGG - Intergenic
978370187 4:108022337-108022359 TACTGAGGGCTGACTGTGCCGGG + Intronic
981081613 4:140643573-140643595 CGCTCAGGGCCGCCTGGGCCAGG + Intronic
981699775 4:147595882-147595904 TGCCCAGTGCTGCTTCTGCACGG - Intergenic
982073188 4:151713687-151713709 TGCCAAGGGCTGCCAGGTCCTGG - Intronic
982096791 4:151930653-151930675 TCCCCAGTGCTGCCTGTGACAGG + Intergenic
982115863 4:152097900-152097922 TGCCCATGGCTGCCTGTTAATGG - Intergenic
982260240 4:153488389-153488411 GGGCCAGGGCTGCCTGTGGGAGG + Intronic
983425790 4:167581981-167582003 TGCCCAGTGGATCCTGTGCCAGG - Intergenic
983972686 4:173893848-173893870 GGCCCAGGTCTGCATCTGCCTGG + Intergenic
985551568 5:535779-535801 ACCCCAGGACAGCCTGTGCCTGG - Intergenic
985603964 5:848909-848931 TGTGCAGGGCTGGCTGTGCAGGG - Intronic
985603967 5:848923-848945 TGTGCAGGGCTGGCTGTGCAGGG - Intronic
986301312 5:6480386-6480408 TGTCGAGGGCTGTCTGAGCCAGG - Intronic
986518796 5:8591944-8591966 TGCCCAGGGCTGGCTTAGGCAGG - Intergenic
986724565 5:10584666-10584688 TGGACAGGGGTACCTGTGCCAGG + Intronic
987083374 5:14446271-14446293 TCTCCAGTGCTGCCAGTGCCTGG - Intronic
987247139 5:16060426-16060448 TGCCCTGAGCTCCCTGTCCCAGG + Intergenic
988497285 5:31756175-31756197 GACCCGGGGGTGCCTGTGCCTGG + Intronic
990384030 5:55242002-55242024 TGCACAGTACTGCCTGTGCCGGG - Intergenic
991408359 5:66323364-66323386 TGTGTAGGGCTGCATGTGCCTGG - Intergenic
991972825 5:72157518-72157540 AGCCCATGGCTCCCTGTCCCCGG - Intronic
992564876 5:77986923-77986945 GGCCCATGGCTTCCTGTGCTGGG + Intergenic
995493916 5:112721957-112721979 TCCCCAGGGCTGCATGGCCCAGG - Intronic
997654753 5:135546499-135546521 AGCCTAGGGCTGCCTGACCCTGG + Intergenic
999110981 5:149121303-149121325 CACACAGGGCTGCCTGGGCCAGG + Intergenic
999214317 5:149919140-149919162 GGCTCAGGGCTTCCTGGGCCTGG + Intronic
999305178 5:150514964-150514986 TGCTGAGGGCTGTGTGTGCCGGG + Intronic
999450343 5:151673071-151673093 TGCCCTTGGCTGCCTGGGCCTGG - Intronic
1001396296 5:171421304-171421326 AGACCAGGGCTGCCTCTGCATGG + Intronic
1001590333 5:172860442-172860464 TGCCCAGCGTTGCCTGAGCCAGG + Intronic
1002173973 5:177391105-177391127 TGCCCATCCCTGCCTGGGCCTGG - Intronic
1002312982 5:178325798-178325820 TGTCCACAGCGGCCTGTGCCTGG + Intronic
1002541866 5:179911500-179911522 TGCCCAGGGGTGCCTATGTCAGG - Intergenic
1003128447 6:3374763-3374785 TCCCCAGGGCTGGCTGTGCTGGG - Intronic
1004350661 6:14887740-14887762 TGGTCAGGTCTGCCTGTTCCTGG - Intergenic
1004930155 6:20455321-20455343 TGCCAGTGGGTGCCTGTGCCAGG + Intronic
1006407343 6:33852978-33853000 TGCCCAGTGCTGGCTTTTCCAGG + Intergenic
1006770345 6:36547554-36547576 TGCCTAGGGCTGGCTGGACCTGG + Intergenic
1006911054 6:37563939-37563961 TGGCCCAGGCTCCCTGTGCCAGG + Intergenic
1007305095 6:40897598-40897620 GGCCCACTGCTGCCTCTGCCTGG + Intergenic
1007383509 6:41505106-41505128 TGCCCAGGGCGGCCTTGGCCGGG - Intergenic
1007686849 6:43672121-43672143 GGCCCTGGGCTGCCTGAACCTGG - Exonic
1007706273 6:43793406-43793428 TGGGCAGGGCTGCTTGGGCCAGG + Intergenic
1008928756 6:56915020-56915042 TGCGCATGACTGTCTGTGCCCGG - Intronic
1013179827 6:107708357-107708379 GGCCCAGGGCCTCCTGAGCCTGG + Intronic
1013750097 6:113395775-113395797 TGTCCAGAGGTGGCTGTGCCAGG + Intergenic
1014726510 6:124978251-124978273 TGGCCACTGCTGCCTCTGCCTGG + Intronic
1015729799 6:136335833-136335855 TCCCCAGGGCCGCCTTTGCCTGG + Intergenic
1015830430 6:137363112-137363134 TCTCCAGGGCTGTCTGTGACAGG - Intergenic
1016709596 6:147154507-147154529 TGTCCAGGGCAGCCACTGCCTGG - Intergenic
1016731399 6:147431999-147432021 TCCCCAGCGCTGCCTGTGCCAGG + Intergenic
1017005540 6:150025924-150025946 TGCCCAGGGCGGGGTGAGCCAGG - Intergenic
1018190558 6:161306091-161306113 TGCCCAGGACTGGCTGTGCAGGG + Intergenic
1018732037 6:166658616-166658638 TGCCCTGGGCTGGCTCTGCCAGG - Intronic
1018824177 6:167397025-167397047 TGCCCTTGACTGCCTGTGACAGG - Intergenic
1019147974 6:169986928-169986950 TGCCCAGTGCTGCCTGGGGCAGG - Intergenic
1019173452 6:170147672-170147694 TGCCAGGGGCTCCCTGTGCTGGG - Intergenic
1019322209 7:420891-420913 TGCCCAGGGCTGCTGCTCCCCGG - Intergenic
1019325510 7:436434-436456 GGCCCTCGGATGCCTGTGCCGGG - Intergenic
1019406773 7:888136-888158 TGCTCGGGTCTGCATGTGCCTGG + Intronic
1019443906 7:1061081-1061103 GGCACTGGGCTGCCTCTGCCCGG + Intronic
1019578679 7:1749621-1749643 TGCCCAGGGCTGAGAGTCCCGGG - Intergenic
1019603172 7:1895426-1895448 TGCCCAGAGCTCCCCATGCCAGG + Intronic
1019735557 7:2648332-2648354 TGCCCAGGTCTCCGAGTGCCTGG + Intronic
1019881403 7:3864643-3864665 TCCCCAGGGCTGTCTGAGACTGG - Intronic
1019978454 7:4603252-4603274 TGCCCAGGCCGGCCTCCGCCGGG + Intergenic
1021406982 7:20282109-20282131 AGGCCAGGGCTGCTTGTTCCTGG - Intergenic
1021588832 7:22239159-22239181 TGCCCAGGTGGGCCTGTGCTGGG + Intronic
1023172085 7:37399419-37399441 TGCCCAGGGCTTCCTGAGAGTGG - Intronic
1023806546 7:43876864-43876886 AGGCCAGGCCTGCCAGTGCCCGG + Exonic
1024220792 7:47284893-47284915 TTCCCAGGGCTGCCTACCCCAGG - Intronic
1025227976 7:57180222-57180244 TGCCCAGTGGGGCCTGTGGCTGG + Intergenic
1025258022 7:57398753-57398775 TGCCCAGTGGGGCCTGTGGCTGG - Intergenic
1026889387 7:73973289-73973311 GGGCCAGGGCTGGGTGTGCCCGG - Intergenic
1026942234 7:74293801-74293823 TGGCCAGGGCTGCCTGCCACTGG + Intronic
1027188256 7:75984288-75984310 TACGCGGGGCTGCCTGGGCCTGG + Intronic
1029194730 7:98797304-98797326 TGCCCAGAGCTGTTTCTGCCTGG - Intergenic
1029236007 7:99119666-99119688 TGCCCAGGTTTTCCTGTCCCTGG - Intronic
1029589694 7:101499152-101499174 TCCCCAGGTCAGCCAGTGCCAGG - Intronic
1030721904 7:112881270-112881292 TGCCAAGGGGTGCCTGCACCAGG - Intronic
1032513904 7:132493071-132493093 ATGCCAGGGCTGCCTGGGCCCGG + Intronic
1033446262 7:141424976-141424998 TTCCCAGAGCTGCCTGTTACTGG + Intronic
1033659978 7:143396439-143396461 AGTCCAGGGCTCCCTGTGCAGGG + Exonic
1034557120 7:151857336-151857358 TGCCCAGGTCCGCCTGTGAGAGG + Intronic
1034882167 7:154771013-154771035 TGCCATGAGCTGCCTCTGCCAGG + Intronic
1034902247 7:154914818-154914840 TGGGCAGGGCTGCTTCTGCCTGG + Intergenic
1035168631 7:157005912-157005934 ACCCCAGGGCTTCCTGTCCCCGG + Intronic
1035252371 7:157605755-157605777 TGCCCAGCTCTGGCTATGCCTGG + Intronic
1035351186 7:158247422-158247444 TGGCCAGGGGTGCCCGTCCCAGG + Intronic
1035625464 8:1067525-1067547 TGCCCAGGCGTGCGTGGGCCGGG - Intergenic
1036003326 8:4633142-4633164 CGCTCAGGACAGCCTGTGCCAGG + Intronic
1036210008 8:6834336-6834358 CGCTAAGGGCTGCCTGAGCCCGG - Intronic
1036795064 8:11749757-11749779 TGACCGGGGCTGCAGGTGCCGGG - Intronic
1036849418 8:12191292-12191314 TGCCAAGGTCAGCCTGTGGCTGG + Intronic
1036870780 8:12433565-12433587 TGCCAAGGTCAGCCTGTGGCTGG + Intronic
1037451529 8:19020461-19020483 TGCCTAGGGCTGAGTGAGCCAGG + Intronic
1037817304 8:22118970-22118992 TGCGCTGGGCGTCCTGTGCCCGG + Exonic
1037890435 8:22621251-22621273 TGCCTAGGGCTCCTGGTGCCAGG + Exonic
1038870691 8:31489968-31489990 TCCCCAGGGCTGGCAGGGCCAGG - Intergenic
1039432471 8:37535675-37535697 TGCCCAGACCTGCCTGAACCAGG + Intergenic
1041342071 8:56856524-56856546 TGCCCAGGCCTGCCTTTCCCAGG - Intergenic
1042503885 8:69539055-69539077 TGTCCAGGGCTGCCTTTGAAAGG + Intronic
1045115234 8:98973852-98973874 TCCCCAGGACCGCCGGTGCCGGG + Intergenic
1045225639 8:100242700-100242722 TGCCCAGGCCTGCCTGAGAGAGG + Intronic
1045650809 8:104340196-104340218 AGCCCATTGCTGCGTGTGCCAGG - Intronic
1047220167 8:122912316-122912338 TGCCCAGGCCAGCCTGTGGCTGG - Intronic
1047449058 8:124946369-124946391 TGCCCATGGCTACCTGTTGCAGG + Intergenic
1048513132 8:135080164-135080186 TCCCCTGTGCTGCCTTTGCCAGG - Intergenic
1048692898 8:136988595-136988617 TGGCCAGTGGTGCCTCTGCCTGG + Intergenic
1048801426 8:138197710-138197732 AGCCCTGTGCTGCCTGGGCCAGG - Intronic
1049181588 8:141225825-141225847 TGCCCAGGGAGGCCTGGGGCCGG - Intronic
1049545049 8:143226661-143226683 AGCACAGGGCTGCCTCTCCCAGG + Intergenic
1049579954 8:143406718-143406740 TGCCCAGGCCAGCCTGAGGCAGG - Intergenic
1049690685 8:143957646-143957668 TGGCCAGGGCAGCCAGGGCCTGG - Intronic
1049795862 8:144497007-144497029 CCCCCAGGGCTGCCTGGGCCTGG + Exonic
1049845830 8:144800612-144800634 TGTCCAGGGCAGTCTGTGGCAGG - Intronic
1051041506 9:12817897-12817919 AGCCCAGGACTCTCTGTGCCTGG + Intronic
1051147298 9:14041106-14041128 TGCACAAGGTTGCCTGTGCTGGG - Intergenic
1053179638 9:35957649-35957671 TGCCCATGGCTGCCAGCTCCTGG - Exonic
1053270071 9:36743742-36743764 TGCCCAGGGCCTTCAGTGCCGGG + Intergenic
1053316356 9:37055186-37055208 TTCCCAGGGCTGCCTGCACTGGG + Intergenic
1053321348 9:37101554-37101576 TTCCCAGGGCTGCCTGCACTGGG + Intergenic
1055913059 9:81373398-81373420 TTCCCATGGCTGACTGTCCCAGG - Intergenic
1056054419 9:82806088-82806110 AGCCCAGGGCAGCCTCTGCCAGG + Intergenic
1056765847 9:89443913-89443935 GGCCCAGGGCTGCCTGACTCTGG - Intronic
1056773564 9:89496710-89496732 TGGCCAGAGCTGCCTGTTTCTGG + Intronic
1056789710 9:89617672-89617694 CGCCCAGGACTGCGTGTCCCAGG + Intergenic
1056795414 9:89655576-89655598 TGCCCTTGGCTGCCAGTGCCTGG + Intergenic
1057705471 9:97392188-97392210 AGACCAGGGCTGTCTCTGCCAGG - Intergenic
1059390884 9:113999024-113999046 TGTCCAGGGCTCCCTCTGCTGGG + Intronic
1060210261 9:121706180-121706202 TGTCCAGGGCAGCATCTGCCTGG + Intronic
1060219702 9:121757934-121757956 TCCCCAGGGCTGGGGGTGCCAGG - Intronic
1060486864 9:124053260-124053282 TACCCAGGACTGTCTGTGGCTGG - Intergenic
1060490655 9:124081771-124081793 GGCTAAGAGCTGCCTGTGCCAGG - Intergenic
1060667414 9:125440129-125440151 TGCTGAGGACAGCCTGTGCCTGG + Intronic
1061016519 9:127983879-127983901 TCCCCAGAGCTTCCTGTACCTGG - Intergenic
1061369003 9:130187443-130187465 TGGCCAGGGCTGCCTCTGCCTGG + Intronic
1061476829 9:130873195-130873217 TGCCCAAAGCTGGCTTTGCCAGG - Intronic
1061499682 9:130994663-130994685 TGCCCAGGGCTGACTCATCCAGG + Intergenic
1061513045 9:131072513-131072535 TGCTCAGGGCTGCTGATGCCTGG + Intronic
1061610819 9:131744491-131744513 TCCTGAGGGCTGCCTGTGGCTGG + Intergenic
1061681760 9:132245979-132246001 TGCCCAGGGCTGCCTGGCCTGGG - Intergenic
1061817924 9:133207428-133207450 TGCCCTGGACAGCCTGAGCCAGG + Intronic
1061924412 9:133798930-133798952 TGCCCTGGGCTTCCCGGGCCAGG - Intronic
1061953629 9:133950151-133950173 TGGCCCTGCCTGCCTGTGCCAGG - Intronic
1062122657 9:134842019-134842041 TACCCAGGGCTGCGCTTGCCCGG - Intronic
1062242475 9:135547745-135547767 TGCCCTGGACAGCCTGAGCCAGG - Intronic
1062309712 9:135929249-135929271 AGCCCAGGGCTGGCAGGGCCAGG - Intergenic
1062334314 9:136058327-136058349 TCCCCACGGCTCCCAGTGCCTGG + Intronic
1062336980 9:136075666-136075688 TGTCCTGAGCTCCCTGTGCCCGG + Intronic
1062358486 9:136176365-136176387 TGCCCAGGACAGCCTGGCCCTGG - Intergenic
1062373290 9:136251295-136251317 TGCTCAGGACTTGCTGTGCCTGG - Intergenic
1062373903 9:136253562-136253584 TGCCCAGGGGTGGCTGGTCCGGG - Intergenic
1062434510 9:136540882-136540904 CTCCCAGGGCTGCCTGCGTCTGG - Intronic
1062460116 9:136659474-136659496 TGCCCAGGCTGGCCTCTGCCAGG + Exonic
1062465063 9:136677315-136677337 GACACAGGGCTGCCTGTGCCTGG - Intronic
1062473187 9:136715088-136715110 TGCCCAGGGCAGCCTCTCCCTGG + Intronic
1062597381 9:137305400-137305422 TGGCCGAGGCTGCCAGTGCCAGG - Intergenic
1062703253 9:137919157-137919179 TGGCCAGTGCTGCCTGCCCCAGG - Intronic
1203747982 Un_GL000218v1:54099-54121 TGCTCAGGGCGGCCCGTGCAGGG + Intergenic
1186793623 X:13023273-13023295 TGTCCTGAGCTGCCTGTGTCTGG - Intergenic
1187151195 X:16683117-16683139 TGGCCAGGGCTGAGTGTTCCAGG + Exonic
1187190267 X:17027969-17027991 TGGCCAAGCCTGCCTGTGACTGG - Intronic
1187697043 X:21933291-21933313 TGCGCAGCTCTGCCTGGGCCAGG + Intergenic
1189334965 X:40165462-40165484 TGCACAGGGCTGGTTGTGGCTGG - Intronic
1189361783 X:40358965-40358987 TTCCCAGGGCAGCCTGGCCCAGG + Intergenic
1189973985 X:46444576-46444598 TGCACAGTTGTGCCTGTGCCTGG - Intergenic
1190054949 X:47175931-47175953 GCCCCAGGGCTGCCTCTGCCGGG - Intronic
1190264813 X:48821893-48821915 TGCCCAGTACTGCTTGTGACAGG + Intronic
1190297125 X:49034238-49034260 TGCCCCCAGCTGCCTGTGTCAGG - Exonic
1197769777 X:130082636-130082658 TCCTCAGGGCTGTCAGTGCCCGG + Intronic
1198451171 X:136767956-136767978 ACCCGAGGGCTGCCGGTGCCTGG + Intronic
1199263956 X:145808599-145808621 TGCCCAGCACTGCCTGGGACTGG - Intergenic
1199537146 X:148915543-148915565 TGCCCTGAGCTCCCTTTGCCAGG - Intronic
1199746428 X:150774660-150774682 TGCCCTGGGCTCCTTGTTCCAGG + Intronic
1200211508 X:154348751-154348773 CGGCCAGGGCGGCCTGGGCCGGG + Exonic
1200236731 X:154471362-154471384 CTCCCTGGGCTGCCTGTGCGAGG + Intronic
1200982085 Y:9271780-9271802 AGCCTAGGGTTTCCTGTGCCTGG - Intergenic