ID: 1077474105

View in Genome Browser
Species Human (GRCh38)
Location 11:2778365-2778387
Sequence CCTCCACTCAGGACACAGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 387
Summary {0: 1, 1: 0, 2: 2, 3: 35, 4: 349}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077474105_1077474118 30 Left 1077474105 11:2778365-2778387 CCTGGCTGTGTCCTGAGTGGAGG 0: 1
1: 0
2: 2
3: 35
4: 349
Right 1077474118 11:2778418-2778440 TCTCCTGGGCCCAGCTGTCTGGG 0: 1
1: 0
2: 1
3: 34
4: 325
1077474105_1077474110 -9 Left 1077474105 11:2778365-2778387 CCTGGCTGTGTCCTGAGTGGAGG 0: 1
1: 0
2: 2
3: 35
4: 349
Right 1077474110 11:2778379-2778401 GAGTGGAGGGTGGCAGAAGCTGG 0: 1
1: 1
2: 8
3: 67
4: 624
1077474105_1077474113 16 Left 1077474105 11:2778365-2778387 CCTGGCTGTGTCCTGAGTGGAGG 0: 1
1: 0
2: 2
3: 35
4: 349
Right 1077474113 11:2778404-2778426 TCACATCCCAGCCTTCTCCTGGG 0: 1
1: 0
2: 1
3: 35
4: 351
1077474105_1077474117 29 Left 1077474105 11:2778365-2778387 CCTGGCTGTGTCCTGAGTGGAGG 0: 1
1: 0
2: 2
3: 35
4: 349
Right 1077474117 11:2778417-2778439 TTCTCCTGGGCCCAGCTGTCTGG 0: 1
1: 0
2: 1
3: 28
4: 317
1077474105_1077474112 15 Left 1077474105 11:2778365-2778387 CCTGGCTGTGTCCTGAGTGGAGG 0: 1
1: 0
2: 2
3: 35
4: 349
Right 1077474112 11:2778403-2778425 CTCACATCCCAGCCTTCTCCTGG 0: 1
1: 0
2: 2
3: 51
4: 369

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077474105 Original CRISPR CCTCCACTCAGGACACAGCC AGG (reversed) Intronic
900104161 1:975280-975302 CCCCCACCCAGCACCCAGCCAGG + Exonic
900159961 1:1218811-1218833 CCTCCACCCCGAGCACAGCCGGG - Exonic
900513233 1:3069987-3070009 CCACCACGCGGGGCACAGCCGGG - Intronic
900537343 1:3185440-3185462 CCTGCACTTAGGCCACAGCCTGG - Intronic
900804035 1:4755758-4755780 GCTCAACTTAGAACACAGCCTGG + Intronic
902220461 1:14961218-14961240 CCTCCACTCAGGGCATAGTGTGG + Intronic
902381754 1:16056105-16056127 TAACCACTCAGGACAGAGCCTGG + Intronic
902649326 1:17826380-17826402 CCTCCACCAAGGCCACAGTCTGG + Exonic
902680213 1:18038301-18038323 CCAGCATTCAGGAGACAGCCTGG - Intergenic
903211716 1:21822668-21822690 CCTCCTGCCAGCACACAGCCTGG - Exonic
903225741 1:21893375-21893397 CCCCTGCCCAGGACACAGCCAGG - Intronic
903831385 1:26177438-26177460 GCTCCGCCCAGGACCCAGCCCGG + Exonic
904023984 1:27490564-27490586 CCTTCACTCCGGTCTCAGCCAGG + Intergenic
904081663 1:27876318-27876340 CCTCCACTGAGTTCACAGGCAGG - Intronic
904346945 1:29878985-29879007 CCTCACCACAGGACACACCCTGG - Intergenic
904364464 1:30001670-30001692 CCTCCACTCACTCCACACCCAGG + Intergenic
904423790 1:30410511-30410533 CCTCCACTCACGCGACACCCAGG - Intergenic
904447850 1:30588950-30588972 CCTCACCACAGGACACACCCTGG + Intergenic
905026407 1:34853103-34853125 CCTCCTCTCAGGCCACCACCAGG + Exonic
905366372 1:37453852-37453874 CCTCCTCTGCGGACACTGCCTGG - Intergenic
905636744 1:39559112-39559134 TCTCCATTCAGGCAACAGCCTGG + Intergenic
906148360 1:43573245-43573267 GCTCCTCTCAGGACCCAGCAGGG - Intronic
906517920 1:46450477-46450499 CCCCCAGTCTGGACTCAGCCAGG - Intergenic
907446724 1:54512920-54512942 CCTCCCCTCAGTAGACAACCTGG + Intergenic
908536911 1:65086685-65086707 CTTCCAATCAGGCCACAGTCTGG + Intergenic
912214575 1:107593433-107593455 CCTCTACTCAGAACACAGAATGG + Intronic
912508591 1:110173323-110173345 CATCCACTCTGGACACAGGGTGG - Intronic
913588989 1:120304578-120304600 CCTGGCTTCAGGACACAGCCAGG + Intergenic
913619196 1:120593791-120593813 CCTGGCTTCAGGACACAGCCAGG - Intergenic
914571012 1:148916461-148916483 CCTGGCTTCAGGACACAGCCAGG + Intronic
914601820 1:149213810-149213832 CCTGGCTTCAGGACACAGCCAGG - Intergenic
914990991 1:152499643-152499665 CCTCCACTCAGGGCCAAGCCTGG - Intergenic
915626790 1:157118789-157118811 CCTCCCCTCAGGATACACACAGG - Intergenic
915938738 1:160104875-160104897 CCACCCCTCAGGAAACAACCAGG + Intergenic
916214448 1:162383584-162383606 CATCCTCCCAGGACTCAGCCAGG - Exonic
916785186 1:168081880-168081902 CTTCCAGACAGGACACAGCCAGG + Exonic
917031473 1:170697150-170697172 TCTCCAGGCAGGAGACAGCCAGG + Intronic
917315036 1:173715301-173715323 CCACCAGGCAGGACAAAGCCCGG - Intronic
919106397 1:193156863-193156885 CCAGCACTCAGCACACTGCCAGG - Intronic
919109323 1:193198133-193198155 CCTCCAATCTTGATACAGCCAGG - Intronic
919419751 1:197355527-197355549 CCTCCCCTCAGGACAGGGCTCGG - Intronic
920186421 1:204162079-204162101 GCTCCACTCGGGACCAAGCCTGG + Exonic
922109247 1:222541483-222541505 CCAGCACTCAGGACAGTGCCTGG - Intronic
922910388 1:229210897-229210919 CCTCCACACACGGCACAGCCTGG + Intergenic
922947153 1:229526393-229526415 CTTCCACTCAGGACAAAGCGGGG + Intronic
923181986 1:231528626-231528648 CCTCCCCTCCGGACGCAGGCCGG + Intergenic
924661512 1:246023081-246023103 TCTCCATTTAGGACACAGGCAGG + Intronic
1064156354 10:12906345-12906367 CCTCCCCTCCCGCCACAGCCTGG - Intronic
1067063766 10:43091976-43091998 CCTCCACTCTGGATACATACAGG + Intronic
1067326600 10:45274495-45274517 CTTACAGTCAGGACACAGCTTGG - Intergenic
1067402291 10:45987979-45988001 CCTGCACTCAGGGCCCATCCAGG - Intronic
1067870644 10:49957613-49957635 CCTGCACTCAGGGCCCATCCAGG - Intronic
1069592302 10:69649757-69649779 CCACCCCACAGGACAAAGCCTGG + Intergenic
1069946661 10:71991065-71991087 CCTCCACTGTTGCCACAGCCAGG + Intronic
1070116492 10:73533909-73533931 TCTTCACTTAGGACAAAGCCTGG + Intronic
1073205415 10:101766845-101766867 CCCTCACCCAGGACAGAGCCTGG + Intergenic
1073489914 10:103846284-103846306 CCTCCGCTCAGGTAACAGCAGGG + Intronic
1074780771 10:116800441-116800463 CCTGCTCTCAGGACACAGTGGGG - Intergenic
1075730256 10:124631595-124631617 CCGCCACGCAGGCCAGAGCCCGG + Intronic
1075782029 10:125023306-125023328 GCTCAGCTCAGGACACACCCTGG - Intronic
1076434336 10:130429874-130429896 CCTCCACTCAAAATACAGCAGGG - Intergenic
1076715650 10:132362540-132362562 CCTCCCCTCAAGGCCCAGCCAGG - Intronic
1076742480 10:132493586-132493608 CCTGCCCTGAGGAGACAGCCAGG + Intergenic
1077087829 11:763401-763423 CCTCGGCACAGGCCACAGCCTGG - Exonic
1077474105 11:2778365-2778387 CCTCCACTCAGGACACAGCCAGG - Intronic
1077751124 11:4971159-4971181 TCCCCACTCAAGACAGAGCCAGG + Intronic
1079203805 11:18396458-18396480 CCTACAGCAAGGACACAGCCAGG - Exonic
1079567063 11:21895955-21895977 CCCAACCTCAGGACACAGCCTGG + Intergenic
1081552531 11:44127316-44127338 GCTCCAAACAGGCCACAGCCCGG - Intronic
1081864786 11:46353545-46353567 CCTCCACGCCAGACCCAGCCCGG - Intronic
1083698077 11:64455892-64455914 CCTCCCCTCAGCTCACATCCTGG + Intergenic
1083745849 11:64736090-64736112 GCTAGACTCAGGACAAAGCCTGG + Intronic
1083935218 11:65866546-65866568 ACTCCACTCTGGACAGCGCCAGG - Exonic
1084043801 11:66557599-66557621 CCTACACTCTGGCCACAGCCTGG + Intronic
1084062566 11:66685818-66685840 CCTCCGTTCAGGAAACTGCCAGG - Exonic
1084284991 11:68125205-68125227 CCTCCTCCCAGGTCACACCCAGG + Intergenic
1085808770 11:79661161-79661183 CCACCATTCAAGACACAGTCAGG + Intergenic
1090519322 11:127461429-127461451 CCTCCACTGAGCACAATGCCAGG - Intergenic
1090955678 11:131511271-131511293 CATCCCCTCAGGCCCCAGCCAGG + Intronic
1091034892 11:132224231-132224253 ACTCCCCTCAGGAAACAGCTGGG + Intronic
1091262809 11:134247180-134247202 CCTGAACACAGGACACAGCGTGG - Exonic
1091817428 12:3449802-3449824 ACACCATTCAGGACACAGGCAGG - Intronic
1092219162 12:6700927-6700949 CCTCCACCTGGGACATAGCCTGG - Intergenic
1095772184 12:45972123-45972145 CCTCCACACATGTCACAGACTGG + Intronic
1095828782 12:46560339-46560361 CCACCACCCAGCACAAAGCCTGG - Intergenic
1097044537 12:56177637-56177659 CCTACTCTCAGGAACCAGCCTGG + Intronic
1097178772 12:57158912-57158934 GCTGCACACAGCACACAGCCAGG + Intronic
1097723668 12:63050545-63050567 CCTCATCTCTTGACACAGCCAGG + Intergenic
1101840575 12:108324868-108324890 CCTCCAGTCTGACCACAGCCAGG + Intronic
1102470637 12:113158043-113158065 CCTCCACTATGGACTCTGCCAGG + Exonic
1102587339 12:113932598-113932620 ACGCCTCTCTGGACACAGCCTGG - Intronic
1102900234 12:116630931-116630953 CCTCCGTTCTGGACACACCCAGG + Intergenic
1103869095 12:124078325-124078347 GCTCCACTCTGCACACAGCAGGG + Intronic
1103904639 12:124321098-124321120 CCTCCACCCAGGGCACAGAGTGG - Intergenic
1106547005 13:30739365-30739387 CCTGCACCCAGGACACTGCCTGG + Intronic
1108039859 13:46329999-46330021 CCTTCTCTCAGGACACCGACTGG - Intergenic
1113642864 13:111970744-111970766 CCTCCACTTGGGACACAGCGAGG + Intergenic
1113646987 13:112005092-112005114 CCTCCACTCACTGCACAGCCTGG + Intergenic
1113691737 13:112315903-112315925 CATACCCTCAGGATACAGCCAGG + Intergenic
1113812317 13:113150150-113150172 CCTGCATCCAGGCCACAGCCTGG + Intergenic
1118306998 14:64663098-64663120 CCTCCCCACAGCACCCAGCCTGG + Intergenic
1119024499 14:71141991-71142013 CCTCCTCACTGCACACAGCCAGG + Intergenic
1119195415 14:72713829-72713851 CCTAAACTCAGGAGCCAGCCAGG + Intronic
1119791999 14:77359313-77359335 CCTGCACTCAGGACCCTTCCAGG + Intronic
1120163568 14:81170444-81170466 CCTCCACTCAGAACACTGGGAGG + Intergenic
1121142495 14:91555471-91555493 CCTCCACTGGTGACACATCCAGG + Intergenic
1121488923 14:94343945-94343967 CCTCTAGTCAGGACAGAACCAGG - Intergenic
1122716179 14:103698309-103698331 CCACCACTCAGGCCACAGTGGGG - Exonic
1122913513 14:104845194-104845216 CCTCCCCACAAAACACAGCCTGG - Intergenic
1123814284 15:23961127-23961149 GCGCCACTCTGCACACAGCCTGG - Intergenic
1123998518 15:25735098-25735120 CCTCCAAGCAGGACAGTGCCAGG + Intronic
1124150959 15:27177844-27177866 GCTCAACTCTGGACACAGCATGG + Intronic
1124432418 15:29618971-29618993 CCTCCACTCCAGCCGCAGCCAGG - Intergenic
1124628658 15:31325524-31325546 GCTCCTCTCAGAACACAGCAAGG + Intergenic
1126484970 15:49170124-49170146 CCTCCTCCCTGGACTCAGCCAGG - Exonic
1127187599 15:56495280-56495302 CCTACACTCAGCACACAGGCTGG + Intergenic
1127705977 15:61547619-61547641 CATCCTCACAGGACACACCCAGG + Intergenic
1128229593 15:66025299-66025321 CCCCCACTCAGGAATCAGCCTGG - Intronic
1128495457 15:68195927-68195949 ACTCCCCCCAGGACACTGCCCGG - Intronic
1128816960 15:70617244-70617266 CATGCAGTCAGGACACAGGCTGG - Intergenic
1132631097 16:917821-917843 AGTCCACTCCAGACACAGCCTGG - Intronic
1132783015 16:1638826-1638848 CCACCCCGCAGGACACAGCAAGG - Intronic
1133030022 16:3006110-3006132 CTTCCTCTCAGGGCCCAGCCCGG - Intergenic
1133782578 16:8951430-8951452 GCTCCACAGAGAACACAGCCCGG + Intronic
1133969621 16:10558418-10558440 CCTCTACTTAGGAAACAGCGAGG - Intronic
1134092140 16:11397153-11397175 CCTGCACCTAGAACACAGCCTGG + Intronic
1134688516 16:16175413-16175435 CCTCCAGCCAGGACACAGCTGGG - Intronic
1135526861 16:23219850-23219872 CATCCAGGCAGGACAAAGCCAGG + Intergenic
1136643434 16:31588342-31588364 CCTCCACTGATGACACCTCCAGG - Intergenic
1137056720 16:35749610-35749632 CCTCCATCCAGGCCCCAGCCAGG - Intergenic
1137491297 16:48935290-48935312 TTTCCACTCAGGACAGAGGCAGG - Intergenic
1137589725 16:49686194-49686216 CCAGCACTCAGCACACAGCCTGG + Intronic
1140063531 16:71591122-71591144 CCTGCATTCAGAACAGAGCCTGG - Intergenic
1140468750 16:75203183-75203205 CCGCCAATCCGGACACATCCTGG + Intergenic
1140934296 16:79656454-79656476 CCTTCATTCAGGACAGGGCCTGG - Intergenic
1141097404 16:81172637-81172659 CCTCAACCCAAGACACAGCCGGG - Intergenic
1141728318 16:85805315-85805337 CCTCCACTCAGCACAGAGAAGGG - Intronic
1141757461 16:86001427-86001449 ACTCCACTGAGAACACACCCAGG - Intergenic
1141762559 16:86038461-86038483 CTTCTGCTCAGGACACAGTCCGG - Intergenic
1141946586 16:87315018-87315040 CTTCCACCCTGGACACAGGCAGG + Exonic
1142226640 16:88880859-88880881 CCTGCACTCAGGGCCCAGCCAGG - Intronic
1142258918 16:89033371-89033393 CATCCACTCAGGACCCTGCGTGG + Intergenic
1142271132 16:89089863-89089885 CCACAAATCAGGAAACAGCCTGG - Intronic
1142961365 17:3554310-3554332 CATCCACTCTGCACCCAGCCGGG - Intronic
1144084765 17:11798772-11798794 CCTCCACTCAGGGGTCAGTCAGG - Intronic
1144445382 17:15322567-15322589 CCACAACTCAGGCCACAGCGCGG - Intronic
1144468391 17:15515461-15515483 CCTCCACTCGGGAAACATACAGG + Intronic
1144564605 17:16349602-16349624 TTTCCACTCAGTACCCAGCCAGG + Intronic
1144952812 17:19003373-19003395 CCTCCACCCAAGAGGCAGCCAGG + Intronic
1149363889 17:55921463-55921485 TCTCCACTCAGGATAGAGGCAGG - Intergenic
1151284990 17:73104425-73104447 CATTCACCCAGGACACATCCAGG - Intergenic
1152224874 17:79088058-79088080 CCTCCACCCAGGACAGTCCCCGG - Intronic
1152231678 17:79117113-79117135 CCTCCACTGCAGACACAGCCTGG + Intronic
1152469147 17:80481379-80481401 CCAGCCCTCAGGACACAGTCAGG + Intergenic
1152502768 17:80724262-80724284 CCACCTCTCAGGACATGGCCTGG - Intronic
1152940844 17:83172338-83172360 CCCCCACACGGGGCACAGCCAGG - Intergenic
1152959916 18:73417-73439 CCTCTCCTCAGGACCCACCCAGG - Intronic
1153632434 18:7084537-7084559 CTTCCACTCAGGACACACAATGG + Intronic
1155020514 18:21892682-21892704 ACTCCACTCAGGACCCTTCCTGG - Intergenic
1155399287 18:25420318-25420340 CCTCCTCTCAAGGCACACCCTGG - Intergenic
1156745954 18:40391310-40391332 CCTGGAATCAGGACACAGACAGG - Intergenic
1157607230 18:48933447-48933469 CCTCTGCACAGCACACAGCCTGG + Intronic
1160217743 18:76947782-76947804 TGTCCACTCAGGATTCAGCCGGG - Intronic
1160512456 18:79460177-79460199 CCTCCACCCAGGCAGCAGCCCGG + Intronic
1160527743 18:79547459-79547481 GCCCCACGCAGGCCACAGCCGGG + Intergenic
1160682390 19:417813-417835 CCTCCACCCAGCCCCCAGCCAGG - Intronic
1160775832 19:855324-855346 CCTGCACTCAAGCCACATCCAGG + Intronic
1160802195 19:975220-975242 CACCCACTCAGTACGCAGCCAGG - Exonic
1160910599 19:1472138-1472160 CCCCCTTTCAGGACACAGCGGGG + Exonic
1161320605 19:3639077-3639099 CCCCCACTCAGGACCCAGGCAGG + Intronic
1161392409 19:4028352-4028374 CCCCCACTCAGGCCACACCCGGG + Intronic
1161717838 19:5886777-5886799 CCTCCTACCAGAACACAGCCAGG + Intronic
1162249582 19:9430903-9430925 CAGCAACTCAGGAGACAGCCGGG - Intronic
1162326746 19:10003996-10004018 CCTAATCTCAGGACACAGGCTGG - Intronic
1163726912 19:18928254-18928276 CGTCCACCCAGGACACCGTCTGG + Exonic
1164520676 19:28976826-28976848 GCTCCACTCATGCCACTGCCAGG + Intergenic
1164599836 19:29553271-29553293 CCTCCACTGATGACACCTCCAGG + Intronic
1165387573 19:35519897-35519919 CCTCCAGGCAGGAGAGAGCCAGG + Intergenic
1166260523 19:41637315-41637337 CCTGCCCTCATGACCCAGCCAGG - Intronic
1167369046 19:49070088-49070110 CCTCCACTCTGGGCACCCCCAGG - Exonic
1167390794 19:49193638-49193660 CCTCCAGCCAGGCCACAGGCAGG - Intronic
1167591571 19:50407009-50407031 CCTTCAGGCAGTACACAGCCAGG - Exonic
1167613286 19:50517514-50517536 CCCCCACCCAGGTCCCAGCCCGG - Exonic
1167803873 19:51765677-51765699 CCACGACACAGCACACAGCCTGG + Intronic
1202635286 1_KI270706v1_random:39345-39367 CCACCACTGAAGAGACAGCCTGG - Intergenic
1202649933 1_KI270706v1_random:170756-170778 CCACCACTGAAGAGACAGCCTGG + Intergenic
926113383 2:10196526-10196548 CCAGCAACCAGGACACAGCCTGG - Intronic
926358992 2:12067509-12067531 CCACCACTCAGCTCACGGCCAGG - Intergenic
926627226 2:15102327-15102349 CCTGCTGTCAGGACACACCCAGG + Intergenic
926958677 2:18330835-18330857 CCTCCAGTCAGCAAAAAGCCAGG + Intronic
927195115 2:20541516-20541538 CCTTCAGTCAGGACACAGAAAGG - Intergenic
927644718 2:24870417-24870439 GCCACACTCAGGACAGAGCCTGG + Intronic
928329798 2:30348927-30348949 CCTCCACACCAGGCACAGCCTGG - Intergenic
928435362 2:31251384-31251406 CCTCCAGGGAAGACACAGCCTGG + Intronic
930070531 2:47362428-47362450 CCTCCACCCAGGTCAGAGCTTGG + Intronic
930355712 2:50316299-50316321 CCTCCACTGAGGACTCTACCTGG + Intronic
932319225 2:70808922-70808944 CCTGCCCTCAGGCCACACCCTGG + Exonic
933213260 2:79596196-79596218 CCAACACTCAGGACGCTGCCTGG + Intronic
933810689 2:86031184-86031206 CTCCCACTCAGAGCACAGCCAGG - Intronic
933998824 2:87689498-87689520 CCTCCACTCAGCATCCACCCTGG - Intergenic
934132915 2:88966735-88966757 GACCCACTCAGGACACAGCATGG - Intergenic
934140917 2:89046463-89046485 GACCCACTCAGGACACAGCATGG - Intergenic
934148293 2:89117814-89117836 GTCCCACTCAGGACACAGCATGG - Intergenic
934220998 2:90082797-90082819 GTCCCACTCAGGACACAGCATGG + Intergenic
934228315 2:90154079-90154101 GACCCACTCAGGACACAGCATGG + Intergenic
934228907 2:90159841-90159863 GACCCACTCAGGACACAGCATGG + Intergenic
934305406 2:91817753-91817775 GCCCCAGTCAGGACACAGCACGG + Intergenic
934327850 2:92034995-92035017 GCCCCAGTCAGGACACAGCACGG - Intergenic
934466240 2:94265534-94265556 GCCCCAGTCAGGACACAGCAAGG - Intergenic
935264105 2:101380296-101380318 TCTCCACCAAGGATACAGCCCGG - Intronic
936174269 2:110205126-110205148 CCACCAGGCAGGTCACAGCCGGG + Intergenic
936484467 2:112914456-112914478 CCTCTTCTCAGGACAGAGTCAGG + Intronic
936508218 2:113124862-113124884 CCACTTCTCAGGACACAGCGGGG + Intronic
938146421 2:128838418-128838440 CCTCCCCTCAGGCCCCTGCCTGG - Intergenic
938979701 2:136514480-136514502 TCCCCACACAGGACAGAGCCTGG + Intergenic
946874212 2:224111540-224111562 CCACCACTGAAGACACAGCTGGG + Intergenic
947907024 2:233772325-233772347 ACTCCACCCAGAACACGGCCAGG - Exonic
948641402 2:239378070-239378092 CCTCCACTCAGCCAACATCCGGG + Intronic
948862605 2:240760208-240760230 CCTCCATTCAGGAAGCTGCCGGG - Intronic
948917337 2:241041161-241041183 CCTCCCCTCAGGACACACCCTGG - Intronic
1168971823 20:1936598-1936620 CCTTCACTCAGGGCAAAGCTGGG - Intronic
1170882744 20:20311539-20311561 CCTCCACTCAGGACTCTGCATGG - Intronic
1171558148 20:26096654-26096676 CCTCTGCTCAGGACATAGCATGG + Intergenic
1171820736 20:29835805-29835827 CCTGCTCACAGGACACAGCTTGG - Intergenic
1173576302 20:44114927-44114949 CCCCCACCCAGGTCACAGCAAGG + Intronic
1174773155 20:53320166-53320188 CAAGCACTCAGGACAAAGCCTGG - Intronic
1176306503 21:5126295-5126317 ACTCCACTGAGGGCACAGCCTGG + Intronic
1179850556 21:44135735-44135757 ACTCCACTGAGGGCACAGCCTGG - Intronic
1180083957 21:45499247-45499269 CCTCCACTGCCGACACAGCTCGG - Intronic
1180259954 21:46662149-46662171 CCACCACTCTGGGCCCAGCCTGG + Intronic
1180365419 22:11933882-11933904 CCACCACTGAAGAGACAGCCTGG + Intergenic
1180587362 22:16904692-16904714 GCCCCAGTCAGGACACAGCACGG - Intergenic
1180590601 22:16934000-16934022 GCCCCAGTCAGGACACAGCACGG - Intergenic
1180747824 22:18103663-18103685 CCTCCACCCTGCCCACAGCCCGG + Exonic
1180966317 22:19789584-19789606 CCCCCTCTCAGAACCCAGCCGGG - Intronic
1181173406 22:21022808-21022830 CCTGCACTCAGGAGCCACCCAGG - Intronic
1181633691 22:24164571-24164593 CAGCCACCCTGGACACAGCCTGG + Intronic
1183079255 22:35446096-35446118 CCAGCACTCAGTACAGAGCCTGG - Intergenic
1183648867 22:39142348-39142370 ACCCCACCCAGGCCACAGCCAGG + Intronic
1184279231 22:43427526-43427548 CCCTCCCTCAGGACGCAGCCCGG - Intronic
1184872362 22:47249108-47249130 TCAGCACTCAGGACAGAGCCTGG + Intergenic
1184877485 22:47284660-47284682 CCACCACGCAGGGCTCAGCCTGG - Intergenic
1184920129 22:47600330-47600352 CCTCCTCCCAGAAAACAGCCTGG - Intergenic
1185035944 22:48476989-48477011 TCTCCACTCAGGGCACAGTGGGG - Intergenic
1185074039 22:48673619-48673641 CCTACACACAGTACACAGCCAGG - Intronic
1185151119 22:49164483-49164505 CCACCACACAGGAGACAGACAGG - Intergenic
950264267 3:11562824-11562846 CCTGGACTGAGGACAAAGCCAGG - Intronic
951411421 3:22372088-22372110 CCTCGACTCTGGACAGAACCAGG + Intronic
952687277 3:36164199-36164221 CCTCCACTCTGGAAGAAGCCTGG + Intergenic
952968596 3:38636746-38636768 CCTGCAGGCAGGACTCAGCCAGG - Intronic
953355505 3:42253113-42253135 CCGCTACTCAGGTCACAGACTGG - Intergenic
954151140 3:48657703-48657725 CCCCAACTCAGGACACAGAGAGG + Intronic
954436746 3:50500346-50500368 GCTCCACCCAGCACTCAGCCAGG + Intronic
954795453 3:53159422-53159444 CCAGCACCCAGCACACAGCCTGG + Intronic
955415489 3:58687344-58687366 CCTCCCCTCAGTACTCAGCATGG + Intergenic
956726857 3:72163509-72163531 CCTCAACTCAGGGGACAGCCAGG - Intergenic
962091481 3:132248670-132248692 CCTTCACTGTGGACAGAGCCTGG + Intronic
962206815 3:133441583-133441605 CCTACCCTCAGGGAACAGCCAGG - Intronic
963867036 3:150372777-150372799 CCAGCACTCAGCACACTGCCAGG - Intergenic
964129954 3:153275934-153275956 CCTTCCCCCAAGACACAGCCAGG - Intergenic
968449075 4:666708-666730 ACTCCAGTGAGGACACCGCCGGG - Intronic
969521076 4:7678056-7678078 CCTGCCCTCGGGACACAGGCTGG + Intronic
969559523 4:7938799-7938821 CCTCCAATCAGAGCCCAGCCCGG + Intronic
969563434 4:7963670-7963692 CCTGCACCCAGGACAGTGCCAGG + Intergenic
972705898 4:41542102-41542124 CCTCCCCTCATTACACATCCTGG + Intronic
973395380 4:49588856-49588878 CCACCACTGAAGAGACAGCCTGG + Intergenic
973545048 4:51973059-51973081 CCTCCACTGGGGACACCTCCAGG - Intergenic
975671343 4:76784112-76784134 CCCCCACTCTGTGCACAGCCAGG - Intergenic
975823202 4:78292622-78292644 GGTCCACCCAGGGCACAGCCAGG - Intronic
976398669 4:84583551-84583573 CTTCCAACCAGGACCCAGCCAGG - Intronic
977086076 4:92600703-92600725 CCTCCACTGATGACACCTCCAGG - Intronic
977190899 4:93999868-93999890 CCAGCACTCAGGACATTGCCTGG + Intergenic
981290593 4:143070940-143070962 CCTCTACTCATGACACTTCCAGG - Intergenic
982227636 4:153180910-153180932 CCAGCACTCAGGACAATGCCTGG - Intronic
984608861 4:181815653-181815675 CCTCCACTGATCACACAGCTGGG + Intergenic
985827602 5:2204666-2204688 CCTTCACTCAGAACATACCCTGG + Intergenic
986181662 5:5398726-5398748 CTTCCACTCAGTACAAACCCAGG + Intergenic
986639276 5:9856329-9856351 TCTCCACTTGGGATACAGCCTGG - Intergenic
993002341 5:82394137-82394159 CCTCCACACAGCGCTCAGCCTGG - Intergenic
995115433 5:108472929-108472951 CCACCACTGCGGACACAGCTGGG + Intergenic
996086449 5:119310297-119310319 CCTCCACTCAGGGCTCTCCCAGG - Intronic
996091567 5:119356481-119356503 CCTCCACTCAGGGCTCTTCCAGG - Intronic
996833950 5:127770464-127770486 CCTCCACTCACTGCACTGCCAGG + Intergenic
997143260 5:131405848-131405870 CCTCCAGCCAGGTGACAGCCAGG + Intergenic
998094669 5:139390506-139390528 CCTCCACCCAGGCCATACCCAGG + Intergenic
998703370 5:144731288-144731310 ACTCCACTCCGGACAAAGCTGGG - Intergenic
999290203 5:150419973-150419995 CCTTCACCCAAGCCACAGCCTGG + Intergenic
999883898 5:155898712-155898734 CATCCCCTCAGGATACAGCTTGG + Intronic
1001664484 5:173421249-173421271 CCTCCATTCAGGACACGTGCAGG - Intergenic
1001989118 5:176101496-176101518 TGTGCACACAGGACACAGCCTGG + Intronic
1002065875 5:176651425-176651447 CTTCCCCACAGGACACAGCCTGG - Intronic
1002139569 5:177130836-177130858 CCAGCACTCAGCACACTGCCTGG + Intergenic
1002196420 5:177504013-177504035 CCTCCGCTCACGACTCAGCAGGG + Exonic
1002227752 5:177736642-177736664 TGTGCACACAGGACACAGCCTGG - Intronic
1002417086 5:179126295-179126317 CCTCCACCCGGGACACACCAAGG - Intronic
1003110289 6:3247483-3247505 CCAGCACTCAGGACAGTGCCTGG + Intronic
1003259056 6:4500125-4500147 CCTGCACCCAGCACACTGCCTGG + Intergenic
1003332102 6:5137783-5137805 TCTCCACTCAGGTCACACACTGG + Intronic
1003769913 6:9288774-9288796 CCTCCACTAAGGCCAGAGCAGGG + Intergenic
1007352014 6:41280885-41280907 CATCCTCTCAGCACACAGACTGG + Intronic
1007396197 6:41579058-41579080 TCTCCACCCAGGACAAAGCCTGG - Intronic
1007509626 6:42365086-42365108 TCACCACTCAGGAGACAACCTGG - Intronic
1007801398 6:44396875-44396897 CCTGCACTCAGGACCCTTCCAGG - Intronic
1012613938 6:101252155-101252177 CCTCTCCTTAGGTCACAGCCTGG + Intergenic
1014250754 6:119113340-119113362 CCGTAACTCAGGACACAGCCAGG - Intronic
1016511707 6:144850033-144850055 CCTCCCCTCAGTACAATGCCTGG + Intronic
1017524298 6:155229213-155229235 CCTACACCCAGAACAGAGCCTGG + Intronic
1018787027 6:167116446-167116468 CCTCCTCTCAGCCCACAGCGCGG + Intergenic
1019294376 7:266262-266284 TCTCAACACAGGACACTGCCTGG + Intergenic
1019406859 7:888563-888585 CCGCCACTCGGCACACAGCCAGG - Intronic
1019486720 7:1292816-1292838 CCTACTCCCAGGACAAAGCCAGG - Intergenic
1019913560 7:4116315-4116337 CCTCCACCCTCGAGACAGCCAGG + Intronic
1020128365 7:5545730-5545752 CCCCTGCTGAGGACACAGCCCGG + Intronic
1021910975 7:25385804-25385826 CCTCGGCTGAGCACACAGCCTGG + Intergenic
1022441099 7:30434098-30434120 CATCTACTCCGGACTCAGCCTGG + Intronic
1022510472 7:30932092-30932114 ACTCCACTCAGGCCTTAGCCAGG - Intergenic
1024033034 7:45481189-45481211 TCTCCACTCAGGCAATAGCCTGG + Intergenic
1024302318 7:47896643-47896665 CCTCCCCCCAGCACACAGCCAGG + Intronic
1025210550 7:57017686-57017708 CCTTCACTCAGAACACTTCCCGG + Intergenic
1028185948 7:87785359-87785381 CCCCCACTCAGAACACAAACAGG - Intronic
1029475954 7:100784754-100784776 TCTTCACTCAGCACATAGCCGGG - Exonic
1030695679 7:112582308-112582330 CCTCAAGTCAGGACAAATCCAGG + Intergenic
1032414605 7:131726355-131726377 CAGCCACTCAGGACACAGGAAGG - Intergenic
1032524502 7:132569393-132569415 CCTTCACTCCAGTCACAGCCTGG - Intronic
1033946979 7:146731165-146731187 CGTACAATCTGGACACAGCCAGG - Intronic
1034267515 7:149788415-149788437 CCTCCACACAGGCCACCACCTGG - Intergenic
1034269796 7:149797989-149798011 CATCCCCTGAGGATACAGCCTGG - Intergenic
1034457698 7:151180197-151180219 CCTCCAGACACGACACAGCATGG + Intronic
1034492742 7:151402676-151402698 CCTCCATTCTGGCCACATCCCGG - Intronic
1034531736 7:151700230-151700252 CCAGCACCCAGAACACAGCCCGG - Intronic
1034657665 7:152742154-152742176 CCTGCACCCAGCACAGAGCCTGG - Intergenic
1034760614 7:153668679-153668701 CCTCCACTCTGGACTCTGCAAGG + Intergenic
1036731739 8:11271628-11271650 GCTCCACTCCAGACACAGCCTGG + Intergenic
1037686445 8:21143552-21143574 CCTCCACTGAGGGAAGAGCCAGG + Intergenic
1037877095 8:22553635-22553657 CCTGCACTCACAAAACAGCCTGG + Intronic
1039558834 8:38496632-38496654 CCTCCTCTTAGGACTCAGCCTGG - Intergenic
1039891026 8:41685521-41685543 TGTCCTCTCAGGACACAGTCTGG - Intronic
1040905906 8:52469790-52469812 CCTCCACTCAGGACCCTCCAGGG + Intergenic
1041366734 8:57114279-57114301 CCTCCACCCAGGAGACTGCTGGG - Intergenic
1041668112 8:60465748-60465770 CCCCCACTCAGGACACTCACAGG + Intergenic
1042857016 8:73277776-73277798 CCTCAACAGAGGAAACAGCCTGG + Intergenic
1043731329 8:83687069-83687091 CCACCACCCAAGACACAGCCAGG + Intergenic
1045392141 8:101726101-101726123 CCTCCACTCCAGCCACATCCTGG - Intronic
1045392681 8:101731181-101731203 CCTCCACTCTAGCCACATCCTGG - Intronic
1046052495 8:109040312-109040334 GCCCCACTCTGGAAACAGCCAGG + Intergenic
1046499317 8:115055193-115055215 CCTTCCCTGAGGACACAGCTTGG + Intergenic
1047474382 8:125212528-125212550 CCTCCACTCAAACCTCAGCCTGG - Intronic
1048205542 8:132412461-132412483 CCTCCAACCAGGATTCAGCCAGG + Intronic
1048969330 8:139635761-139635783 CCCCCACTCAGGAGGCAGCCTGG + Intronic
1049245560 8:141560448-141560470 CCTGCCCTCAGCACAGAGCCTGG - Intergenic
1049261093 8:141639625-141639647 CCTGGTCTGAGGACACAGCCAGG + Intergenic
1049560193 8:143306482-143306504 CCACAGCTCAGGACACAGCAGGG - Intronic
1051169291 9:14302781-14302803 CCTTCAGACAGGACACAGTCTGG + Intronic
1051581457 9:18680369-18680391 CCTCCACACAGGAAACTGCCCGG - Exonic
1051867046 9:21695103-21695125 CCTCCTTTCAGGAAACAGACCGG + Intergenic
1053200263 9:36147435-36147457 CCTCCACTCAGCAGCCAGCAAGG + Intronic
1053365212 9:37517982-37518004 CCTCCTGCCAGGACTCAGCCTGG - Intronic
1053696289 9:40642306-40642328 GCCCCAGTCAGGACACAGCACGG - Intergenic
1054307540 9:63441534-63441556 GCCCCAGTCAGGACACAGCACGG - Intergenic
1054406268 9:64765536-64765558 GCCCCAGTCAGGACACAGCACGG - Intergenic
1054439895 9:65251009-65251031 GCCCCAGTCAGGACACAGCACGG - Intergenic
1054490511 9:65770930-65770952 GCCCCAGTCAGGACACAGCACGG + Intergenic
1054880061 9:70135357-70135379 CACCCACTCAGGTCACAGACAGG + Intronic
1059327429 9:113512696-113512718 CCTGCACCCAGGACCCAGGCTGG + Intronic
1059354094 9:113686490-113686512 CCTGCAGTCAGGAGACAGCATGG + Intergenic
1061025189 9:128043806-128043828 CCTCCCCTCAGCACACCCCCAGG + Intergenic
1061140667 9:128764316-128764338 GCTGCACTCAGGACACTGCTGGG + Intronic
1062341164 9:136094611-136094633 CCCCCACTCGGGCCCCAGCCTGG - Intronic
1062436676 9:136549423-136549445 CCCCCACCCAGGACCCAGCAGGG - Intergenic
1062479013 9:136742958-136742980 CCTCCTCTCCCGACACAGGCTGG - Exonic
1202778737 9_KI270717v1_random:15967-15989 GCCCCAGTCAGGACACAGCACGG - Intergenic
1203791705 EBV:155110-155132 CCTACATTCTGGACAGAGCCAGG - Intergenic
1203585813 Un_KI270747v1:2375-2397 GCCCCAGTCAGGACACAGCACGG - Intergenic
1185504347 X:620213-620235 CCTCACCTCAGGCCTCAGCCGGG + Intergenic
1186090882 X:6047857-6047879 CCTGCACTCAGATCCCAGCCAGG - Intronic
1188046086 X:25427396-25427418 TCTCCAATCAAGACACAGACTGG - Intergenic
1190493475 X:51005253-51005275 CCTTCACTCAGGACCCTTCCAGG + Intergenic
1191034462 X:56009268-56009290 CCTCCACTGATGACACCTCCAGG + Intergenic
1192270121 X:69571190-69571212 CCTCCCCTGAGGACATAGCCAGG - Intergenic
1193396791 X:80993277-80993299 CCTCCAATCAAGACACAGAGTGG + Intergenic
1193723659 X:85016637-85016659 ACTCCACTGAAGACACAGCAGGG - Intronic
1198776903 X:140189423-140189445 ACTGCACTCAGGACACAGCCAGG + Intergenic
1199701573 X:150381293-150381315 CCTTCACCCAGTTCACAGCCAGG + Intronic
1200758605 Y:7015530-7015552 CCAGCACTCAGAAGACAGCCAGG + Intronic
1200908420 Y:8509374-8509396 CCCCCACAGAGGACACAGGCTGG - Intergenic
1201194039 Y:11474235-11474257 GCCCCAGTCAGGACACAGCACGG - Intergenic
1201552236 Y:15229678-15229700 CCTCCACTCTGGACACAGTGTGG - Intergenic