ID: 1077474379

View in Genome Browser
Species Human (GRCh38)
Location 11:2779453-2779475
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 269
Summary {0: 2, 1: 0, 2: 0, 3: 22, 4: 245}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077474379_1077474391 24 Left 1077474379 11:2779453-2779475 CCTGCTTCCATCTCGGCTGCAGC 0: 2
1: 0
2: 0
3: 22
4: 245
Right 1077474391 11:2779500-2779522 CTGACGTGCAGGAGTGTCGGTGG 0: 1
1: 0
2: 0
3: 3
4: 64
1077474379_1077474385 -10 Left 1077474379 11:2779453-2779475 CCTGCTTCCATCTCGGCTGCAGC 0: 2
1: 0
2: 0
3: 22
4: 245
Right 1077474385 11:2779466-2779488 CGGCTGCAGCCAGGCAGGCGGGG 0: 1
1: 1
2: 3
3: 45
4: 433
1077474379_1077474387 13 Left 1077474379 11:2779453-2779475 CCTGCTTCCATCTCGGCTGCAGC 0: 2
1: 0
2: 0
3: 22
4: 245
Right 1077474387 11:2779489-2779511 CGTGAACATCCCTGACGTGCAGG 0: 1
1: 0
2: 0
3: 0
4: 29
1077474379_1077474388 21 Left 1077474379 11:2779453-2779475 CCTGCTTCCATCTCGGCTGCAGC 0: 2
1: 0
2: 0
3: 22
4: 245
Right 1077474388 11:2779497-2779519 TCCCTGACGTGCAGGAGTGTCGG 0: 1
1: 0
2: 2
3: 14
4: 562

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077474379 Original CRISPR GCTGCAGCCGAGATGGAAGC AGG (reversed) Intronic
900311910 1:2037556-2037578 CCTGCAGCCAGGATGAAAGCTGG - Intergenic
900457472 1:2784232-2784254 GCTGAAGCAGAGATAGAAGGTGG + Intronic
900506906 1:3033948-3033970 GCTGCAGCACAGATGGAGGATGG + Intergenic
900743571 1:4344993-4345015 GCTCCAGCAGAGATGAAAGAAGG - Intergenic
901167587 1:7231012-7231034 GCTGCATCCAAGGTGGAAGGAGG + Intronic
902449340 1:16486634-16486656 GCTGCAGCTGGGAGGGGAGCTGG - Intergenic
902505408 1:16936643-16936665 GCTGCAGCTGGGAGGGGAGCTGG + Exonic
903374484 1:22857321-22857343 GCTACAGCGGAGATGTGAGCTGG + Intronic
903995630 1:27303817-27303839 GGTGCAGCCCAGTTGGCAGCGGG + Intronic
904248395 1:29204737-29204759 GCTGCAGCCTAAATGGGAGGTGG + Intronic
904471363 1:30738476-30738498 GCTGCACCAGAGATGGTACCTGG - Intronic
907944084 1:59117082-59117104 GCTGCAGCCAAGAGCGAAGGGGG + Intergenic
910415554 1:86993386-86993408 GCTTCAGCAGACATGTAAGCAGG - Intronic
911042715 1:93603769-93603791 GCCGCAGCTGTGATGGAAGGAGG + Intronic
913091518 1:115479439-115479461 GCTGCAGCCACATTGGAAGCCGG + Intergenic
915245506 1:154553413-154553435 GCTGCAGCTGAGATCGAGGCAGG + Intronic
915791612 1:158678128-158678150 GCTGCAGACGGAAGGGAAGCAGG - Intronic
922127618 1:222743902-222743924 GCTGAAGCCGAGATGGTTGCTGG - Intronic
922196667 1:223364846-223364868 GCTTCGGCGGAGATGGGAGCGGG - Intergenic
922355055 1:224767428-224767450 GCTGCAGGGGTGATGGAAGGAGG - Intergenic
922730289 1:227945860-227945882 CCAGCAGCCCAGATGGAACCTGG + Intronic
922786073 1:228282917-228282939 GCTGTAGCCCAGATGGTGGCTGG + Intronic
924218509 1:241849417-241849439 GCTGCAACCGGAATGGAAGGGGG + Intronic
1063138878 10:3239449-3239471 GCTGCAGCCACGATGGGTGCTGG + Intergenic
1063728495 10:8667993-8668015 GCTGCAGTCAAGATGTCAGCTGG + Intergenic
1064300565 10:14119196-14119218 GCTGCAGCCCAGGTGCCAGCAGG - Intronic
1065261887 10:23932081-23932103 GCACCAGCAGAGATGGAAGTTGG - Intronic
1065871459 10:29959746-29959768 GCTGCAGCCGAGACGGGACGGGG - Intergenic
1067193175 10:44089773-44089795 GTTTCAGCAGATATGGAAGCTGG - Intergenic
1069938134 10:71933528-71933550 GCTGCAGAAAAGTTGGAAGCTGG - Intergenic
1070549497 10:77480060-77480082 CCTGCAGCCAAGACAGAAGCTGG + Intronic
1070790986 10:79189231-79189253 GTTGCAGCTGAGAGGGAGGCAGG - Intronic
1073118528 10:101107477-101107499 ACTGCATCCGAGAGAGAAGCGGG + Intronic
1073232798 10:101986708-101986730 CCTGCTGCCCAGCTGGAAGCAGG + Intronic
1075400113 10:122154988-122155010 GCAGCAGTCGAGACAGAAGCTGG - Intronic
1076270038 10:129144350-129144372 GCTGCAGCCAGGAAGGAAGGGGG + Intergenic
1077474227 11:2778845-2778867 GCTGCAGCCGAGATGGAAGCAGG - Intronic
1077474379 11:2779453-2779475 GCTGCAGCCGAGATGGAAGCAGG - Intronic
1077722773 11:4644444-4644466 GCTGCAGCTGGGGTGGAAGTGGG + Intronic
1078391843 11:10941691-10941713 GTTGCAGCCAAGATGTCAGCTGG - Intergenic
1079309998 11:19356676-19356698 GCTGCAGCTGGGATGGATGCTGG + Intronic
1081536359 11:43999383-43999405 GCTGCAGCCAACATGTCAGCTGG + Intergenic
1081856247 11:46305513-46305535 GCTGCAGGCAAGATGGAGGCAGG - Intronic
1082001268 11:47394841-47394863 GCTGCTGCCGATGTGGAAACAGG - Intergenic
1082011549 11:47453018-47453040 GCTGCAGATGGGAGGGAAGCTGG + Intergenic
1083066878 11:59932472-59932494 GCTGCAGCCGGGATGATGGCAGG + Intergenic
1084084126 11:66847044-66847066 GCTGCAGCCCTGAGGGCAGCAGG + Intergenic
1084493880 11:69492630-69492652 TCTGCAGTCGAGGTGGCAGCGGG - Intergenic
1084598704 11:70132405-70132427 GCTGCAGCAGGGATGGAGGCAGG - Intronic
1085574529 11:77590150-77590172 GCAGCAGCAGAGCTGGAAGGTGG - Exonic
1089453285 11:118611052-118611074 GCCGCGGGCCAGATGGAAGCGGG + Intronic
1089629214 11:119773573-119773595 GCAGCAGGAGAAATGGAAGCTGG - Intergenic
1090415136 11:126535264-126535286 GCTGCATCCAGGTTGGAAGCCGG - Intronic
1090667783 11:128926188-128926210 CCTGCAGCCGAGCTGGAAGGAGG + Intergenic
1091217754 11:133913708-133913730 GCAGCAGCTGGGAAGGAAGCGGG + Intronic
1091339757 11:134801162-134801184 GCTGCGGGCGAGAGGGACGCTGG + Intergenic
1091885836 12:4016398-4016420 GCAGCAGCCCAGATAGAAACAGG + Intergenic
1092758685 12:11789454-11789476 GCTGAAGCCCAGACCGAAGCAGG - Intronic
1095038459 12:37419249-37419271 GCTGCAGCCGAGGCGGCAGCTGG + Intergenic
1095038914 12:37421675-37421697 GCTGCAGCCGCGGTGGCTGCTGG + Intergenic
1095743383 12:45631114-45631136 GCTGCAGGGTAGATGGAAGTGGG - Intergenic
1096539621 12:52298201-52298223 GCTGGAGCAGAGATTGAAGGAGG + Intronic
1097066801 12:56326623-56326645 GCTGGAGCAGAGTTGGCAGCAGG + Exonic
1097489707 12:60250751-60250773 ACTGCAACTGAGATGGAAGAAGG + Intergenic
1098416739 12:70243351-70243373 GCTGCCGCCTGGAGGGAAGCCGG + Exonic
1098578138 12:72068037-72068059 GCTGCTGCAGAAATGGAAACAGG - Intronic
1102058518 12:109914750-109914772 ACTGCAGCTGGGATGGAAACGGG - Intronic
1102651435 12:114445257-114445279 GCAGCAGCCGAAGTCGAAGCCGG - Intergenic
1105014483 12:132777780-132777802 GCTGCTGCCAAGGTGGAAGCCGG - Exonic
1105452437 13:20512121-20512143 CCTCCTGCCTAGATGGAAGCAGG + Intronic
1105612633 13:21982414-21982436 GCTCCAGCCCCGATGGCAGCTGG - Intergenic
1106537542 13:30660464-30660486 GCTGCAGCCGGAATGATAGCAGG + Intronic
1107840384 13:44451233-44451255 GCTGCAACCGTGACAGAAGCGGG + Intronic
1108901194 13:55410635-55410657 GCTGCAGCAGGCAGGGAAGCAGG - Intergenic
1110389499 13:74957700-74957722 GCTGCAGTCAAGATGTTAGCTGG - Intergenic
1110517764 13:76436838-76436860 GCTGAAGGCGAAGTGGAAGCAGG + Intergenic
1112092459 13:96095690-96095712 TCCACAGCCGAGAGGGAAGCAGG + Intronic
1112467629 13:99658054-99658076 GCTGCAGCCGAGAGGGACCGCGG - Intronic
1113773623 13:112929314-112929336 GCTGCAGCCGCGCAGGAATCGGG - Intronic
1114316072 14:21511139-21511161 GCTGCAGCGGAGGCGGAAGCAGG - Exonic
1115491068 14:33958696-33958718 GATGCAGCCGACATGGAGGAAGG + Intronic
1116694249 14:48151288-48151310 GCAGCAGGTGAAATGGAAGCAGG - Intergenic
1119415480 14:74466677-74466699 TGAGCAGCCGTGATGGAAGCGGG - Intergenic
1119730418 14:76947555-76947577 GCTGCAGCAGGGAGGGCAGCGGG - Intergenic
1122235464 14:100328704-100328726 CCTGGAGCAGAGAAGGAAGCAGG - Exonic
1124364547 15:29062812-29062834 GCTGCAGCCGGGTGGGATGCCGG - Intronic
1125289235 15:38127396-38127418 GCTGCAGCCTGGATGGGAGATGG - Intergenic
1125714136 15:41809747-41809769 GCAGCTCCGGAGATGGAAGCTGG - Intronic
1125930090 15:43594056-43594078 GCTGGAGCCGGAATGGGAGCCGG - Exonic
1125930098 15:43594086-43594108 GCTGCAGCCGAAATGGGGGTCGG - Exonic
1125943258 15:43693888-43693910 GCTGGAGCCGGAATGGGAGCCGG - Exonic
1125943266 15:43693918-43693940 GCTGCAGCCGAAATGGGGGTCGG - Exonic
1128307785 15:66611445-66611467 GCTGCAGCCAAGAAAAAAGCTGG - Intronic
1128870266 15:71149811-71149833 ACTGCAGCTGAGATGGTAGCGGG + Intronic
1129082323 15:73052201-73052223 GCGGCAGCCGGGATTGGAGCGGG + Intronic
1129352069 15:74961637-74961659 GCTGCAGTCAAGATGTCAGCTGG + Intronic
1129672941 15:77617142-77617164 CCTGCAGCCTATATGCAAGCTGG - Intronic
1130646785 15:85735370-85735392 GATGCAGAAGAAATGGAAGCAGG - Intronic
1131046518 15:89319849-89319871 TCTGCAGGTTAGATGGAAGCTGG - Intronic
1131581967 15:93652164-93652186 GCTGCAGGTGAGAGGGAAGAGGG - Intergenic
1132288610 15:100683857-100683879 TCTCCATCCGAGATGGAGGCAGG + Intergenic
1132557034 16:577072-577094 GCTCCAGCCCAGAAGGAAGGAGG + Intronic
1133001203 16:2852581-2852603 GCTGAACCCTAGGTGGAAGCAGG + Intergenic
1133279694 16:4658179-4658201 GCTGCAGACCAGATGGACGCTGG - Intronic
1135112770 16:19703635-19703657 ACTGCAGCCGTGATGGAGGGTGG + Exonic
1136033334 16:27519374-27519396 TCTGCAGTGGACATGGAAGCTGG + Intronic
1137512376 16:49113001-49113023 GCTGCAGCCAGCAAGGAAGCAGG - Intergenic
1137564503 16:49524782-49524804 CCTGCTGCCCAGATGGCAGCCGG - Intronic
1138234404 16:55369534-55369556 GCTGCAGGTGATATGGCAGCTGG - Intergenic
1138639021 16:58368040-58368062 GTTGCAGCTGAGATGGACACTGG - Intronic
1139962260 16:70724784-70724806 GCTTCTGCTGAGAGGGAAGCAGG + Intronic
1141362163 16:83405972-83405994 GCTGCAGCCGAGATCCAGGTGGG - Intronic
1142560645 17:807151-807173 GCTGCAGCCCAAAGGGAATCCGG + Intronic
1143523861 17:7461672-7461694 GCTGGAGAAGGGATGGAAGCTGG + Exonic
1144777607 17:17792665-17792687 GCTGCAGGCGATGTGGGAGCGGG + Intronic
1146398057 17:32484398-32484420 GCTGCTGCAGAGTGGGAAGCAGG + Intergenic
1146803290 17:35844606-35844628 GCTACAGCGGAGATAGAAGTGGG + Exonic
1147438366 17:40431680-40431702 CATGCAGTAGAGATGGAAGCAGG + Intergenic
1147515965 17:41117896-41117918 GCTGCAGCTGGGGTGGCAGCAGG + Exonic
1148827545 17:50405015-50405037 GCTGCTTCCGAGATGGTGGCAGG + Intergenic
1149627197 17:58088261-58088283 TCTTGAGCCGAGATTGAAGCTGG + Intronic
1151402664 17:73866001-73866023 ACAGCAGCCGAGAAAGAAGCTGG - Intergenic
1151601410 17:75108479-75108501 GCTGCAGCCCCATTGGAAGCAGG - Intergenic
1151649230 17:75456091-75456113 ATTTCAGCCGAGCTGGAAGCGGG + Intronic
1151786245 17:76276425-76276447 AGTGCAGCCGGGATGGAGGCTGG + Intronic
1151820154 17:76492780-76492802 GGTGCAGCCCAGAGGGAAACAGG + Intronic
1151921008 17:77155492-77155514 GCTGGTGCCCAGATGGGAGCTGG + Intronic
1152599413 17:81254145-81254167 GCTGCAGCCGAGGGGGACTCAGG + Intronic
1153687721 18:7563141-7563163 GCTGCTGCTGACATGGAAGATGG + Intergenic
1156495409 18:37522394-37522416 GCTGGAGCTGAGATGGAAGAGGG + Intronic
1156499825 18:37550665-37550687 GCTGCAGCAGAGAGGGACCCAGG - Intronic
1159279722 18:66270138-66270160 GCTGCTTCCAAGATGGCAGCAGG + Intergenic
1160884935 19:1341417-1341439 CCTGCAGCAGGGGTGGAAGCAGG - Intergenic
1163314081 19:16530937-16530959 GCTGGAGCCGCGATGGTAACGGG - Intronic
1165351673 19:35279193-35279215 GCTGCAGCTGGGCTCGAAGCAGG - Exonic
1166549899 19:43658324-43658346 CCTGCAGTCGAGATGTCAGCTGG - Intronic
925451554 2:3973555-3973577 GCAGCAGCCAGGATGGATGCTGG - Intergenic
925741896 2:7012662-7012684 GCTGCAGCCCTGCTGGAGGCTGG + Intronic
926682420 2:15674090-15674112 GCTGCAGCCCCGCTGGGAGCAGG + Intergenic
926892406 2:17649759-17649781 GCTGCAGCGGGGACAGAAGCAGG - Intronic
927482785 2:23467740-23467762 GCTGCAGGCGGGATGGGAACAGG + Intronic
927679020 2:25127934-25127956 GCTGGAGCCCAGATGGTACCAGG + Intronic
930357555 2:50341131-50341153 TCAGCAGCAGAGATGGAGGCAGG - Intronic
937215144 2:120307982-120308004 GCTGCAGCCAAGGTGTCAGCTGG + Intergenic
942277926 2:174336249-174336271 GCTGGAGCCGAGGTTGCAGCTGG - Exonic
945058623 2:205889336-205889358 CCTGCAGCCAGGATGGAATCAGG - Intergenic
946434132 2:219640817-219640839 GATGCAGCCCAGCTGGATGCAGG - Exonic
946843247 2:223837791-223837813 GCTGCAGCCGAGGCGGGGGCGGG - Intronic
948437981 2:237966961-237966983 GCGGCAGCCGAGACAGCAGCGGG - Intronic
1168780313 20:483620-483642 GCAGCAGCCGGGATTGAGGCTGG + Exonic
1168821148 20:774611-774633 GCTGCGGCTGAGAGGGAGGCAGG + Intergenic
1169442127 20:5641356-5641378 GCTGCAGACAAGATGTCAGCTGG + Intergenic
1170963714 20:21048340-21048362 GATGCAGCCGAGCTGAATGCAGG - Intergenic
1171293441 20:23995591-23995613 GCAGCTGCCCAGAGGGAAGCAGG - Intergenic
1171450149 20:25229988-25230010 CCTGCCGCCGAGAGAGAAGCAGG + Intergenic
1173741157 20:45403407-45403429 TCTGCATCCTAGATGGAAGCCGG + Intronic
1173906279 20:46632002-46632024 GCTGCAGCCCAGCAGGGAGCTGG - Intronic
1178175273 21:30089893-30089915 GCTGTAGCCAAGCCGGAAGCTGG - Intergenic
1180219772 21:46351138-46351160 GCTGCGGCCGGCATGGAACCTGG + Intronic
1180224774 21:46385894-46385916 GCTGCAGCAGAGGCGGGAGCGGG + Exonic
1180636282 22:17265155-17265177 GCTCCAGCCGTGGAGGAAGCGGG + Intergenic
1181501280 22:23316994-23317016 GCAGCTGCCCAGAGGGAAGCAGG + Exonic
1181650872 22:24258424-24258446 GCAGCTGCCCAGAGGGAAGCAGG - Intergenic
1181706509 22:24652315-24652337 GCAGCTGCCCAGAGGGAAGCAGG + Intergenic
1183683706 22:39349999-39350021 GGTGCAGCCACGATGGAAGGGGG + Exonic
1184493858 22:44826014-44826036 GGGGCAGCAGTGATGGAAGCTGG - Intronic
1184546181 22:45170064-45170086 GCTGAAGCAGAGAAGGAAGGCGG - Intronic
1184589082 22:45469111-45469133 GCTGCAGCAGAGAAGGATCCAGG + Intergenic
1185050491 22:48551692-48551714 TCTGCAGCAGTGATGGAAGCAGG + Intronic
1185266204 22:49905612-49905634 GCGGAAGGCGAGAGGGAAGCGGG - Intronic
949140946 3:632174-632196 GCTCCTGCCGACATGGTAGCTGG + Intergenic
950426682 3:12928145-12928167 GCTGCAGCAGAGGTGGGAGGGGG + Intronic
950738929 3:15034193-15034215 GCTGGATCCGAGACTGAAGCAGG - Intronic
954664774 3:52245925-52245947 GCTGGAGCCGCGAAGGAAGCGGG - Intronic
957041799 3:75341456-75341478 GCTGCAGCAGTCAGGGAAGCTGG + Intergenic
960045196 3:113190415-113190437 GCTACAGCCAAGAAGGAAGTTGG - Intergenic
960977929 3:123194645-123194667 GCTGGGGCTGGGATGGAAGCAGG - Intronic
961521777 3:127471206-127471228 TCTCCAGCCCAGCTGGAAGCAGG + Intergenic
962316265 3:134361384-134361406 CCTGCAGCCTAGATCTAAGCAGG + Intronic
962417836 3:135200056-135200078 ACTGGAGGAGAGATGGAAGCAGG - Intronic
966807701 3:183819532-183819554 GCTGGAGCCCAGATGGGAGAGGG + Intronic
968426799 4:529065-529087 GCTGGAGTGGAGGTGGAAGCGGG + Intronic
968500207 4:946382-946404 CCTGCACCCGAGGTGGAGGCTGG - Intronic
968947108 4:3670879-3670901 GCCACAGCAGACATGGAAGCAGG - Intergenic
970158065 4:13161413-13161435 GCCACAGCCGAGAAGGCAGCTGG + Intergenic
970175306 4:13333413-13333435 CATGAAGCTGAGATGGAAGCTGG + Intergenic
970191596 4:13523703-13523725 GCTTCTGCCGAGAGGGAAGTGGG + Intergenic
974448610 4:62019985-62020007 ACTGCAGCACAGTTGGAAGCAGG - Intronic
976921777 4:90451571-90451593 GCTGGAACCCAGCTGGAAGCTGG + Intronic
977556769 4:98494992-98495014 GGTGCAGCAGAGAAGAAAGCAGG + Intronic
977882222 4:102217974-102217996 GCTGCTGCTGAAATTGAAGCTGG + Intergenic
978492867 4:109327519-109327541 GCTGCAGTCAAGATGTCAGCTGG + Intergenic
979135957 4:117113561-117113583 GCTGCTTCCAAGATGGCAGCAGG + Intergenic
981088268 4:140706061-140706083 ACTGCAGCCTAGCTGGGAGCTGG + Intronic
981136743 4:141219720-141219742 TCTGCAGGAGAAATGGAAGCAGG - Intergenic
981707218 4:147673019-147673041 GCAGCAAACAAGATGGAAGCAGG - Exonic
982361502 4:154524020-154524042 GCTGGAGCCCAGATGGAGGCTGG + Intergenic
984007570 4:174331689-174331711 GCTGGAGCTGAGGAGGAAGCTGG - Exonic
984833522 4:183998484-183998506 GCTGCAGCAGAGGTGGGAGTTGG - Intronic
985800456 5:2002403-2002425 GCTGCAGCAGCCCTGGAAGCAGG - Intergenic
988260681 5:28882785-28882807 GCACCAGCTGAGGTGGAAGCAGG - Intergenic
992515939 5:77492288-77492310 GCTGCAGCCGGGGAGGAAGGAGG - Exonic
993591004 5:89794969-89794991 GCTGCTTCCAAGATGGCAGCAGG - Intergenic
995182357 5:109240684-109240706 CCTGCAGCAGAGCTGGAAACAGG + Intergenic
995625167 5:114068609-114068631 TCTGCAGCAGAGATAGGAGCAGG - Intergenic
996128327 5:119751863-119751885 GCTGCTTCCAAGATGGCAGCGGG - Intergenic
997416651 5:133733806-133733828 GTTGCAGTCAAGATGGGAGCTGG + Intergenic
998822654 5:146070671-146070693 CCTGCAGAGGAGATGGAAGTGGG - Intronic
1002333608 5:178462851-178462873 GCTGGAGCCAAAATGGAAACTGG + Intronic
1006672016 6:35735535-35735557 GCTGCACCCAGGATGGAAGGAGG - Intergenic
1007783093 6:44265237-44265259 GCTGGAGCCGAGGTGGACTCGGG + Exonic
1013535689 6:111061227-111061249 GCTATAGCAGAGATGGGAGCAGG + Intergenic
1016828951 6:148414608-148414630 GCTGCAGCAGTGAGGGAAGTGGG + Intronic
1017881313 6:158564456-158564478 GCTGCCGCAGAGGTGGGAGCTGG - Intronic
1018107955 6:160507010-160507032 GCTGCAGCTGAAATGGCAGAGGG + Intergenic
1018123500 6:160659625-160659647 GCTGCAGCTGAAATGGCAGAGGG + Intronic
1018378023 6:163231909-163231931 GCTCCAGCTGAGAGTGAAGCCGG - Intronic
1018420027 6:163633187-163633209 GCTGCAGCCAAGGTGTCAGCTGG + Intergenic
1018776693 6:167023710-167023732 GCAGCAGAGGAGATGGAACCAGG + Intronic
1019377324 7:699752-699774 GCTGCAGTGGAGAGGCAAGCAGG + Intronic
1020121356 7:5505575-5505597 GCAGCAGCCGGGATGGCAGACGG - Exonic
1021554559 7:21906008-21906030 CCTGCAGCAGAGATTAAAGCAGG + Intronic
1021626918 7:22602712-22602734 GCTGCTGCTGAGGTGGAAGGTGG + Intronic
1022091946 7:27113739-27113761 GCATCAGCCGAGATGGCAGGCGG + Intronic
1022573853 7:31479074-31479096 GCTGGAGCCGAGCTGGAATAAGG - Intergenic
1023623568 7:42095663-42095685 GCAGCAACAGAGAAGGAAGCAGG + Intronic
1025284546 7:57651324-57651346 GCTGCAGCCGCGATGGTGGCTGG + Intergenic
1027662058 7:80998933-80998955 GCTGCAGCCTAGATGAAATGAGG + Intergenic
1029886445 7:103877714-103877736 GCTGGAGAAGAGATGGAAGATGG - Intronic
1032187353 7:129738329-129738351 GCTCCAGCTGAGCTGGGAGCCGG + Intronic
1033537839 7:142328446-142328468 GCTGCAGCCACAATGGAAACAGG - Intergenic
1034452425 7:151144116-151144138 GCTGCAGCAGAGAGGGATGAGGG + Exonic
1035167056 7:156997611-156997633 GCTGCAGAAGAGCTGGAAGCTGG - Intronic
1035428282 7:158797018-158797040 ACTGCAGGCGAGAGGGCAGCAGG + Intronic
1035596195 8:859837-859859 CAGGCAGCCGAGATGGAAGACGG + Intergenic
1035607055 8:936635-936657 GCTGGAGCCTAGTTGGAAGCTGG + Intergenic
1036682628 8:10886562-10886584 TCTGCAGGCGAGTTGGAGGCTGG - Intergenic
1037814272 8:22103587-22103609 GCTGCAGCCAGGAGGGGAGCGGG + Exonic
1039803710 8:40981438-40981460 CCTGCAGCAGAGCTGAAAGCTGG - Intergenic
1041465131 8:58150876-58150898 GCTGCAGACAAGATGGCGGCTGG + Intronic
1045293272 8:100851703-100851725 GCTGCAGCAGACATGGATGAGGG + Intergenic
1047009686 8:120658284-120658306 GCTGAAGAGGAGATAGAAGCTGG + Intronic
1047435483 8:124832343-124832365 GTTGCAGCCAAGATGTCAGCTGG + Intergenic
1047540357 8:125759305-125759327 GCTGCACCATAGATGGAAGTGGG - Intergenic
1048968233 8:139629243-139629265 GCTGGGGCCGAGATGCATGCGGG + Intronic
1051694209 9:19750959-19750981 TCTTCAGTCGAGAAGGAAGCCGG - Intronic
1053123545 9:35562528-35562550 GCTGGAGCCGAAGAGGAAGCGGG + Exonic
1053184009 9:35999603-35999625 GATGCAGACAAGAAGGAAGCTGG - Intergenic
1054160642 9:61670326-61670348 GCTGCAGCCACGGTGGCAGCTGG + Intergenic
1056271709 9:84953949-84953971 GCTGGAGCCGGGATGGAAGTGGG + Intronic
1056777595 9:89525092-89525114 GCTGCAGCCGAGACTGAGGCCGG - Intergenic
1057948529 9:99351285-99351307 GTAGGAGCCTAGATGGAAGCTGG - Intergenic
1060506111 9:124199478-124199500 TTTGTAGCCGAGATGGAAGCTGG - Intergenic
1060590122 9:124811209-124811231 GCAGCAGCTGAGAAGGCAGCCGG + Exonic
1061775033 9:132956826-132956848 GCTGCAGTCTAGATGTCAGCTGG + Intronic
1061892699 9:133631112-133631134 GCAGCCCCCGAGATGGATGCGGG + Intergenic
1062253269 9:135608812-135608834 GCTGCAGCAGCGATGGGGGCCGG - Intergenic
1062428060 9:136515143-136515165 TCTGCAGCAGAGATTGCAGCGGG - Intronic
1062491292 9:136806295-136806317 GCTGCAGCCAGGCTGGGAGCTGG + Intronic
1187225463 X:17372193-17372215 GCTCCAGCCCAGAAGGAAGAAGG - Intergenic
1187956436 X:24523453-24523475 GCTGCAGCAGAGGTGGCAACTGG + Intronic
1189821387 X:44873002-44873024 GCCGCCACCGAGATGGGAGCGGG - Intergenic
1191937946 X:66445104-66445126 GCAGCAGCCAACATTGAAGCTGG - Intergenic
1197335318 X:125204457-125204479 GCCGCAGCTGAGATGGGAGGTGG + Intergenic
1197416285 X:126177372-126177394 GCTGCAACCAAGATGTCAGCTGG - Intergenic
1198312048 X:135433662-135433684 GCTGCAGCTGGGAGGGGAGCTGG + Intergenic
1198767073 X:140091277-140091299 GCTGCAGCCGCGGCGCAAGCGGG + Intergenic
1200118315 X:153778846-153778868 GCTCCTGCGGTGATGGAAGCAGG + Intronic
1200133103 X:153862165-153862187 GCTCCAACCGGGATGGGAGCCGG - Exonic