ID: 1077475852

View in Genome Browser
Species Human (GRCh38)
Location 11:2790131-2790153
Sequence CTGTCTCTGTGGCAGGTTGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 345
Summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 324}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077475852_1077475864 12 Left 1077475852 11:2790131-2790153 CCCTCAACCTGCCACAGAGACAG 0: 1
1: 0
2: 1
3: 19
4: 324
Right 1077475864 11:2790166-2790188 GCCACTGGGTGATGGGACCGTGG 0: 1
1: 0
2: 2
3: 13
4: 164
1077475852_1077475863 5 Left 1077475852 11:2790131-2790153 CCCTCAACCTGCCACAGAGACAG 0: 1
1: 0
2: 1
3: 19
4: 324
Right 1077475863 11:2790159-2790181 ACTAACTGCCACTGGGTGATGGG 0: 1
1: 0
2: 0
3: 11
4: 108
1077475852_1077475862 4 Left 1077475852 11:2790131-2790153 CCCTCAACCTGCCACAGAGACAG 0: 1
1: 0
2: 1
3: 19
4: 324
Right 1077475862 11:2790158-2790180 CACTAACTGCCACTGGGTGATGG 0: 1
1: 0
2: 3
3: 8
4: 124
1077475852_1077475856 -3 Left 1077475852 11:2790131-2790153 CCCTCAACCTGCCACAGAGACAG 0: 1
1: 0
2: 1
3: 19
4: 324
Right 1077475856 11:2790151-2790173 CAGCCCCCACTAACTGCCACTGG 0: 1
1: 0
2: 1
3: 16
4: 161
1077475852_1077475857 -2 Left 1077475852 11:2790131-2790153 CCCTCAACCTGCCACAGAGACAG 0: 1
1: 0
2: 1
3: 19
4: 324
Right 1077475857 11:2790152-2790174 AGCCCCCACTAACTGCCACTGGG 0: 1
1: 0
2: 0
3: 16
4: 126

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077475852 Original CRISPR CTGTCTCTGTGGCAGGTTGA GGG (reversed) Intronic
900183200 1:1321392-1321414 TTGTCTCTGTTGGAGGCTGAGGG - Intronic
902257661 1:15200497-15200519 CTCTCTCTGTGGCCTGTAGATGG - Intronic
905626393 1:39492557-39492579 GTGTGTCTGGGGCAGGGTGAAGG - Intronic
905794637 1:40808648-40808670 CTGTCCCTGTGGAAGCTGGAGGG + Intronic
906344390 1:45006109-45006131 CTGTCTCTGGGGCAGGGCAATGG - Exonic
907515655 1:54991769-54991791 CTGTCTCTCTGGCAGGCAGCAGG + Intronic
907576940 1:55535018-55535040 CTGTCTCCATGGCAGGTTTAAGG - Intergenic
907865426 1:58395326-58395348 TTGTCTCTGTGGCAGAGAGAGGG - Intronic
908213662 1:61928697-61928719 CTCACTATGTGGCAGGTTAAAGG - Intronic
910446453 1:87303172-87303194 CAGGCTCAGTGGCAGGTTGTGGG - Intergenic
912242097 1:107921973-107921995 ATGTTTGTGAGGCAGGTTGAAGG - Intronic
912809227 1:112781289-112781311 TTGTCTCTATGGAAAGTTGATGG + Intergenic
912971518 1:114288283-114288305 CTGTCCCTGGGGCTGGTTCAAGG - Intergenic
913581000 1:120226637-120226659 GCTTCTCTGAGGCAGGTTGAGGG + Intergenic
913627178 1:120671763-120671785 GCTTCTCTGAGGCAGGTTGAGGG - Intergenic
914562930 1:148838074-148838096 GCTTCTCTGAGGCAGGTTGAGGG + Intronic
914609897 1:149292148-149292170 GCTTCTCTGAGGCAGGTTGAGGG - Intergenic
915645665 1:157270198-157270220 CTGGCTCAGTGGCAGGCTCACGG - Intergenic
916663729 1:166947272-166947294 TTGTATCTGTGGCAGTCTGATGG - Intronic
916754210 1:167753232-167753254 CTGGCTGCGTGGCATGTTGAAGG + Intronic
917521128 1:175749294-175749316 CTGTCTCTGTGGCAGGCAGCTGG - Intergenic
920082506 1:203385598-203385620 CTGCCCCTGTGCCATGTTGATGG + Intergenic
921577648 1:216855617-216855639 CTGAGTCTGTGGCACGTGGAAGG + Intronic
921765276 1:218965072-218965094 CTCTCTCTGTTCCAAGTTGAGGG - Intergenic
922116580 1:222618742-222618764 TTTTCCCAGTGGCAGGTTGATGG + Intronic
923098718 1:230795505-230795527 GTGCCTCTGTGGGAGGATGATGG + Intronic
923639553 1:235740425-235740447 TTGTCTCTGTGGAAGGGGGACGG - Intronic
924452090 1:244187509-244187531 ATGTCCCTGTGCCAGGGTGAGGG - Intergenic
924766768 1:247039761-247039783 CTGTCTCATTGGCAGGTGCAGGG + Intronic
1063064554 10:2595044-2595066 CTGTGTCTGAGGCTGGTTGTGGG - Intergenic
1064255061 10:13736434-13736456 CTGGCTCTTTGGCGGGTGGAGGG - Intronic
1064270589 10:13861748-13861770 CTTACTCTGTGCAAGGTTGATGG - Intronic
1064535224 10:16351235-16351257 CTGTCTCGGTGGCAGGTGGAGGG - Intergenic
1065886072 10:30078371-30078393 CTCTCTCTGGGGCAGGATGAAGG + Intronic
1066491959 10:35902484-35902506 CTGTGTCTGGGGAAGTTTGATGG + Intergenic
1069881712 10:71597477-71597499 CTGTACCTGTGGCAGCTTCAGGG - Intronic
1072419014 10:95273699-95273721 CTGTCCCAGTGGCTGGATGAGGG - Intronic
1072705512 10:97677973-97677995 CTGTCTCTGTGGCACTCTGTGGG + Exonic
1073033381 10:100546229-100546251 CTGTCTCTAGGACAGGATGACGG + Intronic
1076093692 10:127712990-127713012 CTGTCGCAGTGGCAGGTGCATGG - Intergenic
1077475852 11:2790131-2790153 CTGTCTCTGTGGCAGGTTGAGGG - Intronic
1077529663 11:3089299-3089321 CTGACTCTGAGCCAGGCTGAGGG - Intronic
1080018444 11:27532635-27532657 CTAACTCTGTGTAAGGTTGAGGG - Intergenic
1080896043 11:36449490-36449512 CTCTCACTGGGGCAGTTTGAAGG - Intronic
1080986642 11:37474975-37474997 CTGTCTCTATGACAGCCTGAAGG - Intergenic
1081303092 11:41477729-41477751 TTGTCTCAATGGCAGTTTGAGGG - Intergenic
1081764922 11:45603935-45603957 CAGTCTCTGTAGCAGATTGGTGG - Intergenic
1082963092 11:58937901-58937923 GAGTGTCTGTGGGAGGTTGATGG - Intronic
1085044748 11:73346389-73346411 CTTCCTCTGTAGCAGGGTGATGG + Intronic
1086902874 11:92387399-92387421 CTGTGTGTGTTGCAGGGTGAAGG + Intronic
1087428205 11:98016965-98016987 CTGTGTCAGTGGTAGCTTGATGG - Intergenic
1088826091 11:113495857-113495879 CTGGCTCTGTGGGAGGTTAGTGG + Intergenic
1089892602 11:121896443-121896465 CTGTTTCTGTGGAAGCTTGTAGG + Intergenic
1090515839 11:127425649-127425671 CTGTTTCAGTGGAGGGTTGAGGG + Intergenic
1091623193 12:2105436-2105458 CTGTGTCTGTAGCAGGATGGGGG + Intronic
1092467100 12:8742822-8742844 ATGTCTCTGTGAAAGGTTGGTGG - Intronic
1094320631 12:29178987-29179009 CTCTCTCTTTGGCTGGTAGATGG + Intronic
1094447753 12:30550180-30550202 CTGTCTCAGTGGCAGGAGGCAGG - Intergenic
1098487535 12:71039318-71039340 CTGTCTCTGTGGCATCTTTGAGG - Intergenic
1098981715 12:76963218-76963240 CTCTCTCTGGGGCTGGTGGAAGG + Intergenic
1099946749 12:89253899-89253921 GTGTCTCTGTGGAAGATTGATGG - Intergenic
1100929165 12:99585905-99585927 CTGTCTCTGGGCCTGGATGAGGG + Intronic
1101796358 12:107978249-107978271 CTGGCTCTGTGCAAAGTTGAGGG - Intergenic
1101966948 12:109288057-109288079 CTGTCTCTGTGGCCAGTTATGGG + Exonic
1102259402 12:111435212-111435234 CTGGCTTTGTGGCAGGGGGATGG + Intronic
1103470290 12:121174937-121174959 CTGGCTCTGTGACAGGTGGCAGG - Intronic
1106138163 13:26990048-26990070 CTCGCTCTGTGGCAGGCTGCTGG + Intergenic
1108375343 13:49808957-49808979 ATTTCTGTGTGGAAGGTTGAAGG + Intergenic
1108701260 13:52946231-52946253 CTGTTTTTGTGGCAAGATGAGGG + Intergenic
1109330117 13:60918730-60918752 CTGCCTCTGTGGCAGGTCTCTGG + Intergenic
1111794554 13:92901467-92901489 CTGTGTTTGTGGCGGGTTGGGGG - Intergenic
1111928232 13:94485523-94485545 CTGTGTTTGTGCAAGGTTGATGG - Intergenic
1113389314 13:109880515-109880537 CCGGCTGTGTGGCATGTTGATGG - Intergenic
1113920197 13:113903479-113903501 CTGCCTCTCTGGCAGGAGGACGG + Intergenic
1114530802 14:23394688-23394710 CTGTTTCAGTGGTAGGTTCATGG - Intronic
1117240349 14:53825974-53825996 CTGTCTCTGGGGCAGGGAGAGGG + Intergenic
1117501434 14:56356648-56356670 CTGTGTCTGTGGCAGCCTCATGG - Intergenic
1118333429 14:64832023-64832045 CCTTCTCTGTGGTTGGTTGATGG - Intronic
1118380676 14:65215053-65215075 CTGCCTCTGTGCCAAGTGGAAGG + Intergenic
1119572191 14:75684817-75684839 GTGTCTGTGTGGCAGTCTGAGGG + Intronic
1120060210 14:79973800-79973822 ATGTCTTTGTGGCAGGGTTATGG + Intergenic
1120316334 14:82898270-82898292 CTGACTCAGTGCCAAGTTGATGG - Intergenic
1120889849 14:89482249-89482271 CTGTCTCTCTGGCAGGAGGCCGG - Intronic
1121494507 14:94382839-94382861 CTGGCTGTCTGGCTGGTTGAGGG + Exonic
1122028071 14:98892152-98892174 CTGTCTCCCTGGCTGGTAGAGGG - Intergenic
1202908805 14_GL000194v1_random:97951-97973 CTGTCTCTGTAGTAGTTGGATGG - Intergenic
1202884460 14_KI270722v1_random:91366-91388 CTGTCTCTGTAGAAGTTGGATGG + Intergenic
1123469305 15:20538408-20538430 CTGTCAAAGTGCCAGGTTGAAGG + Intronic
1123648758 15:22462290-22462312 CTGTCAAAGTGCCAGGTTGAAGG - Intronic
1123666589 15:22613333-22613355 CTGTCAAAGTGCCAGGTTGAAGG + Intergenic
1123729579 15:23133395-23133417 CTGTCAAAGTGCCAGGTTGAAGG + Intronic
1123747746 15:23330877-23330899 CTGTCAAAGTGCCAGGTTGAAGG + Intergenic
1123751116 15:23359029-23359051 CTGTCAAAGTGCCAGGTTGAAGG - Intronic
1123763345 15:23449738-23449760 CTGTCCCTGTTGCAGATGGAAGG - Intergenic
1123857132 15:24425254-24425276 CTGTCTCTGTGGTATCTTCATGG + Intergenic
1123978303 15:25573924-25573946 CTGTTTCTATGACAGGTTCATGG - Intergenic
1124280114 15:28354728-28354750 CTGTCAAAGTGCCAGGTTGAAGG + Intergenic
1124283491 15:28382947-28382969 CTGTCAAAGTGCCAGGTTGAAGG - Intronic
1124299207 15:28528666-28528688 CTGTCAAAGTGCCAGGTTGAAGG + Intronic
1124302586 15:28556883-28556905 CTGTCAAAGTGCCAGGTTGAAGG - Intergenic
1124320432 15:28707906-28707928 CTGTCAAAGTGCCAGGTTGAAGG + Intronic
1124482082 15:30087504-30087526 CTGTCAAAGTGCCAGGTTGAAGG - Intronic
1124488540 15:30139604-30139626 CTGTCAAAGTGCCAGGTTGAAGG - Intronic
1124521508 15:30409699-30409721 CTGTCAAAGTGCCAGGTTGAAGG + Intronic
1124537153 15:30556520-30556542 CTGTCAAAGTGCCAGGTTGAAGG - Intronic
1124543627 15:30608576-30608598 CTGTCAAAGTGCCAGGTTGAAGG - Intronic
1124754988 15:32398718-32398740 CTGTCAAAGTGCCAGGTTGAAGG + Intronic
1124761496 15:32451071-32451093 CTGTCAAAGTGCCAGGTTGAAGG + Intronic
1124777135 15:32597997-32598019 CTGTCAAAGTGCCAGGTTGAAGG - Intronic
1124959701 15:34385207-34385229 CTGTCAAAGTGCCAGGTTGAAGG + Intronic
1124976327 15:34531428-34531450 CTGTCAAAGTGCCAGGTTGAAGG + Intronic
1125768577 15:42150697-42150719 CTGGCTCTGTGGGAGGCTGCAGG + Exonic
1125991288 15:44111221-44111243 CTGTCCCTGTTGCAGATGGAAGG - Intronic
1128910120 15:71506422-71506444 CTGTCTCTGTGCCATGCTGATGG - Intronic
1129029641 15:72609017-72609039 CTGTCAAAGTGCCAGGTTGAAGG - Intergenic
1129037580 15:72660051-72660073 CTGTCAAAGTGCCAGGTTGAAGG - Intronic
1129212307 15:74077174-74077196 CTGTCAAAGTGCCAGGTTGAAGG + Intronic
1129398090 15:75263905-75263927 CTGTCAAAGTGCCAGGTTGAAGG - Intronic
1129401701 15:75288186-75288208 CTGTCAAAGTGCCAGGTTGAAGG - Intronic
1129475293 15:75780893-75780915 CTGTCAAAGTGACAGGTTGAAGG - Intergenic
1129729436 15:77921492-77921514 CTGTCAAAGTGCCAGGTTGAAGG + Intergenic
1129839081 15:78732478-78732500 CTGTCAAAGTGCCAGGTTGAAGG - Intergenic
1132248264 15:100314772-100314794 CTGTCTTTGTGGCTGGCTGCAGG - Intronic
1132731795 16:1366498-1366520 CTGTCTCTGTAGCTGGTGGCCGG - Intronic
1133251107 16:4481864-4481886 CTATCTCTGTGGCAGTCTGGAGG + Intronic
1134071137 16:11260456-11260478 GTGTCTCAGTGGCGGGTAGAGGG + Intronic
1135248726 16:20881718-20881740 CTGTCTCTGTCACAGGCTAAGGG - Intronic
1135707731 16:24689223-24689245 GTGTCTATGTTGCAGCTTGATGG - Intergenic
1136482049 16:30548171-30548193 CTGGGTCTTTGGCAGGTTCAGGG + Intronic
1137488758 16:48913391-48913413 CTGTCTGTGTTGCAGTGTGAGGG - Intergenic
1138498696 16:57425090-57425112 CTGTCCTTGTGGCAGGGAGAAGG - Intergenic
1139207818 16:65046220-65046242 CTGTCTATATGGCTGGTTGTCGG + Intronic
1139778398 16:69330998-69331020 CTCTCTCTTTGGCAGGATAAAGG + Exonic
1139876120 16:70147463-70147485 CTGTGTCTGTGGCATCTTCAGGG + Intronic
1140193208 16:72835686-72835708 GTGTCTCTGTGGTGGGTGGAAGG + Intronic
1140359670 16:74333635-74333657 CTGTGTCTGTGGCATCTTCAGGG - Intergenic
1140895198 16:79318466-79318488 CTGGCTCTGGGGCAGGTTTGTGG - Intergenic
1141555596 16:84834764-84834786 CTCTCTCTGTGGCTGGCAGACGG + Intronic
1141695244 16:85616004-85616026 CTGTCTCTGGGGGAAGTTCAGGG + Intronic
1143366703 17:6413461-6413483 ATGTCTCTGTGGCAGGTGTAAGG - Intronic
1144235722 17:13258413-13258435 CTGGGTCTGTGGGAGGCTGAGGG + Intergenic
1144295818 17:13873975-13873997 CTGTCTCTGTGGCTTGCAGATGG - Intergenic
1144398242 17:14867102-14867124 CTGTATCTGTAGCAGGAAGAGGG + Intergenic
1145841395 17:27998118-27998140 CTCCCTCTGTGACAGGTTTATGG - Intergenic
1145908248 17:28528061-28528083 CTGTCTCAGTGCCAGGCTGCAGG - Intronic
1146478311 17:33180908-33180930 TGGTCTCTGTGGCAGGCAGAAGG + Intronic
1148752009 17:49950746-49950768 CTGCCTCTCTGACAGGCTGAAGG + Intergenic
1151901351 17:77017530-77017552 CTACCTCTGTGGCAGGGAGAGGG + Intergenic
1153575981 18:6522406-6522428 ATGTCTCTGTGGCAGAAGGAGGG + Intronic
1154162821 18:11992520-11992542 ATGTCTCTGAAGCTGGTTGATGG + Intronic
1158191249 18:54831330-54831352 CTCCCTCTGTGCCAGGTTCATGG - Intronic
1159024582 18:63171213-63171235 CAGTCCCTGTGCCAGGTTAATGG + Intronic
1159528562 18:69626717-69626739 CAGTCTCTGTGAGAGGGTGAGGG - Intronic
1159828515 18:73244232-73244254 CTGTCTCTGTTGCAGGGGGAAGG - Intronic
1159926248 18:74271892-74271914 ATGACTCTGTGGCAGGTTTTAGG + Intronic
1161482880 19:4519529-4519551 CTGTCTCAGGGGCAGGTAGGAGG - Intergenic
1163642584 19:18469955-18469977 CAGGCTCTGTGGCAGGCTGCCGG + Intronic
1163663102 19:18590009-18590031 CTGTATCTACGGGAGGTTGAGGG - Intronic
1164249211 19:23462273-23462295 CTCTCTCATTGGCAAGTTGAAGG - Intergenic
1165106824 19:33475227-33475249 CTCTCTCTGTGGGAGGGTTATGG - Intronic
1165950181 19:39469944-39469966 CTGTTTCTGGGGCAGTCTGAGGG + Intronic
1166091114 19:40509771-40509793 CTGTCTGGCTTGCAGGTTGATGG + Intronic
1166706750 19:44912332-44912354 ATGTCTCTGTGGATGGTTGCTGG - Intergenic
1167445517 19:49534958-49534980 CTGTGTGTGTGGCAGGGTGTGGG - Intronic
1202633613 1_KI270706v1_random:22741-22763 CTGTCTCTGTAGAAGTTGGATGG + Intergenic
1202652273 1_KI270707v1_random:17318-17340 CTGTCTCTGTAGAAGTTGGATGG - Intergenic
1202659868 1_KI270708v1_random:58412-58434 CTGTCTCTGTAGAAGTTGGATGG + Intergenic
925261252 2:2530431-2530453 CTGTGTCTGTGCCAGGCTGGAGG - Intergenic
926204721 2:10828014-10828036 CTGTGTGTGTGGCAGGGGGAGGG - Intronic
928257998 2:29741762-29741784 AAGTCTCTGGGGCAAGTTGAAGG + Intronic
928337862 2:30413511-30413533 TTGTCTGTCTGGCAGGTGGATGG + Intergenic
931694790 2:64863671-64863693 CCGTGTGTGTGGTAGGTTGATGG - Intergenic
933912656 2:86956949-86956971 CTGTGTCAGTGGCAAGTGGATGG + Intronic
934010338 2:87812941-87812963 CTGTGTCAGTGGCAAGTGGATGG - Intronic
935693962 2:105754617-105754639 GTGTGTCTGTGGGAGGTTGGGGG + Intronic
935773905 2:106453661-106453683 CTGTGTCAGTGGCAAGTGGATGG - Intronic
935815934 2:106845715-106845737 GTGGCTCTATGGCAGGTTAAAGG + Intronic
935906158 2:107842252-107842274 CTGTGTCAGTGGCAAGTGGATGG + Intronic
935950343 2:108323169-108323191 CTCTCTCTTTGGCAGGTATATGG + Intergenic
935992627 2:108734775-108734797 CTGTGTCAGTGGCAAGTGGATGG + Intronic
936127946 2:109807417-109807439 CTGTGTCAGTGGCAAGTGGATGG + Intronic
936216751 2:110564068-110564090 CTGTGTCAGTGGCAAGTGGATGG - Intronic
936300148 2:111298763-111298785 CAGTCTCTGTGGCAGGGGAAAGG - Intergenic
936425890 2:112418649-112418671 CTGTGTCAGTGGCAAGTGGATGG - Intronic
937911158 2:127076178-127076200 CTGGCTGTGTGGCAGGCTCAAGG - Intronic
938211320 2:129467601-129467623 CTGTCTCTGAGGCAGCATGCTGG + Intergenic
939801671 2:146719083-146719105 CTCTCTCTGTGGCTTGTAGATGG + Intergenic
940740807 2:157505445-157505467 CAGTGTCTGGGGCAGCTTGAAGG + Intergenic
942055944 2:172182158-172182180 CTGTTTCTGTGGCATGTTTCAGG - Intergenic
942575904 2:177363322-177363344 CTGCCTCTGTGATAGGTGGAAGG - Intronic
943220327 2:185095380-185095402 CAGGCTCTGTGCCAAGTTGAGGG - Intergenic
944635541 2:201672889-201672911 GTGTGTCTCTGCCAGGTTGATGG - Intronic
946703107 2:222432160-222432182 CTGTCTCTGTGCAGGATTGATGG + Intronic
946921199 2:224584429-224584451 CTGCGTCGGGGGCAGGTTGATGG + Intronic
947954730 2:234178856-234178878 CTGCCTCTGTGCCAGGCTGCAGG + Intergenic
948166321 2:235865487-235865509 CTGTCGTTGTGCCAGGTTGCAGG - Intronic
1169845834 20:9990369-9990391 CTGGCTTTGTGGAAGGCTGAGGG + Intronic
1170328940 20:15187060-15187082 CTGGCTCTTTGGCAGTTTGGTGG - Intronic
1170693595 20:18637278-18637300 CTGCCTGTGTGGCAGGGGGAAGG - Intronic
1171226135 20:23443587-23443609 CTGGCTCTGTTGCATTTTGAAGG + Intronic
1172151970 20:32796991-32797013 CTGCCTCTGGGGCAGGATGGGGG + Intronic
1173083105 20:39888514-39888536 CTGCCTAGGTGGCAGGCTGAAGG + Intergenic
1173363969 20:42368622-42368644 CTCTCTCCTTGGCATGTTGAAGG + Intronic
1174255787 20:49253903-49253925 CTGTCGCTGATGCAGGTTCAGGG - Intronic
1174524044 20:51157114-51157136 CAGTCTCTGTGGCTGGGAGATGG + Intergenic
1174682309 20:52420458-52420480 CTGTCTCAGTGACTGGTTCAGGG + Intergenic
1175305921 20:57975545-57975567 CTGGCTCTGAGGCTGGTAGATGG - Intergenic
1175363959 20:58438129-58438151 CTGTCACTGTGGCAGTGTGTGGG - Intronic
1175921963 20:62454373-62454395 CTTGCTCTGGGGCAGGCTGAAGG + Intergenic
1176599878 21:8782337-8782359 CTGTCTCTGTAGAAGTTGGATGG + Intergenic
1176628166 21:9112614-9112636 CTGTCTCTGTAGTAGTTGGATGG - Intergenic
1176645827 21:9348598-9348620 CTGTCTCTGTAGAAGTTGGATGG + Intergenic
1178231000 21:30784443-30784465 TTGTTTCTGTGGAGGGTTGAGGG + Intergenic
1179221045 21:39407884-39407906 CTCTCTCTGTTGCAGTTTGGTGG - Intronic
1180056350 21:45361145-45361167 GTGTCCCTGGGGCAGGGTGAGGG + Intergenic
1180327343 22:11441974-11441996 CTGTCTCTGTAGAAGTTGGATGG + Intergenic
1180367101 22:11950555-11950577 CTGTCTCTGTAGAAGTTGGATGG - Intergenic
1180992123 22:19942924-19942946 CAGTCTCTGTGGGAGGTTGGGGG - Intronic
1181540034 22:23568059-23568081 CTGTCATTCTGGCAGGTGGAGGG - Intergenic
1183064067 22:35351647-35351669 CTGTCTGTGGGGCAGGGTGGTGG - Intergenic
1184098088 22:42327393-42327415 CTATCTCATTGGCAGGTTGGGGG - Intronic
1184580716 22:45414954-45414976 CTGTCTCTGAGTCAGCTTGAGGG - Intronic
1184733098 22:46381711-46381733 CTGTCTCTGGGCCAGGGTCACGG + Intronic
949890868 3:8733035-8733057 CTGTCACTAGGGCAGGGTGAAGG + Intronic
950486962 3:13279640-13279662 CTGTCTGTGTGGCGGGCTGGGGG + Intergenic
951085978 3:18513283-18513305 CTCCCTCTGTGGAAGGTTGCAGG - Intergenic
953025822 3:39144341-39144363 CAGTCGCTGTGGCAGGTGGCCGG - Exonic
953662654 3:44902184-44902206 CAGTCTCTGAGGGAGGCTGAAGG - Intronic
956449540 3:69359718-69359740 CTGTCTGTTTCACAGGTTGAAGG + Intronic
958646159 3:96876999-96877021 GTGTCTCTGGGTCAGGTAGATGG + Intronic
961808616 3:129507527-129507549 CAGTGTCTGTGCCAGGGTGAGGG - Intronic
963024922 3:140910201-140910223 CTTTCTCTTTGGCTTGTTGATGG - Intergenic
963500733 3:146122206-146122228 CTTCCTATGTGGCAGGTTGAGGG + Intronic
965672321 3:171159291-171159313 CTGTCTTGGTGGCTGGGTGACGG + Intronic
966630709 3:182071246-182071268 CCGTCTCTGTGGCTTGTAGATGG + Intergenic
966878678 3:184337658-184337680 ATGTTTCTGTGGCAGCGTGAAGG + Exonic
967474490 3:189900775-189900797 CTGTCTATGTGCCAGGTGGGTGG + Intergenic
1202741058 3_GL000221v1_random:56465-56487 CTGTCTCTGTAGAAGTTGGATGG - Intergenic
969466893 4:7362643-7362665 CTTTGCCTGTGGCAGGGTGAGGG + Intronic
969859540 4:10024681-10024703 CTGTCCCTGAGCCAGGCTGAAGG - Intronic
971290964 4:25339042-25339064 CTCTCTCTGTGGCATGCAGATGG + Intronic
971812472 4:31444516-31444538 CTGGCTCTCTGGCAGGGTGAGGG + Intergenic
975590061 4:75990791-75990813 CTGTAACTGCGGCAGGTTGCTGG + Exonic
977566915 4:98589850-98589872 ATGTCTCTGTGGAAGGTGGTGGG + Intronic
979674940 4:123399433-123399455 CTCTCTCTGTGGTAGGAGGAGGG - Intronic
979718442 4:123869821-123869843 CTGACTCTGTGGCTGATTAATGG - Intergenic
980410417 4:132410471-132410493 CTGTATCTGTGGCCAGTAGAGGG + Intergenic
982397790 4:154930779-154930801 CTGTATCTGAAGCAGGTTGAAGG + Intergenic
984847908 4:184123237-184123259 CTGTATCTGAGGCAGTTTTAGGG + Intronic
985565980 5:617572-617594 CTGTCCCGGTGGCAGGGTGTGGG + Intronic
986090988 5:4506235-4506257 CTTTCTCTGTGGCAGAATAAGGG + Intergenic
986244790 5:5997588-5997610 GTGTGCCTGTGGCAGGGTGATGG + Intergenic
987068144 5:14309371-14309393 GTGTCCCTGTGCCAGGTTAAGGG - Intronic
987089871 5:14500977-14500999 CTGTCTCTGGGTCTGGTTGGTGG + Intronic
989057503 5:37379331-37379353 CTGTCCCTGTGGCTGGTTCTGGG + Exonic
990199006 5:53350044-53350066 GGCTCTTTGTGGCAGGTTGATGG - Intergenic
990408474 5:55516140-55516162 CTGTCTTGGTGACATGTTGAAGG - Intronic
990614677 5:57495406-57495428 TTGTCTCTGTGGCACCTTCAGGG - Intergenic
992615573 5:78543265-78543287 CTGTCTCTGTTGCAGAGAGAGGG - Intronic
992744063 5:79801962-79801984 CTGACTCTGTGGCAAGGGGACGG + Intergenic
997529454 5:134572934-134572956 CTGTCACTGTGGCAGAGTGAAGG + Intronic
997581184 5:135018461-135018483 GTGTCCCTGTGGTAGGTGGAAGG + Intergenic
997975801 5:138440612-138440634 CTGGCTCTGAGGGAGGTGGAGGG + Intronic
998011049 5:138695948-138695970 ATGTCTGTTTGGCAGGGTGAGGG - Intronic
998159587 5:139805935-139805957 CTCTCCCTGTGGCAGCTGGAGGG - Intronic
998643206 5:144035352-144035374 CTTTCTCTTTGGCTGGTAGATGG - Intergenic
1001670490 5:173469452-173469474 CTGTCTCTGTGGATGGAAGAGGG - Intergenic
1002105702 5:176878577-176878599 CTGTGGGTGTGGCAGGTGGAGGG + Exonic
1003257467 6:4487130-4487152 CTGTGATTTTGGCAGGTTGAAGG - Intergenic
1004616412 6:17294677-17294699 CTGGCTCTGTGGCAAGTAGTTGG - Intergenic
1005195143 6:23273901-23273923 CTGTCACTCTGTAAGGTTGATGG - Intergenic
1006678154 6:35778343-35778365 ATGTCACTGTGGCAGGGAGATGG - Intronic
1007181455 6:39932106-39932128 TTGTTTGTGTGGCAGGATGAGGG - Intronic
1007353356 6:41291793-41291815 CTGTCTCTGGGTCAGGGTCAGGG - Intergenic
1007382827 6:41501889-41501911 CTGTCTCCCTGGCAAGTTGGAGG + Intergenic
1008509710 6:52264779-52264801 TTCTGTCTGGGGCAGGTTGAAGG - Exonic
1008905381 6:56672139-56672161 CTGGCTCTGTGGCAGCTGGGAGG - Intronic
1010620446 6:78067684-78067706 CTCTCTGTGCAGCAGGTTGAGGG - Intergenic
1011259185 6:85453843-85453865 TTGTCTATGTGGGAGGTGGAGGG - Intronic
1012521981 6:100132392-100132414 GTGTTTCTGTGGCAGGATGAGGG + Intergenic
1013296785 6:108764717-108764739 CTGTCTCTGGGAAAGGTTGTTGG + Intergenic
1013339500 6:109199564-109199586 CTGTTTCTGTTGCATGTTGGGGG - Intergenic
1013371670 6:109476398-109476420 ATGTTTCTGTGGTAGATTGAAGG - Intronic
1014899580 6:126946469-126946491 CTGTCTTTCTGGCAGCCTGAGGG - Intergenic
1017916919 6:158838182-158838204 CTGTCTCTGTGGAAATGTGACGG + Intergenic
1022536697 7:31102800-31102822 CTGTCTCTGTGGCCCATCGAGGG + Intronic
1025635311 7:63315877-63315899 CTGTCACTGGACCAGGTTGAAGG - Intergenic
1025647384 7:63432293-63432315 CTGTCACTGGACCAGGTTGAAGG + Intergenic
1026056378 7:66987627-66987649 CTGTGTCTGTGGTAGGGTTAGGG - Intergenic
1026721714 7:72837427-72837449 CTGTGTCTGTGGTAGGGTTAGGG + Intergenic
1026902182 7:74043393-74043415 CGGGCTCTGTGGCAGGCTGTCGG + Intronic
1028512064 7:91636206-91636228 CTCTCTCTTTGGCTGGTAGATGG - Intergenic
1029652586 7:101903630-101903652 CCGGCTCTGTGGCAGGGAGAGGG - Intronic
1030101140 7:105946243-105946265 AGGTCTCTGAGGCAGGGTGATGG + Intronic
1030374287 7:108737332-108737354 CTATCTCTGTGACGGGTGGAGGG - Intergenic
1032554670 7:132819559-132819581 CTGTATCTGAGCCAGCTTGATGG - Intronic
1032991159 7:137396233-137396255 CTGTGTGAGTGGCAGGTGGAAGG + Intronic
1033286752 7:140048044-140048066 CTCTCTGTGTGGCAGGTGGACGG + Intronic
1037407902 8:18563531-18563553 CTGTCTTTGAGTCAGTTTGAGGG + Intronic
1039468462 8:37799474-37799496 GTGTCTCTGTGTCAGGGTTAGGG + Intronic
1039929017 8:41966185-41966207 CTATCTCAGTGGCAGGTTCTTGG + Intronic
1043471673 8:80569257-80569279 CTGTCTGTGTGGTAGTTTGGGGG - Intergenic
1045316550 8:101048489-101048511 CTGTCTCTGTGGCTGGCGGTTGG + Intergenic
1045854192 8:106744030-106744052 TTGTGTCTGTCGCAGGGTGAGGG + Intronic
1045931064 8:107627220-107627242 CTGTCTCTTTGGCATGTAGATGG - Intergenic
1049680514 8:143915924-143915946 CTGTGTGAGTGGCAGGTAGAAGG + Exonic
1051575909 9:18615307-18615329 CTGCCTGTGTGGCAGGGGGAGGG + Intronic
1055302108 9:74892447-74892469 CTCTGCCTGTGGCAAGTTGAAGG + Intergenic
1055684318 9:78754077-78754099 CTGTCACTGTGCCAACTTGAGGG + Intergenic
1056221209 9:84452148-84452170 CTGTCCTAGTGGCAGGTTGGTGG - Intergenic
1056714215 9:89014753-89014775 ATGTTTCTTTGGTAGGTTGATGG - Intronic
1057260861 9:93582539-93582561 TTGGCTCTGTGGCAGGTAGGTGG + Intronic
1057425916 9:94949545-94949567 CTGTGTCTGCTGCAGGCTGATGG + Intronic
1058175208 9:101727844-101727866 CTGTGTCTGTGGCCAGGTGAAGG + Intronic
1058626464 9:106938751-106938773 CTGTGGTTGTGGCAGGTTGTTGG + Intronic
1058941128 9:109813641-109813663 CTGTCTGTGCTGCAGGTTTAGGG + Intronic
1059026846 9:110643589-110643611 CAGTCTATGTGGTAGGTAGATGG - Intergenic
1060006021 9:120000602-120000624 CTGTCTCTGTGCCAGGATCTGGG + Intergenic
1061063911 9:128265741-128265763 CTGTCAAAGTGCCAGGTTGAAGG + Intronic
1061417328 9:130454205-130454227 CTGTCTCTGTAGCAGGGGGTGGG + Intronic
1062335376 9:136063101-136063123 CTGTTTCTGTGTCTGGTTGTGGG + Intronic
1062515773 9:136934710-136934732 GTGTCACTGTGGAAGGTGGAAGG - Intronic
1203751010 Un_GL000218v1:80294-80316 CTGTCTCTGTAGTAGTTGGATGG - Intergenic
1203482976 Un_GL000224v1:24049-24071 CTGTCTCTGTAGTAGTTGGATGG + Intergenic
1203709697 Un_KI270742v1:86395-86417 CTGTCTCTGTAGAAGTTGGATGG - Intergenic
1185769660 X:2755941-2755963 ATGCCTCTGTGACGGGTTGATGG + Intronic
1186103564 X:6182119-6182141 CTGTGTCTCAGGCATGTTGAAGG - Intronic
1187404104 X:18986843-18986865 AAGTCTCTGTGGCAGGATGATGG - Intergenic
1187962658 X:24581447-24581469 TTGTGTCTGTGGCAGAGTGAGGG - Intronic
1188404187 X:29786474-29786496 CTGTTTCTGTTGGAGCTTGAAGG + Intronic
1190286950 X:48967607-48967629 CTGTCTCTGTGGGAGGTGGGTGG - Intronic
1190440411 X:50470315-50470337 CAGACTCTGTGGCAGGTTCTGGG + Exonic
1190440423 X:50470351-50470373 CCGGCTCTGTGGCAGGTTCTGGG + Exonic
1190440430 X:50470375-50470397 CCGGCTCTGTGGCAGGTTCTGGG + Exonic
1192576111 X:72244598-72244620 CTGTTTCTGTCACAGGTTCAGGG - Intronic
1194519408 X:94900496-94900518 CTGTCTCTGAGGCACATCGATGG + Intergenic
1197169053 X:123410840-123410862 GTGTCTCTGTAGCTGGATGAAGG - Intronic
1198482197 X:137051700-137051722 CTGTATCTCAGGCTGGTTGAGGG - Intergenic
1200138275 X:153885414-153885436 CTGGCTCTGCGGCAGGTTTTCGG + Intronic
1200749939 Y:6935673-6935695 CTGTCAGTTTGGGAGGTTGAAGG + Intronic
1201157723 Y:11148819-11148841 TTGTCTCTCTGGTAGGTAGATGG + Intergenic
1201164663 Y:11197917-11197939 CTGTCTCTGTAGTAGTTGGATGG - Intergenic
1202242422 Y:22785533-22785555 CCCTCTCTGTGGCTGGCTGAGGG + Intergenic
1202395407 Y:24419282-24419304 CCCTCTCTGTGGCTGGCTGAGGG + Intergenic
1202475378 Y:25250810-25250832 CCCTCTCTGTGGCTGGCTGAGGG - Intergenic