ID: 1077476066

View in Genome Browser
Species Human (GRCh38)
Location 11:2791181-2791203
Sequence GCAGGCGGCAGGGGCGTGTC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 322
Summary {0: 1, 1: 0, 2: 0, 3: 31, 4: 290}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077476066 Original CRISPR GCAGGCGGCAGGGGCGTGTC AGG Intronic
900317997 1:2069007-2069029 GCAGCCGGCAGGGTGGTGACTGG - Intronic
900322006 1:2089359-2089381 CCAGGAGGCAGGGCCGTCTCTGG + Intronic
900467019 1:2830857-2830879 GCAGGCGGCGGGGGCGGGGGCGG - Intergenic
900513266 1:3070094-3070116 GAGGGCGGCAGCGGCGGGTCGGG - Intronic
902796296 1:18802779-18802801 GCTGGTGGCAGTGGGGTGTCGGG - Intergenic
903069160 1:20718006-20718028 GCAGGCGGCTGGGGCGGCTCCGG - Exonic
903439131 1:23374338-23374360 GCAGAGGGCAAGGGCCTGTCAGG + Intergenic
903642708 1:24870888-24870910 GCAAGCGGCAGGGCCGGGGCTGG - Intergenic
903654947 1:24943261-24943283 GCAGGGTGGAGGGGGGTGTCTGG + Intronic
903761865 1:25704017-25704039 GCATGTGGCAGGGGCGTCTGTGG - Intronic
903883707 1:26529606-26529628 GCTCGCGGCAGGGGCGGGGCCGG + Intergenic
905271430 1:36790166-36790188 GCAGGAGCTAGGGGCTTGTCTGG + Intergenic
906214349 1:44030423-44030445 GCAGGCGGCGGGGCCGGGCCGGG - Intronic
906510171 1:46406150-46406172 TCAGGTGGCAGGGCAGTGTCTGG + Intronic
911063016 1:93764115-93764137 GCAGGAGACAGGGGCCTGTCTGG - Intronic
914674692 1:149899669-149899691 GCAGGTAGAAGGGGCGTCTCCGG + Exonic
915163161 1:153933588-153933610 GCGGGAGGCAGGGGAGTGGCGGG + Exonic
922620280 1:226984459-226984481 ACAGGAGGCAGGGGCTTCTCTGG + Intronic
923744309 1:236686421-236686443 GGTGGCGGCGGGGGCGTGGCCGG + Intergenic
924944774 1:248838715-248838737 GCAGGCCGCGCGGACGTGTCCGG - Intronic
1063417917 10:5889255-5889277 GCAGGCGGCCGGGGGCTGCCCGG - Exonic
1063614980 10:7593391-7593413 GCAGGCTGCAGGGGTGAGTGGGG - Intronic
1063614999 10:7593457-7593479 GCAGGCTGCAGGGGTGAGTGGGG - Intronic
1063615018 10:7593523-7593545 GCAGGCTGCAGGGGTGAGTGGGG - Intronic
1063615028 10:7593556-7593578 GCAGGCTGCAGGGGTGAGTGGGG - Intronic
1063615038 10:7593589-7593611 GCAGGCTGCAGGGGTGAGTGGGG - Intronic
1063615048 10:7593622-7593644 GCAGGCTGCAGGGGTGAGTGGGG - Intronic
1063615058 10:7593655-7593677 GCAGGCTGCAGGGGTGAGTGGGG - Intronic
1064157644 10:12916819-12916841 TAAGGCTGCAGGGGCCTGTCTGG + Intronic
1064260887 10:13785392-13785414 GCAGGGGGCAGGTGCTTGGCAGG - Intronic
1065533497 10:26697169-26697191 GCAGCCGACCAGGGCGTGTCAGG + Intergenic
1066429367 10:35336955-35336977 GCGGGCGGCGGGGGCGTGTGGGG - Exonic
1067756419 10:49009094-49009116 GCAGAGGGCAGGGGCGGGTGAGG - Intergenic
1069567037 10:69470545-69470567 GCAGGTGGGAGGGGCTGGTCAGG - Intronic
1069698352 10:70404344-70404366 GCAGGCGGCGGCGGCGGGGCCGG - Intergenic
1069959449 10:72071031-72071053 GAAGGCTGCAGGGGCATGGCCGG - Intronic
1070827407 10:79399305-79399327 GGAGGAGGCAGGGGGGTGTGTGG - Intronic
1071298201 10:84237645-84237667 GCCGGGGGCAGGGTCATGTCGGG + Exonic
1072003487 10:91220549-91220571 CCGGGCGGCGGGGGCGTGGCCGG + Intronic
1072245756 10:93542538-93542560 GCAGGTGGAAGGGGAGGGTCAGG - Intergenic
1072766298 10:98097553-98097575 GCAGGCTGGAGGGGCGTTTGTGG - Intergenic
1074088711 10:110227238-110227260 GCGGGGGGGAGGGGCGTGTGCGG + Intronic
1074995588 10:118754788-118754810 ACAGGCGGCAGGTGCCTGTGAGG - Exonic
1075462252 10:122624660-122624682 GCAGGCAGCTGGGCCGTGGCTGG + Intronic
1075711522 10:124533350-124533372 GGGGGCGGCAGGGGCGTGGGGGG + Intronic
1075795136 10:125114846-125114868 GCAGGCGGCATGGGGGGGCCAGG - Intronic
1076171737 10:128325672-128325694 GCAGGCGGCAGGGAGGGGGCAGG - Intergenic
1076184052 10:128432688-128432710 GCAGGCGCCAGGGGTGGGGCAGG + Intergenic
1076675688 10:132146442-132146464 GCATGAGGCAGGGGCGGGGCTGG + Intronic
1076758379 10:132587274-132587296 GCAGGAGTGAGGGCCGTGTCTGG + Intronic
1076833739 10:133009661-133009683 GGAGGCTGCATGGGCGTGTCTGG - Intergenic
1076868843 10:133182876-133182898 GCAGGCGGCAAGGGCATGGGTGG + Intronic
1076904350 10:133354851-133354873 GCAGGTGGCAGGGGCTGGCCTGG - Intergenic
1076945081 10:133640905-133640927 GCAGGCGGCAGGTGCGGGAACGG + Intergenic
1077476066 11:2791181-2791203 GCAGGCGGCAGGGGCGTGTCAGG + Intronic
1078175026 11:8964043-8964065 GCAGTCGGGAGGGGCGGGGCTGG + Intronic
1078246085 11:9574105-9574127 GCGGGCGGCAGCGGCGAGTCGGG - Exonic
1078455907 11:11475000-11475022 GCAGGAGGCCTGGGTGTGTCAGG - Intronic
1081614667 11:44583542-44583564 GCAGGCGGCAGAGGTGTGGAAGG + Intronic
1082076787 11:47981037-47981059 GCAGGAGGCTGGGGCGGGACTGG + Intronic
1083544481 11:63538347-63538369 ACAGGAGGCAGGGGCTGGTCAGG + Intronic
1083590283 11:63889589-63889611 CCAGGCGGAAGGGGCCTGACAGG + Intronic
1083667671 11:64284652-64284674 GGAGGCGGCAGGCCCGGGTCAGG - Intronic
1083669368 11:64291693-64291715 GGAGGCGGCAGGGGCGGAGCGGG - Intronic
1084266595 11:68008357-68008379 GCAGGTGGGAGGGGTGTTTCAGG - Intergenic
1084524370 11:69686681-69686703 GGAGGAGGCAGGGGCGGGTCTGG - Intergenic
1085336668 11:75701923-75701945 GCAGGGGGCTGGGGCATGGCTGG + Intergenic
1089208920 11:116787911-116787933 GCAGGCGGCGGGGCCGGGGCGGG + Exonic
1090128582 11:124116053-124116075 ACAGGCCGCAGGGGTGTGTGTGG + Intronic
1090828657 11:130405618-130405640 GCAGGTGGCAGAGGCCTGGCCGG + Exonic
1091226074 11:133957025-133957047 GCGGGCGGCGGGGGCGGTTCCGG - Intergenic
1091396747 12:157849-157871 CCAGGCGGCTGGGGAGTTTCCGG + Intronic
1091769649 12:3142624-3142646 GCAGGGGGCAGGGGCGAGCAGGG - Intronic
1092021308 12:5204610-5204632 GCAGGCTGCAGGTGCCTCTCAGG + Intergenic
1095976193 12:47942497-47942519 GCAGGCGGGAGGGGTGTGGGAGG - Intronic
1096907245 12:54946854-54946876 GCAGGTGGCGGGGGCTAGTCGGG + Intergenic
1100992800 12:100267844-100267866 GCGGGCGGCAGGGCCCTGGCTGG - Intronic
1101252584 12:102950622-102950644 GGAGGCGGCAGGAACGTTTCAGG + Intronic
1103719106 12:122964049-122964071 GCAGCCGGCAGTGGCTTGGCTGG - Intronic
1103749779 12:123150867-123150889 GCAGGCGGCGGGGGCGCGCGGGG - Intergenic
1103893765 12:124259739-124259761 GCAGGCGGCCGGGGAGGGGCGGG - Intronic
1104513732 12:129404668-129404690 GCAGGGGGCAGGGGGGTGTAGGG + Intronic
1104897949 12:132173441-132173463 GCAGGCAGCACGGGCGTTTGGGG + Intergenic
1104921276 12:132291989-132292011 GCAGGAAGCAGGAGCGTGGCTGG - Intronic
1114495021 14:23126474-23126496 GCAGGAGGCAGGGGCAGGGCTGG + Exonic
1116945180 14:50830244-50830266 GCAGGCGGCCGGGGCGTCGGGGG + Intronic
1117424485 14:55580437-55580459 GCAGGCGGGAGGGCCGCGCCGGG + Intronic
1118398084 14:65354615-65354637 GCAGGCCGCAGGGCCCAGTCTGG + Intergenic
1119725760 14:76920902-76920924 GCAGGCTGCAGGGTGGTGCCCGG + Intergenic
1119859019 14:77923427-77923449 GCAGGAGGCAGGGCCTGGTCAGG + Intronic
1121342788 14:93115402-93115424 GCAGGCGGCGGGGGCGTGGGCGG - Intronic
1122082116 14:99273508-99273530 GGAGGCGGCCAGGGCGGGTCGGG + Intergenic
1122123463 14:99566805-99566827 GCAGGCAGCAGGGGCCTCTCAGG + Intronic
1122262290 14:100530499-100530521 GCAAGCGGCTGGGGCCTGTGAGG - Intergenic
1122342848 14:101039587-101039609 GCAGTCGGCAGGGGCCTCCCGGG - Intergenic
1122744254 14:103888656-103888678 GCAGGAGGCAGGGCCATGCCTGG + Intergenic
1122772379 14:104103177-104103199 GCAGGCCGCATGGGGGCGTCAGG - Intronic
1122834712 14:104425097-104425119 GCAGGCAGCAGGGCAGGGTCCGG - Intergenic
1122880835 14:104689792-104689814 GGAGGAGGCAGGGGCGTGCTTGG + Intronic
1122946427 14:105012686-105012708 GCAGGCAGCATGGGCGGGTGTGG - Intronic
1123706895 15:22957076-22957098 GCAGGCGGCAGTGCTGTGGCAGG + Intronic
1128035252 15:64519125-64519147 GCGGGGGGCGGGGGCGGGTCAGG + Intronic
1128618320 15:69127825-69127847 GCAGGGGGCAGGGGAGGGGCAGG - Intergenic
1128877632 15:71215175-71215197 GCAGGCGGTAGGAGCGGGGCAGG - Exonic
1129237745 15:74233945-74233967 TCAGGAGGCGGGGGCGTCTCTGG + Intergenic
1129266033 15:74393617-74393639 GCCCGGGGCTGGGGCGTGTCTGG - Intergenic
1132815890 16:1826434-1826456 GGAGGCGTCAGGGGCGCGGCCGG + Intronic
1133255544 16:4513797-4513819 GCAGGGGGCAGTGGCATGCCTGG + Exonic
1134018582 16:10906474-10906496 GCAAAGGCCAGGGGCGTGTCAGG - Intronic
1135771936 16:25224430-25224452 GCAGGTGGCAGGGGCGTTGGTGG + Exonic
1136062929 16:27739100-27739122 GGAGGCGGCAGTGGTGTCTCTGG + Intronic
1136531786 16:30874960-30874982 GCAGTCGGCAGAGGCGTGGCCGG - Intronic
1137984248 16:53094329-53094351 GCAGGTGGCAGGGGCAGGCCTGG + Intronic
1138560653 16:57799058-57799080 GGAGGCGGCAGGTGCGAGCCAGG + Intronic
1138594551 16:58022823-58022845 GCTGGCGGCAGGAGCTTGGCGGG + Intergenic
1139700984 16:68707821-68707843 GCAAGCGGCAGGGGTGTGGCGGG + Intronic
1139959602 16:70710088-70710110 GCGGGTGGCAGGGGCGTGCAAGG - Intronic
1140474625 16:75233692-75233714 TCAGGAGGCAGGGGGGTGGCAGG + Intronic
1140927575 16:79599181-79599203 GGAGGCGGCGGGGGCGCGGCGGG - Exonic
1142136347 16:88453561-88453583 GCGGGCGGCGGGGGCGCGGCGGG - Exonic
1142351729 16:89583779-89583801 GCAGGCTGCAGGGGTGCGCCCGG - Intronic
1142673394 17:1498030-1498052 GCCGGCGGTATGGGAGTGTCGGG + Exonic
1142810248 17:2392797-2392819 GCAGCCGGGAGGGGCGGGGCCGG - Intronic
1143185587 17:5008142-5008164 CCTGGCGGCAGGCACGTGTCAGG - Intronic
1143608892 17:8006438-8006460 GCAGGTGGCAGATGGGTGTCCGG + Exonic
1143750315 17:9022406-9022428 GCTGGCGGCGGTGGCGTGCCTGG + Exonic
1147140619 17:38458724-38458746 GCAGGGGCCAGGGGCGTGCTGGG - Intronic
1147558795 17:41496604-41496626 GCAGGCGCCAAGGGGGTCTCAGG + Intergenic
1148122764 17:45222289-45222311 GGGGGCGGCAGGGGCGCGGCAGG + Intronic
1148685343 17:49497540-49497562 GCAGACGGCAGGTTCCTGTCGGG - Intronic
1148782510 17:50129887-50129909 GCGGGCGGCAGGGGCGGGGAGGG - Intergenic
1149477839 17:56978079-56978101 GGAGGCGGACGGGGCGGGTCGGG - Intergenic
1150388851 17:64779746-64779768 GCAGGGGGCGGGGGCGGGCCCGG - Intergenic
1151559183 17:74861606-74861628 GCGGGGCGCAGGGGCGGGTCGGG - Intergenic
1151747854 17:76021433-76021455 GCAGGCGGCAGGGGCGGCAGGGG - Intronic
1152210466 17:79000512-79000534 GCAGGTGGCGAGGGAGTGTCAGG - Intronic
1152239854 17:79155584-79155606 GCTGGGGGCAGGGGGGTCTCAGG + Intronic
1154173412 18:12067131-12067153 TCAGGCGGGAGGGGCCTGGCGGG - Intergenic
1155322172 18:24630554-24630576 GCAGGTGGCAAGGACGTCTCAGG - Intergenic
1160340594 18:78085689-78085711 GCACGCGGCTTGGCCGTGTCCGG + Intergenic
1160747557 19:719197-719219 CGAGGCGGGAGGGGCGTGTGTGG - Intronic
1160824916 19:1074978-1075000 GCAGGAGGCCGGGGCGTGTGCGG - Intronic
1160831847 19:1108014-1108036 GCTGGGGGCCGGGGCGTGGCAGG - Exonic
1160874490 19:1290804-1290826 GCAGGCTCCAGCCGCGTGTCTGG - Intronic
1160933065 19:1579707-1579729 GCAGGAGGTAGGGTCCTGTCTGG - Intronic
1160952314 19:1673674-1673696 TTAGGAGGCAGGGCCGTGTCTGG + Intergenic
1161977377 19:7613868-7613890 GCAGGCAGCAGAGGCCAGTCAGG - Intronic
1162046854 19:8005662-8005684 GCGCGCGGGGGGGGCGTGTCCGG - Intronic
1162130368 19:8522577-8522599 GCAGGGGGTAGGGGAGTGTCTGG - Intronic
1162296937 19:9819684-9819706 CCAGGCGCCAAGGGCGTGGCTGG + Intronic
1163583876 19:18153758-18153780 GGAGGCGGGAGGGGCGGGGCAGG - Intronic
1164913349 19:32029889-32029911 GCAGGTGGCAGGGGGATGTTAGG - Intergenic
1164947618 19:32309764-32309786 GCCGGCGACAGGGGAGTGGCAGG - Intergenic
1165058543 19:33194204-33194226 GGAGGCGGCTGGGGCGGGCCGGG - Intronic
1165174087 19:33914432-33914454 GGAGGTGGCAGGGGCGGGGCTGG + Intergenic
1165433222 19:35783997-35784019 GAAGGCAGGAGGGGCGGGTCTGG + Intronic
1165433457 19:35784814-35784836 GCAGGGGGCCGGGGCGGATCAGG - Intronic
1165434942 19:35790446-35790468 GCTGGAGGCAGGGGAGAGTCCGG - Intergenic
1165771976 19:38385440-38385462 GCAGGCGGCGATGGCGTGGCTGG + Exonic
1166364346 19:42270915-42270937 GGAGCAGGCAGGGGCATGTCTGG - Intronic
1166930650 19:46299227-46299249 GGAGGCAGCAGGGGTGTGACGGG + Intronic
1166935416 19:46329523-46329545 GCAGGAGGCAGGGGCAAGACGGG - Intronic
1168286876 19:55339682-55339704 GACGGCGGCGGGGGCGTGGCGGG + Intergenic
1168339171 19:55613982-55614004 GCGGGCGGCAGGGGCGGATCGGG - Exonic
1168339350 19:55614567-55614589 GCAGGCGCCACGGGCGTGGCTGG - Exonic
925982521 2:9188903-9188925 GCAGATGGCAGTGGAGTGTCTGG - Intergenic
926273572 2:11386468-11386490 GTAGGCGGCCGGGGTGTGGCTGG - Intergenic
926320995 2:11748264-11748286 ACAGACGGCAGGGGAGGGTCAGG + Intronic
926355696 2:12038898-12038920 GAAGGCTGCAGGGGTGAGTCAGG + Intergenic
927673598 2:25089121-25089143 GCAGGAGGCAGCAGCCTGTCTGG + Intronic
928025927 2:27738474-27738496 GCTGGCGGCCGGAGCATGTCGGG - Intergenic
932496694 2:72149076-72149098 GCGGGCGGCCGGGGCGGGGCGGG - Intergenic
932666263 2:73701207-73701229 GAAGGTGGCTGGGGCGTGTTCGG + Intergenic
932701944 2:73998065-73998087 GCTGGCGGCAGGGGTGTGGAAGG + Intronic
934779564 2:96960922-96960944 GCAGGTGGCATGGGCGTGGGCGG + Intronic
935804848 2:106735209-106735231 GCAGGGGGCAGGAGGGTGGCAGG - Intergenic
936286137 2:111182774-111182796 GCAGGTGGGAGGAGCATGTCTGG - Intergenic
937049466 2:118876487-118876509 GCAGGTGGCAGGGCTGGGTCAGG - Intergenic
937585718 2:123546377-123546399 GGAAGCAGCAGGGGCTTGTCTGG + Intergenic
938015618 2:127864709-127864731 GGAGGCTGCAGGGGTGTGTGTGG + Exonic
938337050 2:130509802-130509824 GCACGCGGCAGCGGCTTGGCTGG - Intergenic
938352789 2:130610942-130610964 GCACGCGGCAGCGGCTTGGCTGG + Intergenic
938558213 2:132445893-132445915 GGAGGAGACAGGGGCTTGTCTGG + Intronic
943892739 2:193311074-193311096 GCAGGGGGCTGGGAGGTGTCAGG + Intergenic
945119636 2:206443983-206444005 GCAGGCGGCAGGGCGGCGTGCGG - Exonic
946411948 2:219519899-219519921 GCTGGGGGCAGTGGGGTGTCTGG + Intronic
947868721 2:233420086-233420108 GCAGTCGGCAGGGGCCTGGTGGG + Intronic
948735912 2:240004727-240004749 GCAGAGGGCAGGGGCTTGGCAGG - Intronic
948922316 2:241071542-241071564 GCAGGAGGAAGGGGCTGGTCTGG - Intronic
949055601 2:241926705-241926727 GTATGAAGCAGGGGCGTGTCTGG - Intergenic
1170678856 20:18507464-18507486 GCATGCGGAAGGGGCGGGGCGGG - Intergenic
1171238447 20:23546552-23546574 GCAGGCCGCAGGGAGGTCTCCGG + Intergenic
1172006594 20:31822646-31822668 CCTGGAGGCAGGGGGGTGTCAGG - Intronic
1172125246 20:32621695-32621717 TCAGGGGGCAGGGGTGTGACAGG + Intergenic
1172252529 20:33490021-33490043 GCGCGCGGCGGGGGCGTGCCCGG + Intergenic
1173255869 20:41394119-41394141 TCAGGCTGCAGGGCCGTCTCTGG - Intergenic
1173304505 20:41835457-41835479 GCAGGAGGCTGGGTGGTGTCAGG + Intergenic
1173647554 20:44642884-44642906 GCAGGAGGCAGGAGCGCCTCTGG + Intronic
1174819394 20:53713755-53713777 GCAGAGGGGAGGGGCGTTTCAGG - Intergenic
1175400498 20:58697424-58697446 ACAGGCGGCAGGGACGGCTCAGG + Intronic
1175412202 20:58777735-58777757 GCAGGCAGCAGGGGCCAGGCTGG - Intergenic
1175469927 20:59220352-59220374 CCAGGCAGCAGGTGGGTGTCGGG - Intronic
1176005909 20:62862047-62862069 CCGGGCAGCAGGGGCGTGGCTGG - Intergenic
1176074692 20:63243078-63243100 GCAGGCAGCAGGGGCTTGCGGGG + Intronic
1176178124 20:63738127-63738149 GCAGGGGGCAGGAGCGGGTCTGG - Intronic
1176194469 20:63830976-63830998 GCCGGCGGCGGGGGCGCGCCCGG + Intronic
1176388157 21:6150034-6150056 GCAGGAGGCAGGGGCCTGGCAGG - Intergenic
1176515871 21:7783040-7783062 GCAGGCAGATGGGGGGTGTCAGG - Intergenic
1178649899 21:34413052-34413074 GCAGGCAGATGGGGGGTGTCAGG - Intergenic
1179735315 21:43388214-43388236 GCAGGAGGCAGGGGCCTGGCAGG + Intergenic
1180085066 21:45504743-45504765 GCAGGGGGACGGGGGGTGTCCGG - Intronic
1181437440 22:22918856-22918878 GCAGGTGACAGGGACCTGTCAGG + Intergenic
1182255309 22:29033539-29033561 GGAGGGGGCAGGGGCGTGCAAGG + Intronic
1182445461 22:30387151-30387173 GCCGGCGGCCGGGGCGGGGCGGG - Exonic
1184071679 22:42150988-42151010 ACAGGAGGCAGGAGAGTGTCAGG - Intergenic
1184161092 22:42697777-42697799 GCAGGCAGCAGGGGTGTGCCAGG - Intronic
1184230790 22:43157297-43157319 GCAGGAGGGAGGGGCGGGGCAGG + Intronic
1184550637 22:45202611-45202633 GCAGGCGCCAGGGCCGGGCCTGG + Intronic
1184777611 22:46631341-46631363 GCAGGCTGCCGGGGTGTGGCAGG - Intronic
1184796820 22:46737858-46737880 GCAGGCGCCAGGGAGGGGTCGGG - Intronic
950542694 3:13621663-13621685 GCAAGGGGCAGGGGCCTGTCTGG - Intronic
950797372 3:15521019-15521041 GCAGGTGGCAGGGGCCGGTGGGG - Intronic
950902995 3:16513700-16513722 GGCGGCGGCGGGGGCGCGTCGGG - Exonic
954025634 3:47781452-47781474 GCGGGCGGCGGGGGCGTGGCGGG + Intronic
954356933 3:50089449-50089471 GGAGGCGGGAGGGGCATGTGCGG + Intronic
954778931 3:53045541-53045563 GCCGGCTGCAGGGGCGCGCCTGG - Intronic
955225490 3:57056948-57056970 GCAGGGGGCAGGGGTGTGTGGGG - Intronic
956371834 3:68571338-68571360 GCAGGTGGCAGTGGCTTCTCAGG - Intergenic
957083076 3:75655490-75655512 GCAGGCGGCAGGTGCGGGAACGG - Intergenic
958026816 3:88058974-88058996 GCAGGCGGACGGGGCGCGGCGGG - Intronic
960916677 3:122702168-122702190 GTAGGCTGCAGGGGCATGGCAGG + Intronic
961194079 3:124986692-124986714 GCAGAGGGCAGAGGCCTGTCTGG - Intronic
961330012 3:126132826-126132848 GCAGGAGGCAGGGCGCTGTCTGG + Intronic
962809002 3:138946184-138946206 GCAGGCGGGTGCGGCGTGGCGGG - Exonic
964433149 3:156625620-156625642 GCAGGTGGCATGGGGGTGGCAGG - Intergenic
964451501 3:156817026-156817048 GCAGGCAGCGGGGGCGGGGCCGG + Intergenic
967018025 3:185498831-185498853 GCTGGAGGCAGGTGCGTGGCGGG - Exonic
967067988 3:185937726-185937748 CCAGGAGGCAGGGGCGTTTTAGG - Intronic
967174049 3:186846599-186846621 GCAGGAGGCAGAGCCGTGTGGGG - Intronic
968698147 4:2042523-2042545 GCTGGCGACAGGGGCGTGCGGGG + Intronic
968729222 4:2261857-2261879 GCGGGCGGCGGGGCCGTGCCGGG - Intronic
968803283 4:2756531-2756553 GCGGACGGCAGGGGCGGGGCCGG - Intergenic
968948348 4:3677277-3677299 GCAAGCCTCAGGGGCGTGACAGG - Intergenic
969666487 4:8560348-8560370 GCTGGCTGCAGGGCCGTGTGGGG + Intronic
977696497 4:99971823-99971845 GCAGGCAGCAGTGGCATGGCAGG - Intergenic
982129254 4:152212517-152212539 GGAGGGGGCAGGGCCTTGTCAGG + Intergenic
982901167 4:161003964-161003986 GCTGGCGGCAATGGCCTGTCTGG - Intergenic
982979633 4:162116486-162116508 GCAGGGGGCAGGGACTTCTCTGG - Intronic
984206369 4:176792447-176792469 GGAGGCGGCGGGAGCGGGTCCGG + Exonic
985448464 4:190041415-190041437 GCAGGCGGCAGGTGCGGGAACGG + Intergenic
986306882 5:6522773-6522795 GGTGGCAGCAGGGGCGTGTCTGG + Intergenic
989178878 5:38556710-38556732 GCCGGGGGCAGGGGCGGGTCAGG - Intronic
992765086 5:79991110-79991132 GCAGGAGGAAGGGGCGGGGCTGG - Intronic
993905709 5:93621235-93621257 GCAGGCGGGAGGGGCGGGGAGGG - Intronic
997381494 5:133441342-133441364 CCAGGATGCAGGGGCATGTCTGG - Intronic
998250486 5:140548964-140548986 GGAGGCAGCAGGGGGGTGTCCGG - Exonic
998566703 5:143222286-143222308 GCAGGCGGCAGATGTGTGTGTGG - Intronic
1001565059 5:172694742-172694764 GCAGGTGGCAGGGGCTGGTGAGG - Intergenic
1001724825 5:173888154-173888176 GCAGACGGAAGAGGCGTCTCTGG + Intergenic
1002082291 5:176744226-176744248 GCAGGCGCCCGGGGCCTGCCTGG + Intergenic
1002188346 5:177466407-177466429 GCAGGCGGCATGGGTGAGCCTGG - Intronic
1002299470 5:178249124-178249146 GCAGGCGAGATGGGCTTGTCCGG - Exonic
1002634772 5:180601852-180601874 GCAGCGGGCAGGGGCTTGCCCGG - Exonic
1002878793 6:1234355-1234377 ACAGGCTGCAGGGGAGTGCCGGG - Intergenic
1004171337 6:13297632-13297654 GCTGGGGGCAGGGGTGTCTCAGG - Intronic
1006192395 6:32217631-32217653 GCAGGGGACAGAGGAGTGTCCGG + Intronic
1006335904 6:33420383-33420405 GCAGGGGGCGGGGGAGAGTCGGG + Intronic
1006391514 6:33761622-33761644 GCAGGCTGCAGGGATGTATCAGG + Intergenic
1006439835 6:34047195-34047217 TCATCCAGCAGGGGCGTGTCAGG - Intronic
1006611686 6:35297993-35298015 CCAGGCGGCAGGGGCTGGTGTGG - Intronic
1006941299 6:37753810-37753832 GGAGCGGGCAGGGGCGTGTGGGG + Intergenic
1007390240 6:41546504-41546526 GCAGGCGGCGGCGGCGCGGCGGG + Exonic
1007444621 6:41895368-41895390 GCAGGGGGCGGGGCCGTGTTCGG - Intergenic
1009842621 6:69095400-69095422 GCAGGGGGCAGGGGCATGGCTGG + Intronic
1010581972 6:77610376-77610398 GCAGGCAGCAGGAGGCTGTCTGG + Intergenic
1011640203 6:89411398-89411420 GCAGCCGGCGGCGGCGTGACTGG - Intronic
1011744925 6:90400235-90400257 GCAGTCCGCAGGGGCATGGCGGG - Intergenic
1014281902 6:119450817-119450839 GCAAGAGGCAGGGACGTGGCAGG - Intergenic
1014797883 6:125747759-125747781 GCAGGCGACCGGCGCGCGTCAGG + Intronic
1016596675 6:145810904-145810926 TGAGGCAGCAGGGGCGTGTGGGG - Intronic
1017158239 6:151341591-151341613 GCAGCCGGCAGGGGCGCGCTGGG + Intronic
1017561883 6:155636840-155636862 GTGGGCGGCAGGGGGGTGGCAGG - Intergenic
1018613283 6:165662843-165662865 GCGGGCGGGAGGGGCGCGGCGGG + Intronic
1019195842 6:170282680-170282702 GCAGGCGGCCGGGCCGCGACAGG + Exonic
1019398452 7:836309-836331 GCAGGCAGGAAGGGTGTGTCAGG + Intronic
1019421751 7:954139-954161 GGCGGCGGCAGGGGGGTTTCCGG + Intronic
1023382681 7:39623874-39623896 GGCGGCGGCGGGGGTGTGTCCGG + Intronic
1029715085 7:102321374-102321396 GCAGGCGGCCGCGGCGAGGCTGG - Exonic
1032090119 7:128907364-128907386 GCTGGGGGCTGGGGCGTGCCTGG - Exonic
1032122857 7:129169304-129169326 GCAGGCGGGGCGGGCGCGTCCGG + Intronic
1034590138 7:152131640-152131662 GCAGGCTGCAGGGTCGTGCCAGG + Intergenic
1034732855 7:153403146-153403168 GCAGGCTGCAGGGGCCTCTGTGG - Intergenic
1035717046 8:1763327-1763349 GCCGGCGGGAGGGGCGGGGCCGG - Intronic
1037985792 8:23289895-23289917 GCAGGAGGCAGGAGCGCGGCAGG - Exonic
1038204940 8:25457828-25457850 GCAGGCGGGAGCGGGGTCTCGGG + Intronic
1041107012 8:54454028-54454050 GCGGGCGGGAGGGGAGTGTAAGG - Intergenic
1049179706 8:141216004-141216026 GCAGGCGGCTGGCTCCTGTCGGG + Intronic
1049345330 8:142135764-142135786 CCAGGCAGCAAGGGCGTCTCAGG - Intergenic
1049567607 8:143349304-143349326 GCAGGGGGCAGGGGGGTGGGAGG - Intronic
1049614153 8:143568997-143569019 GCAGGCGGGAGGGGCGGGGGCGG + Intronic
1049788483 8:144462522-144462544 GCAGGCGGCGGCGGCGGCTCTGG - Intronic
1050304918 9:4297996-4298018 GGAGGCGGCGGGGGAGTGACGGG - Intronic
1051329607 9:16010433-16010455 GCAGGCAGCAAGGGCCTGTGGGG + Intronic
1053277102 9:36791342-36791364 GCTGGGAGCAGGGGTGTGTCAGG + Intergenic
1054842584 9:69759710-69759732 GGAGGAGGCAGAGCCGTGTCGGG - Intronic
1056992416 9:91423946-91423968 GCGGCCGGCAGGGGCGGGCCGGG + Intergenic
1059405865 9:114098193-114098215 GCGGGCGGCAAGGGCGTGGCTGG + Intronic
1061248601 9:129413987-129414009 GCGGGCGGCAGGGGCAGGTCTGG - Intergenic
1061299679 9:129697465-129697487 GCAGGCGCCAGGGGCTCGTCTGG + Intronic
1061793342 9:133070354-133070376 GCAGTGGGCAGGGAAGTGTCTGG - Intronic
1061795949 9:133086151-133086173 GCAGTGGGCAGGGAAGTGTCTGG - Intronic
1062180051 9:135186446-135186468 GCTGGAGTCAGGGGCTTGTCTGG + Intergenic
1062266673 9:135689705-135689727 GCTGGCGGTGGGTGCGTGTCGGG - Intergenic
1062385477 9:136309348-136309370 CCATGAGGCAGGGGCGTGGCGGG - Intergenic
1062426034 9:136506680-136506702 CCAGGCGGGTGGGGCGTGTGGGG - Intronic
1062562322 9:137147004-137147026 GCTGGGGGGAGGGGCCTGTCGGG - Intronic
1062732985 9:138119879-138119901 GCAGCCAGCAGAGGCGTCTCTGG + Intronic
1188482949 X:30653310-30653332 CAAGGCTCCAGGGGCGTGTCAGG - Intergenic
1192206284 X:69098630-69098652 GCAGGAGGCAGGGGAGAGACTGG - Intergenic
1192366478 X:70477879-70477901 GCAGAGGGAAGGGGAGTGTCAGG + Intronic
1194427846 X:93762161-93762183 GCAGGGGGCAGGGGGGTGGTGGG - Intergenic
1200150041 X:153946879-153946901 GCAGGCGGCAGGGGCTTGGAGGG + Intergenic