ID: 1077478993

View in Genome Browser
Species Human (GRCh38)
Location 11:2804167-2804189
Sequence GGGTGAACTGCAGTTGTTTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 109
Summary {0: 1, 1: 0, 2: 2, 3: 8, 4: 98}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077478993 Original CRISPR GGGTGAACTGCAGTTGTTTC TGG (reversed) Intronic
900552055 1:3261745-3261767 GGCTGAACGCCAGTTCTTTCAGG - Intronic
901826432 1:11864743-11864765 GGGTGAAGCACAGTTCTTTCTGG - Intergenic
902512217 1:16972625-16972647 GGCTGGACTGCAGGTGTTGCTGG - Exonic
909585053 1:77280778-77280800 GCTTGAGCTGCAGTTGTTTCCGG + Intergenic
912029201 1:105218264-105218286 GGATGAACTGGAGTCTTTTCAGG + Intergenic
913490816 1:119378193-119378215 GGCTGGAGTGCAGTTGGTTCTGG - Intronic
915417893 1:155756431-155756453 GGGAAAACTGCAGTTGTTGCAGG - Intronic
920447842 1:206033389-206033411 TGGTGAACTGCATTCCTTTCTGG + Intergenic
1063764200 10:9119094-9119116 AGGTGCACTGAAGTTCTTTCTGG - Intergenic
1065928674 10:30459124-30459146 GGCTGAACTGCATTCGTTGCAGG + Intronic
1074963632 10:118469922-118469944 GGGAGGACTGCAAGTGTTTCAGG - Intergenic
1077478993 11:2804167-2804189 GGGTGAACTGCAGTTGTTTCTGG - Intronic
1078339301 11:10487531-10487553 GGGTGAGCTGCATTTGTGTCAGG + Intronic
1079222787 11:18578376-18578398 GTGTCAACTGCCTTTGTTTCTGG - Intronic
1081199907 11:40203175-40203197 GGGTGAACTTCAGTTCTTTCAGG - Intronic
1081523740 11:43908484-43908506 GGATGAAGGGCATTTGTTTCTGG + Intronic
1084530266 11:69723169-69723191 GGGTGAACTGCACTGGGTGCAGG + Intergenic
1091230097 11:133982598-133982620 TGGTGAAATGCAGCTGTTCCTGG - Intergenic
1092470861 12:8779342-8779364 GGGTGAACTGTTGTTGTTTTAGG + Intronic
1093093356 12:14945372-14945394 GGGTGAAATTCACTTGTATCTGG + Intronic
1097748096 12:63321544-63321566 GAGTGAAAAGCAGGTGTTTCAGG - Intergenic
1100600484 12:96108301-96108323 GTGTGAACTTCTGTAGTTTCTGG - Intergenic
1103571367 12:121847189-121847211 GGTGGAACTGCAGGTTTTTCAGG + Exonic
1104453148 12:128887815-128887837 GGGTGAACTCCAGTTAGATCTGG + Intronic
1110537254 13:76665788-76665810 GGGTGAACAGGAGTTGCTTTGGG - Intergenic
1110692188 13:78443732-78443754 AGGTGAAGTGCAGTGGTTTTTGG - Intergenic
1113399798 13:109980590-109980612 AGGTGACCTGCAGGTGTTTCAGG + Intergenic
1118153826 14:63218775-63218797 TGGTCAACTGTAGTTGTCTCAGG - Intronic
1121818860 14:96949722-96949744 AGGGGAACTGAACTTGTTTCTGG + Intergenic
1122816760 14:104317880-104317902 GGCTGAACTGCAGGGATTTCAGG + Intergenic
1124047793 15:26166282-26166304 GAATGACCTGCAGTTGATTCTGG - Intergenic
1125043772 15:35222811-35222833 GGGTGAAATTCAACTGTTTCAGG + Intronic
1126991112 15:54376830-54376852 GGGTGAACAGCAAGTCTTTCTGG - Intronic
1127126789 15:55819732-55819754 GGCTGAACTGCCCTTGTTTTTGG - Intergenic
1129783056 15:78287375-78287397 GGTTAAAATGCAGTTTTTTCTGG - Intronic
1130670532 15:85908528-85908550 GTGGGAAATGCAGTCGTTTCAGG + Intergenic
1131245676 15:90790354-90790376 GGGCTGACTGCAGTTGATTCTGG + Intronic
1134195402 16:12155729-12155751 GGATGAACTGCAGAAGGTTCTGG - Intronic
1138244361 16:55455836-55455858 GGGTGAATTGCTGTTGATACAGG - Intronic
1145629497 17:25844250-25844272 GGGATAACTGCACTTGTTTGAGG + Intergenic
1145646648 17:26093058-26093080 GGGATAACTGCACTTGTTTGAGG + Intergenic
1145654538 17:26207248-26207270 GGGATAACTGCACTTGTTTGAGG + Intergenic
1147678433 17:42223496-42223518 GGTTGATCTGGAGGTGTTTCTGG + Exonic
1149773506 17:59339888-59339910 GGTTTATCTGCAGTTGTTCCAGG + Intronic
1155710653 18:28874073-28874095 GTGTGAAATGCATTTTTTTCTGG - Intergenic
1158579206 18:58666955-58666977 TGGAGAACTGCAGTTGCTCCAGG - Intergenic
1161626661 19:5330885-5330907 GTGTGAACTGCCGGGGTTTCCGG - Intronic
1167665239 19:50819715-50819737 GGGTGAGATGCAGTTGTCCCTGG + Intronic
927607041 2:24494712-24494734 GGGTGAAATCCATGTGTTTCAGG + Intronic
931632312 2:64312184-64312206 GGGGGAACCCCAGTTGTTCCTGG + Intergenic
932507093 2:72245404-72245426 GGGTGATGTCCAGTTGTTCCAGG - Intronic
942265641 2:174222323-174222345 TGGTTAAGTGCATTTGTTTCTGG - Intronic
946465352 2:219907128-219907150 ATGTGAAGTGCAGCTGTTTCTGG + Intergenic
946722287 2:222622388-222622410 GTTTTAACAGCAGTTGTTTCTGG + Intronic
1176927906 21:14772460-14772482 AGGTGAAGTCCAGTTGTTTCAGG + Intergenic
1177249928 21:18579649-18579671 GAGTGATCTGCAGTGGTTCCTGG + Intergenic
1177498048 21:21914603-21914625 GGGTCAAATGCAGTTGTTTCTGG - Intergenic
1178934955 21:36853289-36853311 GGGAGAAAGGCAGTTGTTTAAGG - Intronic
1182373929 22:29832289-29832311 GGGTGATCTGGAGTTGGTCCAGG + Exonic
1184426062 22:44410005-44410027 GGGTGGACTGCAGTTCTTCTCGG - Intergenic
1184608091 22:45585879-45585901 GGGATAACAGCAGCTGTTTCGGG - Intronic
1185161793 22:49234412-49234434 CGGTCAACTCCAGTTGTCTCCGG - Intergenic
949197389 3:1328764-1328786 AAGTGAACTGAAGTTCTTTCGGG - Intronic
949234044 3:1787067-1787089 GGCTGAGCTGCATTTTTTTCTGG + Intergenic
953476763 3:43211912-43211934 GGGTGAACTGAAGCTCTTTCTGG + Intergenic
964345081 3:155746853-155746875 GGGTGAACTGCTGCTGTTGAGGG - Intergenic
967293954 3:187947724-187947746 GGGTGAACTCAAGTTGTATATGG - Intergenic
970300115 4:14672238-14672260 TGGTGAACTGCATATGTTTGTGG - Intergenic
985331110 4:188835549-188835571 GGGTGAAATTCAGTTGTGTGGGG + Intergenic
987370967 5:17192645-17192667 GGGTTCACTCAAGTTGTTTCTGG + Intronic
987523555 5:19019136-19019158 TGGTGGACTGCATTGGTTTCAGG + Intergenic
987887600 5:23831552-23831574 GGGTCAACTGCAGCTTTTTGGGG - Intergenic
989039609 5:37213908-37213930 GGGTCAATTGTAATTGTTTCTGG - Intronic
994106448 5:95954799-95954821 GGGTGGACTCCAGTTATCTCTGG + Intronic
997204461 5:132036314-132036336 GTGTAAACTGGAGTTGTTCCAGG + Intergenic
998340179 5:141410257-141410279 GGCTGAACTGCAGTTTTACCTGG + Exonic
1006208291 6:32370034-32370056 AGGTGATCAGAAGTTGTTTCTGG - Intronic
1007219947 6:40270541-40270563 GGGTGAAAAGCAATTCTTTCAGG - Intergenic
1007652842 6:43433872-43433894 GGGTCAACTCCAGGTGTTTAGGG + Intronic
1008002392 6:46374178-46374200 GGGTGAACTGCAGAAGATTTTGG - Intronic
1010627227 6:78153298-78153320 GGGTGAACATCAGTGGTTTCTGG + Intergenic
1013618610 6:111867964-111867986 TGGGGAACTGCAGTTAGTTCAGG - Intronic
1016234472 6:141846397-141846419 AGCTAAACTGAAGTTGTTTCAGG - Intergenic
1022497676 7:30863250-30863272 AGCTGAACTGCAGTTGGTCCTGG - Intronic
1026403557 7:70040783-70040805 GGGTAACCTGCAGTGGCTTCAGG - Intronic
1026793969 7:73354083-73354105 TGGTGAGCTGCAGTTGTTGGAGG + Intronic
1027882293 7:83855977-83855999 GGGAGAACTGGATTTGTTTAAGG + Intergenic
1033308324 7:140240747-140240769 GGGTGAACTGTAGTGTTTTGGGG + Intergenic
1037072070 8:14663040-14663062 GGCAGAACTGCATTTCTTTCTGG - Intronic
1038587073 8:28799596-28799618 TGGTGAAATGGAGTTGTTTGAGG - Intronic
1040309718 8:46230518-46230540 GGGTGAACTGCAGTTACTCAGGG + Intergenic
1040449043 8:47525724-47525746 GGGTGGAGTGCAGTGGCTTCTGG - Intronic
1041316093 8:56564223-56564245 GGTTGAACTGTAATTGATTCAGG + Intergenic
1044990527 8:97791494-97791516 GAGTGAACTTCAGTCGGTTCTGG - Intronic
1046740888 8:117827948-117827970 GGGTAGATTCCAGTTGTTTCTGG - Intronic
1050299841 9:4246500-4246522 GTGACATCTGCAGTTGTTTCAGG + Intronic
1050383800 9:5062065-5062087 GGGTCAACTGTAATTGTTTTGGG - Intronic
1056038845 9:82638154-82638176 GGCTGTAGTGAAGTTGTTTCAGG - Intergenic
1057210229 9:93197193-93197215 GGGTGAACTGCAAATGGGTCAGG - Intronic
1057826698 9:98377399-98377421 GAGTGAGCTCCAGTTATTTCTGG - Intronic
1188372227 X:29382755-29382777 GTGTCAACTGCAGCTCTTTCAGG + Intronic
1188575509 X:31645085-31645107 GGGTTAATGGCATTTGTTTCAGG + Intronic
1193151688 X:78131749-78131771 TTTTGAACTGCAGTTGTTGCAGG + Exonic
1193305341 X:79944284-79944306 GGGTCAACTGGCTTTGTTTCTGG + Intergenic
1193871010 X:86798658-86798680 GGGTGAACTGGAATTGGCTCTGG + Intronic
1193943711 X:87707405-87707427 GGGTGAAGTGGAGTTGTGCCAGG + Intergenic
1193949252 X:87778259-87778281 GGGTGAGCTGAAGCAGTTTCTGG + Intergenic
1195559007 X:106262039-106262061 GGCTAAACTGCTATTGTTTCTGG + Intergenic
1201326744 Y:12768767-12768789 GGGTCAACTGTACTTGTTACTGG + Intronic