ID: 1077479828

View in Genome Browser
Species Human (GRCh38)
Location 11:2808317-2808339
Sequence CTGGCATCACAGAGCTACCC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 214
Summary {0: 1, 1: 0, 2: 2, 3: 17, 4: 194}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077479819_1077479828 25 Left 1077479819 11:2808269-2808291 CCAGTGGAAGATAATGGAGGTGT 0: 1
1: 0
2: 0
3: 10
4: 165
Right 1077479828 11:2808317-2808339 CTGGCATCACAGAGCTACCCCGG 0: 1
1: 0
2: 2
3: 17
4: 194
1077479818_1077479828 26 Left 1077479818 11:2808268-2808290 CCCAGTGGAAGATAATGGAGGTG 0: 1
1: 0
2: 2
3: 30
4: 222
Right 1077479828 11:2808317-2808339 CTGGCATCACAGAGCTACCCCGG 0: 1
1: 0
2: 2
3: 17
4: 194

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077479828 Original CRISPR CTGGCATCACAGAGCTACCC CGG Intronic
900092661 1:927203-927225 CTGCTGTCACAGACCTACCCGGG + Intronic
900313905 1:2047826-2047848 CTGGCAGCACAGATCTCCCCAGG + Intergenic
900931897 1:5743062-5743084 CTGACGTCACAGAGCCAGCCCGG - Intergenic
902577228 1:17386087-17386109 CAGTCCTCACAGAGCTGCCCAGG - Intronic
902783794 1:18720426-18720448 CTGGCATGACAGCTCAACCCTGG + Intronic
903662809 1:24989009-24989031 CTGCCTTCACAGAGCAACACTGG + Intergenic
903950355 1:26993040-26993062 GTGGCATCACAGAGGAGCCCCGG - Intergenic
905548776 1:38819430-38819452 CAGGCATCAGAGAGCTACCATGG - Intergenic
906250948 1:44310664-44310686 CTAGCATCTCAGAGGTATCCAGG - Intronic
908139556 1:61170120-61170142 CTGGCTATATAGAGCTACCCTGG + Intronic
912616388 1:111104220-111104242 AAGGCATCAAAGAGCTACACAGG - Intergenic
914903983 1:151729067-151729089 CTGACATGACAGATCAACCCTGG - Intronic
916058998 1:161086313-161086335 CTGGGGTCACAGGGCTTCCCTGG + Intronic
916489174 1:165286373-165286395 CTGGCATGTCAGACCCACCCTGG - Intronic
916917674 1:169427306-169427328 CTGGGATCACAGAGATGGCCGGG + Intronic
919081650 1:192874342-192874364 CTGGCTACTCAGAGCCACCCTGG + Intergenic
919858843 1:201724966-201724988 CTGGGAGCACAGAGCCAGCCTGG - Intronic
922749293 1:228063202-228063224 ATGGGAGCACAGAGCTACCCAGG + Intergenic
923091393 1:230743793-230743815 ATGGCATCCCAGAGCCACCCAGG + Intergenic
923596850 1:235367246-235367268 CTGGGATGACAGAGCAGCCCAGG - Intergenic
1063708033 10:8450038-8450060 CTGGAGTCTCAGAGCTACTCTGG - Intergenic
1066064040 10:31749721-31749743 CAGGCATCACAGACTTTCCCAGG - Intergenic
1067063656 10:43091005-43091027 CTGGCATCACCCTGCTGCCCTGG - Intronic
1067233224 10:44426309-44426331 ATGGCACCCCAGAGGTACCCAGG - Intergenic
1067469210 10:46523821-46523843 CTGGCATGGCAGAGCCAGCCTGG + Intergenic
1067532727 10:47086188-47086210 CTGGCCTCACTGAGCTACCTTGG + Intergenic
1069325189 10:67224747-67224769 CTGGCATCACAGGGATCCACTGG + Intronic
1071598969 10:86947077-86947099 GTGGCATGAAAGAGCCACCCTGG + Intronic
1076081007 10:127580603-127580625 CTGGCATCCCAGGTCTTCCCCGG + Intergenic
1076603909 10:131677201-131677223 CTGGGCTCCCAGAGCTAACCCGG + Intergenic
1077058481 11:607477-607499 CAGACATCTCTGAGCTACCCAGG + Exonic
1077220297 11:1412774-1412796 CTGGCTGCACAGATCAACCCAGG + Intronic
1077479828 11:2808317-2808339 CTGGCATCACAGAGCTACCCCGG + Intronic
1077509766 11:2952077-2952099 CTGGCACCACAGCTCTGCCCTGG + Intronic
1082948283 11:58783992-58784014 CTGGCACCACAGAGTTACAAAGG + Intergenic
1083712095 11:64555817-64555839 GAGGCATCACAGGGCTTCCCGGG + Exonic
1084031604 11:66484541-66484563 CTGGCATAAGAGAGCTACCCAGG - Intronic
1084163538 11:67364399-67364421 CTGGCAACCCACAGATACCCTGG + Exonic
1084781493 11:71412599-71412621 CTGGCATCACATGCCCACCCTGG - Intergenic
1085720541 11:78908748-78908770 CTAGCATCTCAGAGCAAACCAGG + Intronic
1087442951 11:98208519-98208541 CTGGCATGTCAGCACTACCCTGG + Intergenic
1089668136 11:120033179-120033201 CTCTCATCACAGAGCAAGCCTGG + Intergenic
1091344317 11:134842824-134842846 TTGGCATCCCATACCTACCCAGG + Intergenic
1091635477 12:2193639-2193661 CTGGTATCACAGTGCTAGACTGG + Intronic
1092810266 12:12266460-12266482 CTGGCTTCCCAGACCTTCCCCGG - Intronic
1094226079 12:28047828-28047850 CTGGAACCCAAGAGCTACCCAGG + Intergenic
1096007899 12:48186791-48186813 CTGGGAAAACAAAGCTACCCAGG + Intergenic
1101322362 12:103683958-103683980 CTAGATTCCCAGAGCTACCCTGG - Intronic
1101409630 12:104457667-104457689 CTGGCTGCCCAGATCTACCCGGG + Intronic
1103344108 12:120237964-120237986 ATGGCATCACTGAGCTACAAAGG + Intronic
1112987252 13:105466389-105466411 ATGGCAGCACAGAGCTCCCAGGG + Intronic
1113433625 13:110271439-110271461 CTGGCATCACACACCTCCCAAGG + Intronic
1118824788 14:69370219-69370241 CTGACATAGCAGAGCTACCTCGG + Intergenic
1118853803 14:69605782-69605804 CTGGCAGCTCAGAGCTAGCAAGG + Intergenic
1119227941 14:72958398-72958420 ATGGCATCACACAGCCAACCAGG + Intronic
1121535817 14:94690071-94690093 CTGAGACCACAGAGCCACCCTGG + Intergenic
1122423370 14:101591096-101591118 CTGGCAAAACAGACCTACCTGGG - Intergenic
1122467644 14:101945211-101945233 CTGGCATCATTGAGCTTCTCTGG - Intergenic
1122978118 14:105179297-105179319 CTGACATCACAGGCCTCCCCTGG + Intronic
1126788589 15:52199601-52199623 CTAGAATCAGAGAGCTCCCCTGG - Intronic
1127075328 15:55319492-55319514 CTGGCAACACAGAGCTCAACGGG - Intronic
1129332606 15:74835509-74835531 CTGGGATGACTGAGCAACCCGGG + Intergenic
1130996585 15:88907655-88907677 CTGTCCCCACAGTGCTACCCTGG - Intronic
1131034276 15:89210911-89210933 CCAGCATCACAGGGCTGCCCTGG + Intronic
1134201630 16:12204210-12204232 CTGGCGTGACAGTCCTACCCTGG + Intronic
1134216610 16:12321413-12321435 CTGGAATCACAGTGATTCCCAGG + Intronic
1137537436 16:49338033-49338055 CTGACATCCCAGAGTTCCCCTGG - Intergenic
1138302389 16:55943464-55943486 CTGGCATTACAGAGATCCCCAGG + Intronic
1139163063 16:64534725-64534747 CTGGCAGCACAGTTCTTCCCAGG - Intergenic
1142863966 17:2779332-2779354 CTGGCCACACAGAAATACCCCGG - Intronic
1146570524 17:33948635-33948657 CTGGAATCCAAGAGCTGCCCTGG + Intronic
1147337690 17:39737455-39737477 CTGGCCCCTCAGAGGTACCCAGG - Intergenic
1147511253 17:41070662-41070684 CTGGCTTCACATTGCTACCATGG + Intergenic
1147623177 17:41881756-41881778 CTGGCTACACAGATCTACCAAGG + Intronic
1148565923 17:48632992-48633014 CTGGCCTCTCAGAGCTACACTGG - Intronic
1149397651 17:56261361-56261383 CTGGAGTTATAGAGCTACCCAGG - Intronic
1151881026 17:76894524-76894546 CTGACATCATAAAGCCACCCAGG - Intronic
1155611315 18:27671068-27671090 CTGCTATCACACAGATACCCAGG + Intergenic
1156516758 18:37686765-37686787 CTGTCATCACAGATCCTCCCAGG + Intergenic
1158653848 18:59310827-59310849 ATTGCATCACAGAGCTACAACGG + Intronic
1159458464 18:68693390-68693412 CTGGCATCCCTGAGCTCTCCGGG + Intronic
1162600508 19:11664929-11664951 CAGGCATCACTGAGCTAAACTGG + Intergenic
1162899934 19:13788795-13788817 CTGGGATCACAGGGCAAACCCGG - Intergenic
1164588883 19:29495260-29495282 CTGGCCTCACTGCGCGACCCTGG + Intergenic
1164589710 19:29500015-29500037 CTGGGAGCACAGAGCTGCCCGGG - Intergenic
1167665263 19:50819817-50819839 CTGGCTTCTGAGAGCTAACCAGG - Intronic
1168210033 19:54883638-54883660 CTGCCATCTCAGTGCTTCCCAGG + Intronic
931243156 2:60470490-60470512 CTGGGATCACAGAGATACCTGGG - Intronic
933986140 2:87593902-87593924 CAGGCAGCCCAGAGCTGCCCAGG + Intergenic
935981748 2:108634968-108634990 CTGGGGTCACAGAGGAACCCAGG + Intronic
936307696 2:111356901-111356923 CAGGCAGCCCAGAGCTGCCCAGG - Intergenic
936636064 2:114260109-114260131 CTGGAATCATAGACCAACCCTGG - Intergenic
940036134 2:149313787-149313809 CTGGCATCACATAGGAAGCCTGG + Intergenic
940961355 2:159789920-159789942 CTGGCATCAGAGAGCTGCTAAGG - Intronic
943221165 2:185108045-185108067 CTGGTATCACAGAAATACACAGG + Intergenic
944671691 2:201999517-201999539 CTGGCAGCAGAGAGCTGACCAGG + Intergenic
946196639 2:218036060-218036082 CCAGCATCACAGAGGTTCCCAGG - Intronic
946200915 2:218070227-218070249 CCAGCATCACAGAGGTACCCAGG - Intronic
947950494 2:234142933-234142955 CTGGCATCACACAAATGCCCAGG - Intergenic
948465297 2:238149200-238149222 CTGACATCAGAGAGCCAGCCTGG + Intronic
1168967391 20:1907158-1907180 CTGAGTTCTCAGAGCTACCCAGG + Intronic
1169092338 20:2868681-2868703 AAGGCATCAAAGAGCTACCAGGG - Intronic
1172142860 20:32735766-32735788 CTGTAATCCCAGAGCAACCCAGG - Intronic
1172221547 20:33277589-33277611 ATGGCATCACAATGCTTCCCTGG - Intronic
1172485629 20:35296301-35296323 CTGGCATCACTCAGCTGTCCTGG + Intergenic
1173452339 20:43175971-43175993 CTGGCAACAGAGAGAGACCCTGG + Intronic
1173452363 20:43176121-43176143 CTGGCAACAGAGAGAGACCCTGG + Intronic
1173656489 20:44703421-44703443 CTTCCATCTCTGAGCTACCCGGG - Intergenic
1173974260 20:47175183-47175205 CCTGCATCACAGAACTAGCCAGG + Intronic
1173992905 20:47316899-47316921 CTGAGATCACAAAGCTACCAAGG + Intronic
1174199055 20:48794387-48794409 CTGGGAAGACAGAGCTAACCAGG + Intronic
1174300942 20:49581779-49581801 CTGGCATCACCAAGCTGCCAGGG - Intergenic
1178694374 21:34780490-34780512 ATGGCATCACAGAGGTACCTGGG - Intergenic
1179595897 21:42443083-42443105 CTGCCATCACAGAGCCCTCCTGG + Intronic
1182741514 22:32571327-32571349 CTGACCTCCCAGAGCAACCCAGG - Intronic
1184607068 22:45580296-45580318 CAGGCAGCACAGAGCTGCACGGG - Intronic
1184675590 22:46040973-46040995 CTGGCCTCACAAAGGTGCCCAGG + Intergenic
1185116732 22:48942185-48942207 CAGGCACCACAGAGCTGACCTGG + Intergenic
1185148937 22:49153421-49153443 TCGTCATCACAGAGCTGCCCCGG + Intergenic
952993425 3:38853915-38853937 CTGCAAGCACAGAGCTGCCCTGG + Intronic
953032358 3:39187035-39187057 TTGGCAAGACAGAGCTCCCCTGG + Exonic
955812850 3:62809337-62809359 GTGACATCACAGAGGTGCCCAGG - Intronic
960294878 3:115930809-115930831 CTGACACCACAGGGCTTCCCAGG + Intronic
961006689 3:123410282-123410304 CTGCCAAGACAGAGCTGCCCTGG - Intronic
961953076 3:130770895-130770917 CTGTCATCCTAGAACTACCCTGG + Intergenic
964927934 3:161979401-161979423 CTGAGATCACAGAGATGCCCAGG + Intergenic
966830379 3:184002879-184002901 CTGGCAACAGAGAGGTACCTCGG + Intronic
966915736 3:184583365-184583387 CAGGCAGCGCAGAGCTTCCCAGG + Intronic
969509755 4:7611036-7611058 CTGGCACCACAGAACTAAGCAGG + Intronic
973974869 4:56253016-56253038 CTGTCATCCCACTGCTACCCTGG - Intronic
975545198 4:75553588-75553610 CTGGGATTACAGGGCTACTCAGG - Intergenic
978130938 4:105196426-105196448 CTGGGTTCACAGAGCTATTCAGG - Intronic
978461938 4:108965616-108965638 CTGGAATCACAGTGACACCCAGG - Intronic
980397548 4:132234081-132234103 CTGGCATCACACTGCTACCAAGG + Intergenic
983742286 4:171150453-171150475 CTGACATCACAGACTTACCAAGG - Intergenic
984445159 4:179827749-179827771 CTGCCATCAAGGTGCTACCCAGG + Intergenic
984586141 4:181566986-181567008 CTGGCCTCCCAGAGCTTACCTGG + Intergenic
985989185 5:3541205-3541227 CTGCCATCACAATGCAACCCTGG + Intergenic
986682172 5:10243897-10243919 CTGGCATCAAACAGTTAGCCAGG - Intronic
987075594 5:14379182-14379204 CTGTCATCACAGAATTGCCCTGG - Intronic
987095091 5:14542561-14542583 CTGGCAGAGCAGAACTACCCAGG - Intergenic
987182605 5:15384203-15384225 CTGGCATCCCTCAGCTACCCGGG - Intergenic
991923791 5:71683960-71683982 CTGGCATCACAGGGATCCCTTGG + Intergenic
994494446 5:100492253-100492275 CTGAAATCACAGAGCTAAGCTGG - Intergenic
999127251 5:149254750-149254772 CTGGCTTCACTGAGCTGCCCTGG - Intronic
1001953159 5:175830193-175830215 CTGCCGCCACAGAGCTGCCCTGG + Intronic
1002672033 5:180875389-180875411 CTGGCCTCACAGTGCTGTCCTGG - Intergenic
1002868820 6:1147516-1147538 CTGTCAGCACAGAGGTACCCTGG - Intergenic
1003203157 6:3981837-3981859 CTAAGATCACAGAGCTACTCAGG + Intergenic
1004530852 6:16454254-16454276 CTGCCATCAGAGAGCTGACCAGG + Intronic
1005072412 6:21874206-21874228 CTGGCATCACAGAGATCCATTGG + Intergenic
1005125915 6:22446609-22446631 TTGGAATCACAGAGTTACCTGGG - Intergenic
1005935160 6:30515595-30515617 CTGGCCTCACAGACTTGCCCAGG + Intergenic
1007482523 6:42159389-42159411 CTGGCATCCAAGAGGTGCCCAGG + Intronic
1007836561 6:44678420-44678442 CTGGCATGGCAGAGCTGCTCAGG + Intergenic
1009372264 6:62920497-62920519 ATGGCATCAGGGAGCTACCAAGG - Intergenic
1010288441 6:74107573-74107595 CTGTCACCACAGAGCAAGCCAGG - Intergenic
1010361293 6:74997518-74997540 GAGGCATCACAGAGATACCAAGG + Intergenic
1011374990 6:86678425-86678447 CTGTCCTCTCTGAGCTACCCAGG + Intergenic
1011888469 6:92127154-92127176 CCGGCAGGACAGAGCTACCTGGG + Intergenic
1013869761 6:114742866-114742888 CTGTCACCACAGAGCTAGCCTGG - Intergenic
1015826606 6:137319009-137319031 CTGGGATCTCAGACCTCCCCAGG + Intergenic
1016332433 6:142967743-142967765 TTGGCATCACAGAGATAGCTGGG + Intergenic
1016372975 6:143393442-143393464 CAGGCATCTCAGAGCTCCCAGGG + Intergenic
1017104317 6:150873790-150873812 CTGTAATCCCAGAGCTACTCAGG - Intronic
1019572095 7:1717777-1717799 CTGGCACCACAGCCCCACCCTGG - Intronic
1019712199 7:2522850-2522872 TGGGCATAACAGAGCTCCCCTGG - Intronic
1019921824 7:4168087-4168109 GTGGCTTCACAGAGATGCCCGGG - Intronic
1019947850 7:4344270-4344292 CTGGCGTCCCAGAACAACCCTGG - Intergenic
1022307311 7:29159347-29159369 CTGGCATCACAGAGCCTTCATGG + Intronic
1023288653 7:38645828-38645850 AAGGCATCAGAGAGCTACCAAGG - Intergenic
1023767541 7:43525653-43525675 CTGAGATCACTGAGCTACCTTGG - Intronic
1023926002 7:44670276-44670298 CTGGCAGAACTGTGCTACCCAGG - Intronic
1024314858 7:48006342-48006364 CTGGCATCACAGTGCTCTCCCGG + Intronic
1026564776 7:71480938-71480960 CAGGCAACACAGAGCTACAGAGG + Intronic
1026940475 7:74284936-74284958 CTGGCAGCAGAGAGCTACTATGG + Intergenic
1029238293 7:99142187-99142209 GTGGCACTACAGAGCCACCCAGG + Intronic
1030653843 7:112144578-112144600 CTGGCATCCTGGAGATACCCTGG - Intronic
1032137622 7:129295244-129295266 CTGGCTTCACAGAACCAGCCTGG - Intronic
1032472779 7:132190458-132190480 CTTGCATCTCAGAATTACCCAGG + Intronic
1032515482 7:132503419-132503441 CTGGCATCCCAGAATTCCCCAGG - Intronic
1033869291 7:145730657-145730679 CTGGCATCAGATATCTACACAGG + Intergenic
1034677595 7:152902913-152902935 CTGGCATCACCCAGCTACCCGGG - Intergenic
1038113479 8:24526061-24526083 GTGTCATCACAGAGGTAGCCTGG - Intronic
1038688082 8:29737041-29737063 CTGGCATTCCAGAGCAAACCAGG + Intergenic
1041144019 8:54853027-54853049 AAGGTATGACAGAGCTACCCAGG + Intergenic
1044567817 8:93684097-93684119 CTGACAACACAGAGCTAGCTGGG + Intergenic
1045076668 8:98576930-98576952 CTGGCACCAGTGAGCTACACCGG + Intronic
1045531728 8:102991395-102991417 CCGGGAACACAGAGCTACCAGGG - Intergenic
1047356064 8:124123407-124123429 CTGGCATCAGAGAGGCATCCTGG + Intergenic
1047512445 8:125525977-125525999 TTGGCATGACAGAATTACCCAGG + Intergenic
1047985893 8:130233285-130233307 CTGGTCTCAGAGAGCTTCCCAGG + Intronic
1049214596 8:141401957-141401979 CTGGCATCACGGGGCCCCCCTGG - Intronic
1049588193 8:143441470-143441492 CTGGCAGCACAGAGGGAGCCCGG + Intronic
1049749136 8:144275267-144275289 CTGGGACCACAGTCCTACCCTGG + Intronic
1049802324 8:144523603-144523625 CAGGCATCACAGAGCTAAAGGGG - Exonic
1057724819 9:97561041-97561063 CTGGCTTCACAGGCCTTCCCTGG - Intronic
1057953080 9:99385467-99385489 CTGAGATCCCAGAGCAACCCAGG - Intergenic
1061134348 9:128724556-128724578 CTGTCACCACAGAGCAACCTTGG - Intergenic
1186302092 X:8211439-8211461 CTTGCATCACAGAGCCAGCTTGG - Intergenic
1186591668 X:10936605-10936627 CTGGCACCAAACAGATACCCTGG + Intergenic
1187489475 X:19737385-19737407 CTGGAATCACAGAGTTACAGAGG - Intronic
1187817690 X:23250606-23250628 CTGGGATCAGTGAGCTACCGGGG + Intergenic
1189308395 X:40004313-40004335 ATGGCATCACAGGCCTCCCCTGG + Intergenic
1189443610 X:41060057-41060079 CTGGTCTCACAGATCAACCCTGG - Intergenic
1189443938 X:41063235-41063257 CTGGTCTCACAGATCAACCCTGG - Intergenic
1189540726 X:41985091-41985113 CTGGCTTCTCAGAGGGACCCAGG + Intergenic
1193403489 X:81073958-81073980 CTGGCATCACAGAGTGAGCTTGG + Intergenic
1195244877 X:102986548-102986570 CAAGCATCACAGAGCCACCATGG - Intergenic
1195524508 X:105871276-105871298 GTGGCATCACAGTGCAACCTAGG + Intronic
1196760265 X:119194578-119194600 CTGGCATCCAGGAGCTGCCCTGG + Intergenic
1198849576 X:140951995-140952017 CTGACATCAGCGAGCTATCCTGG - Intergenic
1198915984 X:141672195-141672217 CTGACATCAGAGAGCTGACCTGG - Intronic
1199137677 X:144272323-144272345 CTGGCAACACTGAGCTGCTCAGG + Intergenic