ID: 1077483029

View in Genome Browser
Species Human (GRCh38)
Location 11:2825398-2825420
Sequence GTGCCAGGGGCCCCGGGTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 480
Summary {0: 1, 1: 0, 2: 1, 3: 42, 4: 436}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077483019_1077483029 6 Left 1077483019 11:2825369-2825391 CCAGGGAAATGGGCGTTTCCTGT 0: 1
1: 0
2: 1
3: 14
4: 209
Right 1077483029 11:2825398-2825420 GTGCCAGGGGCCCCGGGTGCTGG 0: 1
1: 0
2: 1
3: 42
4: 436
1077483018_1077483029 10 Left 1077483018 11:2825365-2825387 CCTTCCAGGGAAATGGGCGTTTC 0: 1
1: 0
2: 0
3: 6
4: 102
Right 1077483029 11:2825398-2825420 GTGCCAGGGGCCCCGGGTGCTGG 0: 1
1: 0
2: 1
3: 42
4: 436
1077483013_1077483029 27 Left 1077483013 11:2825348-2825370 CCTGCTCAGCTCAGTGTCCTTCC 0: 1
1: 0
2: 2
3: 39
4: 275
Right 1077483029 11:2825398-2825420 GTGCCAGGGGCCCCGGGTGCTGG 0: 1
1: 0
2: 1
3: 42
4: 436

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077483029 Original CRISPR GTGCCAGGGGCCCCGGGTGC TGG Intronic
900087161 1:904200-904222 CTCCCAGGGGCCCGGGGTCCTGG + Intergenic
900136249 1:1118307-1118329 GTGCCTCGGGCCCGGGCTGCAGG + Intergenic
900146712 1:1161807-1161829 GAGCCAGGAGCCCCGGGCACAGG + Intergenic
900183927 1:1324391-1324413 CTGCCGGAGGCCCGGGGTGCAGG + Intronic
900360257 1:2284812-2284834 GTGCTGGGGGCCCCGGTGGCTGG + Intronic
900517978 1:3092177-3092199 GTGCCTGGGGCCCCAGGTGGTGG + Intronic
900629901 1:3628953-3628975 GTGCTATGGGTCCCGCGTGCTGG - Exonic
900683268 1:3930860-3930882 TTGCCAGCAGCCCCGGGAGCTGG + Intergenic
900782423 1:4626749-4626771 TTGCCAGCGGCCCCAGGTGCAGG + Intergenic
901103261 1:6735818-6735840 GCCCCAGGGGCCGCGGGAGCAGG + Intergenic
901629781 1:10642507-10642529 GTGCCAGGGGTCACGTGGGCAGG + Intronic
901678756 1:10901436-10901458 GTGCCAGGGCCCCTGGGGGGCGG - Intergenic
901871838 1:12142916-12142938 GTTACAGGGGCCCCGGGAGCTGG - Exonic
902067545 1:13700458-13700480 GTGCCGGGGGCCCCGGGACGAGG + Intronic
902363917 1:15958616-15958638 GTGCCAGGGGCCCTGGGATAAGG + Intronic
903028599 1:20446899-20446921 ATGCCAGGGGGCCTGGGTTCAGG + Intergenic
903538178 1:24081194-24081216 GGGCCAGGGGCCTGGGGTGCAGG + Intronic
904035992 1:27558799-27558821 GTGCAGAGGGCCCCGAGTGCGGG - Exonic
904601784 1:31676984-31677006 GTGCCAGGGGGCCTGGATGGTGG - Intronic
904699656 1:32351061-32351083 GTCAGAGGGGCCCCGAGTGCAGG - Intergenic
904767837 1:32864006-32864028 GTGCCAGGGGCCATGGGCCCAGG - Exonic
904892463 1:33789497-33789519 GAGCCAGGGGTCCCCTGTGCAGG + Intronic
905293915 1:36942288-36942310 GTGCCAGGGGCTCCTGGCTCTGG - Intronic
906959101 1:50404759-50404781 GTGCCTGTGGTCCCGGCTGCTGG - Intergenic
907388190 1:54139465-54139487 GGGCCAGGGGCCCAGGGGGAAGG + Exonic
911167768 1:94739813-94739835 GTTCCAAAGCCCCCGGGTGCTGG - Intergenic
912445012 1:109728989-109729011 GTGCCAGGGGCTCAAGGTGCGGG + Intronic
913115849 1:115696168-115696190 GTGCCTTGGGCCTTGGGTGCAGG + Exonic
913496227 1:119430569-119430591 GTGTCAGGGGCTCAAGGTGCAGG + Intergenic
915033410 1:152903070-152903092 GTGGCAGGGCCCTTGGGTGCAGG - Intergenic
915479558 1:156175603-156175625 GTGCCAGTGGCCCCATGAGCAGG + Exonic
916056121 1:161069787-161069809 GTGGCCGGGGCCCCAGGGGCAGG - Exonic
916102755 1:161406794-161406816 ATGCCAGTGCCCCTGGGTGCAGG - Intergenic
917085113 1:171297186-171297208 GTGTCAGGGGCTCAAGGTGCAGG + Intergenic
918119722 1:181528130-181528152 GTGGGAGGGGCCCGGGGTGGGGG + Intronic
920100582 1:203514689-203514711 ATGCCAGGGACTCCAGGTGCTGG + Intergenic
922279960 1:224114249-224114271 GCGCCTGGGACCCCGGCTGCGGG - Exonic
923685194 1:236148722-236148744 GTGCCAGGGGCTCGTGGTGAGGG + Intronic
924502806 1:244653005-244653027 GCGCCAGGCGCCCCGGGGGCGGG - Exonic
1063370496 10:5518814-5518836 GAGCCAGGTGCCTGGGGTGCTGG - Intergenic
1063437706 10:6048101-6048123 GGGTCAGGGGCCACGGGAGCAGG - Intronic
1066745375 10:38601664-38601686 GTGCCAGGTGCCACAGGGGCAGG + Intergenic
1067067439 10:43111929-43111951 GTGCCAGGAGCACAGGGCGCAGG - Intronic
1067080785 10:43211205-43211227 GTCCCAGGGGCCCAGCCTGCTGG + Intronic
1067083444 10:43226100-43226122 GTGCCAGGGGCCGCAGGGCCAGG + Intronic
1069729671 10:70602599-70602621 GGGCCTGGGGCCCTGGGTGGAGG - Intronic
1069984156 10:72272727-72272749 ATGCCCAGGGCCCCGGGGGCGGG - Intergenic
1070758257 10:79006724-79006746 GGGCCAGGGGCCTGGGGAGCTGG - Intergenic
1070814637 10:79315076-79315098 GTGCCCGGGGCCTGGGCTGCAGG - Exonic
1070917499 10:80164239-80164261 GTGTCAGGGGCCTCTGTTGCTGG - Intronic
1072082514 10:92045838-92045860 AGGCCAGGGCCCCTGGGTGCGGG + Intergenic
1072705181 10:97675837-97675859 GAGCCAGGGGCCCAGAATGCCGG + Exonic
1072737666 10:97889785-97889807 GGGGCAGGGGCCCTGGGGGCAGG + Intronic
1072757513 10:98030692-98030714 GAGCCGGGGGCCCGGGGTGGGGG + Exonic
1073512264 10:104050189-104050211 GTAACAGGGTCCCCGGCTGCAGG + Intronic
1074439145 10:113459725-113459747 CTCCCAGGGGCCCTGGGAGCAGG - Intergenic
1075658151 10:124175291-124175313 GTGCCAGTGGCCCCATGAGCAGG - Intergenic
1076408839 10:130231635-130231657 GTCCAAGTGGCCCCAGGTGCAGG - Intergenic
1076454170 10:130578013-130578035 TGCCCAGGGGCCCCGGGGGCTGG - Intergenic
1077026405 11:441849-441871 GGGCCGGGGGCCCCAGGTGTGGG + Intronic
1077096610 11:801725-801747 GTGCCAGGGACACAGGGAGCAGG + Intronic
1077266948 11:1655554-1655576 GTGCCAGGGCTCCCGCATGCTGG + Intergenic
1077343500 11:2036311-2036333 GTGACAGAGGCCCAGAGTGCTGG + Intergenic
1077483029 11:2825398-2825420 GTGCCAGGGGCCCCGGGTGCTGG + Intronic
1077487165 11:2844333-2844355 GTGACAGAGGCCCCGGGGGTGGG - Intronic
1078464981 11:11543557-11543579 ATGCCAGGGGCCAGGGGTGTGGG + Intronic
1079058672 11:17228858-17228880 ATGCCAGTGCCCCTGGGTGCAGG - Intronic
1081441825 11:43089342-43089364 GTGCCAGGCTCCTCGGGGGCAGG + Intergenic
1081667969 11:44927482-44927504 GTGCCAGGTGCCCAGGCTGCTGG - Intronic
1082129447 11:48470879-48470901 GTGCCAGGGTCCATGGGTACTGG + Intergenic
1082562980 11:54641773-54641795 GTGCCAGGGTCCATGGGTACTGG + Intergenic
1083430457 11:62611540-62611562 GAGCCAGCGGCTTCGGGTGCAGG - Exonic
1083667683 11:64284677-64284699 GGGCCCGGAGCCCGGGGTGCTGG - Exonic
1084007837 11:66332557-66332579 GGGCCAGGGCCCCAGGGGGCAGG + Exonic
1084204874 11:67585377-67585399 GGGCCAGGGGCCCAGGGGCCTGG + Intronic
1084272371 11:68036185-68036207 GTGACAGGGGCCCTGGGGGCTGG + Intronic
1084412564 11:69013057-69013079 GCTCCAGGGGCCCAGGGTCCAGG - Intronic
1084568418 11:69944604-69944626 GTGCCAGGGGCTCTGGGCTCTGG + Intergenic
1084599197 11:70134863-70134885 GTGGCAGGAGCTCCAGGTGCAGG + Intronic
1084607246 11:70179556-70179578 GTGCCAGGGCCCCTGGCTGGAGG - Intronic
1084783676 11:71429183-71429205 GTGCCAGAGGCCCAGGGAGGTGG + Intronic
1085400896 11:76234890-76234912 GTGCCAGGCGCCCCACGTGCTGG + Intergenic
1085402490 11:76243164-76243186 GTGCCAGGGGCAGCTGATGCAGG + Intergenic
1089494863 11:118902796-118902818 CTGCCAGGGGCCGGGGGTGGCGG + Exonic
1090094524 11:123730046-123730068 GTGACAGGGGCCCAGGCTGGGGG - Intronic
1091231987 11:133994115-133994137 GCGCCAGGGGCCTCTGGTGACGG - Intergenic
1202826486 11_KI270721v1_random:91500-91522 GTGACAGAGGCCCAGAGTGCTGG + Intergenic
1091402459 12:189215-189237 GTGCTAGGGGCCCCGGGGGAGGG + Intergenic
1091602423 12:1925772-1925794 GTGGGAGGGGCCTGGGGTGCTGG + Intergenic
1092071308 12:5633672-5633694 ATGCCAGGGGAGCCCGGTGCCGG - Intronic
1092089991 12:5796704-5796726 GAGGCAGGGGCCAGGGGTGCAGG + Intronic
1096669067 12:53187591-53187613 GCGCAAGGGGCCCCGGGTGGTGG + Exonic
1096818836 12:54218196-54218218 GAGCCAGGGGAGCCGGGTCCGGG - Intergenic
1099043231 12:77682116-77682138 GTGGCAGGGGACCAGGGTGTGGG - Intergenic
1103107948 12:118246672-118246694 ATGCCAGTGCCCCTGGGTGCAGG - Intronic
1103856548 12:123973817-123973839 GCGCCAGGGGACCGGGGAGCCGG + Exonic
1104043124 12:125143519-125143541 GTGGAGGGGGCCCAGGGTGCTGG - Intergenic
1104768141 12:131343854-131343876 GTGGCAGGTGCCCCAGGGGCAGG + Intergenic
1104896907 12:132169101-132169123 GTGCCAGGGGCCCCTGGTCCTGG + Intergenic
1104989777 12:132618990-132619012 GTGCGCGGGGCGCGGGGTGCGGG + Intronic
1105332547 13:19431768-19431790 GTGCCATGGGGCCAGGATGCTGG - Intronic
1105879138 13:24588009-24588031 GTGCCATGGGGCCAGGATGCTGG + Intergenic
1105920699 13:24961043-24961065 GTGCCATGGGGCCAGGATGCTGG - Intergenic
1107467534 13:40664786-40664808 GTGGGAGGGGCCCCGGGCGCAGG - Intronic
1113636138 13:111920369-111920391 GTGCCAGGGCCTCGGGGGGCCGG - Intergenic
1113673679 13:112194120-112194142 CTGCCAGGGGCCCAGGGCTCTGG - Intergenic
1113789655 13:113021641-113021663 GTGCCATTGGCCCCGGGTCCTGG + Intronic
1113820456 13:113209290-113209312 GTGCCCGGAGCCCTGGGGGCAGG + Intronic
1113875971 13:113594605-113594627 GTGACAGGTGTCCCGTGTGCTGG + Intronic
1114281166 14:21193308-21193330 GGGCCAGCAGCTCCGGGTGCTGG - Intergenic
1114349089 14:21830109-21830131 GTGTCAAGGGTCCCGGCTGCAGG - Intergenic
1114359158 14:21950691-21950713 GTGTCAAGGGTCCCGGATGCAGG - Intergenic
1116054460 14:39846053-39846075 GTGCCAGGGCACACAGGTGCAGG - Intergenic
1118763293 14:68893785-68893807 GTACCAGGTGCCCCTGCTGCTGG - Intronic
1119403124 14:74377994-74378016 ATGCCAGTGCCCCTGGGTGCAGG + Intergenic
1119845658 14:77827755-77827777 GTGCCAGGGGACCTGGCTCCAGG - Intronic
1121253679 14:92516667-92516689 GTGCAAGGGGCTGGGGGTGCAGG + Intronic
1121781965 14:96627804-96627826 GGGCCAGGCACCCCAGGTGCAGG + Intergenic
1122066044 14:99175097-99175119 GTGCCCGGGGTCCCGGGCGCGGG - Exonic
1122226851 14:100285430-100285452 GTGCCAGCGGGCCCCGGGGCTGG + Intergenic
1122609762 14:102973852-102973874 GTGGCAGGGGCCCCGGGGCCAGG + Intronic
1122866163 14:104604924-104604946 GGGCCAGGAGCCCGGGGTCCAGG + Exonic
1122912177 14:104836265-104836287 ATGCCAGTGCCCCCGTGTGCAGG + Intergenic
1122924531 14:104893485-104893507 CTGCCTGGGGCCCACGGTGCCGG + Intronic
1122970731 14:105151154-105151176 GTGCCAGGTGCCCGTGCTGCAGG - Intronic
1123040485 14:105488280-105488302 GTGGCAGGGGCCAGGGGTGATGG + Intronic
1123115830 14:105893657-105893679 GTGCCAGGGGCCCCCAGGACTGG + Intergenic
1123120072 14:105912372-105912394 GTGCCAGGGGCCCCCAGGACTGG + Intergenic
1123402810 15:20003958-20003980 GTGCCAGGGGCCCCCAGGACTGG + Intergenic
1123512147 15:21010612-21010634 GTGCCAGGGGCCCCCAGGACTGG + Intergenic
1123977692 15:25568571-25568593 GTGCCAGGGTCCCAGGGTCAGGG - Intergenic
1128579211 15:68797167-68797189 CCCCCAGAGGCCCCGGGTGCTGG + Intronic
1130295759 15:82646564-82646586 GTGCAAGGGGCCAGGGCTGCAGG + Intronic
1132145195 15:99425396-99425418 ATGACAGGGGCCTCGGGTGGAGG + Intergenic
1132235839 15:100220678-100220700 GTGCCAGGGGCTCGGGGAGGAGG - Intronic
1132321870 15:100931278-100931300 GTGCCACGGCCCCTGGGTGCTGG - Intronic
1132518444 16:376656-376678 GGGCCAGGGGGCACCGGTGCAGG + Exonic
1132620760 16:867407-867429 GTGCCTGGGGACCCTGGAGCTGG - Intronic
1132654753 16:1037098-1037120 GGGCCAGGAGCCCCGTGTGTGGG + Intergenic
1132664009 16:1073438-1073460 GTCACAGGGCCCCTGGGTGCTGG - Intergenic
1132837670 16:1962595-1962617 ATGCCAGTGCCCCTGGGTGCAGG + Exonic
1132889333 16:2196312-2196334 GTGCCGGGGGCGCGGGGCGCGGG - Intronic
1133221692 16:4321665-4321687 GTGCCAGGGGCCGTGGGAACTGG + Intronic
1133277979 16:4649450-4649472 GTGCCTGGGGCCCCAGGAGTGGG - Intronic
1133286260 16:4692227-4692249 GTCCCACGGGCCCTGGGCGCTGG + Intergenic
1134097114 16:11425177-11425199 GTGCCGGGGGCCCCAGGAGCAGG + Exonic
1134648256 16:15888264-15888286 GAGCCAGGGGCCCAAGATGCAGG + Intronic
1136069290 16:27778432-27778454 GTGCCAGGCGCCCCGAGAGCAGG + Intronic
1136418684 16:30118630-30118652 GTCCCAGGGGCCCTGGCTGGAGG - Intronic
1136737698 16:32477985-32478007 GTGCCAGGTGCCACAGGGGCAGG - Intergenic
1137673239 16:50291443-50291465 GTGGCAGGGGCACCAGGTGGGGG + Intronic
1138142212 16:54578521-54578543 GTGCCAGGGGACCCCAATGCCGG + Intergenic
1138235415 16:55378069-55378091 GGGTCAGGGGCCCCGGCTGGGGG + Intergenic
1138659613 16:58509488-58509510 GTGACCTGGGCCCCGGATGCTGG + Intronic
1139051473 16:63129736-63129758 CTGCCTGGGGCCCGCGGTGCTGG - Intergenic
1139908422 16:70381818-70381840 GTGCCAGTTGCCCCGGCTGTCGG + Exonic
1140406767 16:74716631-74716653 CAGCCAGGGGCCCCGGCAGCTGG + Intronic
1141739620 16:85882406-85882428 GTGGCAGGGGCCGGGGGTGGGGG - Intergenic
1141810304 16:86371485-86371507 GTGCCACGTGCCCCGGGTCCTGG - Intergenic
1142245448 16:88968203-88968225 CTGCCAGGGGCCCTGGCCGCAGG + Intronic
1203015373 16_KI270728v1_random:351592-351614 GTGCCAGGTGCCACAGGGGCAGG + Intergenic
1203033708 16_KI270728v1_random:624750-624772 GTGCCAGGTGCCACAGGGGCAGG + Intergenic
1142499573 17:324608-324630 GAGACAGGGGCCCCAGGTGAAGG - Intronic
1143100696 17:4503205-4503227 GTCCCAGGAGCCCCAGGTGGAGG + Intronic
1144464095 17:15482651-15482673 GTGACAGATGCCCCAGGTGCCGG - Intronic
1144812806 17:18011536-18011558 ATGCCAGTGCCCCTGGGTGCAGG - Intronic
1144847055 17:18225574-18225596 GCGCCAGGCGGCCCGGGCGCGGG - Exonic
1145022912 17:19446241-19446263 ATGCCAGTGCCCCTGGGTGCAGG + Intergenic
1145779241 17:27551316-27551338 GTGCCAGGTGCCAGGGGTGCAGG + Intronic
1146591056 17:34128310-34128332 TTCCCAGGGACCCCAGGTGCAGG + Intronic
1146736550 17:35243339-35243361 GTGGCAGAGGACCCGGGAGCTGG + Intronic
1146894815 17:36533829-36533851 GTGCCAGGGGCCTTGGGTTTTGG - Intronic
1147198579 17:38784075-38784097 CTGCAAGGGGCCCCCAGTGCTGG + Intronic
1147341604 17:39755899-39755921 GGGCCAGGGGGCCAGGGTACTGG + Intergenic
1147449341 17:40494098-40494120 GTGCCAGAGGGCCTGGGTGCTGG + Intronic
1147614935 17:41822148-41822170 GGGGCAGGGGCCCCGGGTGGAGG - Intronic
1147805329 17:43126922-43126944 CTGCCCGGGGCCGGGGGTGCGGG - Intergenic
1147898893 17:43770680-43770702 GTGGCAGAGGCCCTGGGAGCTGG + Intronic
1147943480 17:44066509-44066531 GTGCCAGGAGCAGCGGCTGCAGG - Exonic
1148186276 17:45646540-45646562 GAGCACTGGGCCCCGGGTGCGGG + Intergenic
1148871692 17:50662232-50662254 GTGCCAGGCAACCTGGGTGCTGG + Intronic
1148875292 17:50683603-50683625 CTGCCAGGCGCCCTGGGTGGTGG + Exonic
1149166281 17:53757260-53757282 ATGCCAGTGCCCCTGGGTGCAGG + Intergenic
1149657744 17:58319189-58319211 GATCCAAGGGGCCCGGGTGCAGG + Exonic
1152135344 17:78500152-78500174 GTGCCAGGGCCCCCACTTGCTGG - Intronic
1152543127 17:80987054-80987076 CTGCCAGTGGCTCCGTGTGCGGG + Intergenic
1152563240 17:81089066-81089088 CTGCCGTGGGCCCCGGGTGGTGG + Intronic
1152628501 17:81399330-81399352 GCGCGCGGGGCCCCGGGTGCTGG + Intronic
1152893585 17:82896806-82896828 GTGCCACGCGCCCCCGGTGCTGG + Intronic
1154295020 18:13140064-13140086 GCTCCAGGGGCCCTGGGTCCAGG + Intergenic
1155219564 18:23671905-23671927 TTGCCAGGGCCCCAGGGTGTTGG - Intergenic
1155848355 18:30737334-30737356 GAGCCAGGGGCACCAAGTGCAGG + Intergenic
1156337912 18:36186705-36186727 GTCCCAGGTGCTCTGGGTGCAGG + Intergenic
1156475105 18:37400996-37401018 CTGGCAGGGGCCCTGGGGGCTGG + Intronic
1157488130 18:48103917-48103939 TTGCCAGGGGTCGAGGGTGCAGG + Intronic
1158709439 18:59824342-59824364 GTGCCAGGAGCCACCTGTGCTGG + Intergenic
1160598404 18:79993888-79993910 GTGTCAGGGGCTCCAGGTGTGGG - Intronic
1160986405 19:1840965-1840987 GTGCCTGGAGCCCGGGGTTCTGG - Intronic
1161401440 19:4067496-4067518 GCGCCAGGGACCCCGGGGGGTGG + Intergenic
1161405956 19:4091157-4091179 TTGCCAGGGTCCCCCGGAGCAGG + Intronic
1161894422 19:7069595-7069617 GTGTCAGGACCCCCGGGTTCAGG - Exonic
1161933533 19:7356959-7356981 GTGCCAGGGGACCCAAGGGCTGG + Intronic
1162659766 19:12159876-12159898 GTGCCACGGGCCCCGCCTTCTGG - Intergenic
1162668708 19:12237278-12237300 ATGCCCGGGGTCCCGGCTGCTGG + Intronic
1162674049 19:12284892-12284914 ATGCCAGTGTCCCTGGGTGCGGG - Intronic
1162935161 19:13978474-13978496 GAGCCTGGGGCCCCGGTTGGTGG + Intronic
1163035628 19:14567320-14567342 CTGCCTGGAGCCCCAGGTGCAGG - Intronic
1163111118 19:15161387-15161409 GCCGCAGGGGCCCCGGGGGCGGG - Exonic
1163124886 19:15239438-15239460 TTGTCAGGGGCCCCTGGTGGCGG + Exonic
1163313587 19:16528155-16528177 TGGCCCGGGGCCCCGGGGGCCGG + Exonic
1163358311 19:16829455-16829477 GTGCCGGCGGCCCCGCGGGCCGG + Exonic
1163361809 19:16851561-16851583 TTGCTGGGGGCCCCGCGTGCAGG - Intronic
1163390497 19:17027211-17027233 GACCCAGGGGCCCCTGGTGAGGG - Intergenic
1163468785 19:17485048-17485070 GAGCCAGGGGCGCAGGGTGGTGG + Intronic
1163694829 19:18758858-18758880 GTGGCAGGGGTTCCGGGGGCAGG - Intronic
1163762779 19:19146317-19146339 CTGCCAGGGGGCCAGGGTGGGGG + Exonic
1164721721 19:30437530-30437552 CAGGCAGGGGCCCCGGGTGAAGG - Intronic
1165300201 19:34963825-34963847 GCGCAAGGGGCCCGGGGCGCAGG + Exonic
1165418045 19:35706986-35707008 GTGGTGGGGGCCCGGGGTGCTGG + Intronic
1165907646 19:39203609-39203631 GTCCCAGGGGCCTGGGCTGCAGG + Intronic
1166112221 19:40629582-40629604 GCGGCAGGGGCCCCGAGTGGCGG - Exonic
1166329513 19:42070001-42070023 GTCCCAGGGGCTCCCGGTGCTGG + Intronic
1166689107 19:44812273-44812295 CTCCCAGGGGCGCCTGGTGCTGG + Exonic
1167115725 19:47488115-47488137 GCGCCAGAGGCCCAGGCTGCTGG - Exonic
1167148516 19:47696105-47696127 GAGGCAGGGGCACTGGGTGCTGG + Intronic
1167554816 19:50187998-50188020 GGGCCAGGAGCCCGGAGTGCAGG + Intergenic
1167612681 19:50514947-50514969 GAGCCAGGAGCCCCCGGTGTGGG + Intergenic
1167732752 19:51270897-51270919 GTGATAGGGGCCTCGCGTGCAGG + Intergenic
925070019 2:959531-959553 GTGCTAGGGTCGCCTGGTGCAGG + Intronic
925134212 2:1515174-1515196 GTGCCTGGGGCTGGGGGTGCGGG - Intronic
925171424 2:1752296-1752318 CTGCCAGGGGCCATGGCTGCAGG + Intergenic
925293044 2:2761214-2761236 GTGGCAGGGGCCTGTGGTGCAGG + Intergenic
925307819 2:2862481-2862503 ATCCCATGGGCCCTGGGTGCAGG - Intergenic
925307833 2:2862526-2862548 ATCCCATGGGCCCTGGGTGCAGG - Intergenic
925336647 2:3103270-3103292 GTGCCTGGGGCACCAGGTGAAGG + Intergenic
926107768 2:10163002-10163024 GGGCCCGGGGCCCTGCGTGCAGG - Intronic
926197902 2:10774683-10774705 CTGCCATGGACCCCAGGTGCAGG + Intronic
926681016 2:15664453-15664475 GTGCCGGGGGCCTCAGGAGCTGG - Intergenic
927089425 2:19699294-19699316 GAGCCAGGGGTCCCAGATGCAGG + Intergenic
927863742 2:26576084-26576106 CAGCCAGCGGTCCCGGGTGCTGG - Exonic
928252795 2:29696626-29696648 GTGACAGGGGCCACTGGTTCTGG - Intronic
929548623 2:42874996-42875018 GAGACAGGGCCCCCAGGTGCTGG + Intergenic
933659588 2:84916372-84916394 ATGCCAGTGCCCCTGGGTGCAGG - Intergenic
933729467 2:85446132-85446154 GTGCAAGAGGCTCTGGGTGCTGG - Intergenic
934176768 2:89584259-89584281 GTGCTAGAGGCCCCGGGGGGAGG - Intergenic
934188822 2:89767098-89767120 GTGCCAGGTGCCACAGGTGCAGG - Intergenic
934287074 2:91658619-91658641 GTGCTAGAGGCCCCGGGGGGAGG - Intergenic
934307774 2:91840855-91840877 GTGCCAGGTGCCACAGGGGCAGG + Intergenic
934775451 2:96934325-96934347 GAGCAAGGAGCCCAGGGTGCTGG + Intronic
935250064 2:101253092-101253114 GAGCAAGCGGCCCCGGGTCCGGG + Exonic
935625695 2:105170684-105170706 GTGTCATGGGCCGGGGGTGCTGG + Intergenic
936050061 2:109215934-109215956 GTGCCAGCGGCCACGTGAGCTGG + Intronic
936066598 2:109337299-109337321 CTGCCGGGAGCCCTGGGTGCAGG + Intronic
936392525 2:112088019-112088041 GAGCCTGGGCCCCCGGGGGCCGG - Intronic
936537587 2:113324119-113324141 GCTCCTGGGGCCCCGGGTGGGGG - Intergenic
937340742 2:121088967-121088989 AGGCCAGAGGCCCCCGGTGCAGG + Intergenic
940855142 2:158723669-158723691 GTGCCTGGGGCCACTGGGGCAGG - Intergenic
941815290 2:169789979-169790001 CTGGCAGGGGTCCCTGGTGCGGG + Intergenic
946308791 2:218871582-218871604 CTGCCAGGCGCCCCGCGGGCGGG + Exonic
946395446 2:219441906-219441928 GAGCCTGGGGCCTCGGGAGCCGG - Intronic
946530277 2:220563289-220563311 TTGCCAGGGGCTTGGGGTGCAGG + Intergenic
947914227 2:233821377-233821399 GTGCCTGGGGGCCTGGGGGCAGG - Intronic
948402692 2:237694985-237695007 GGGCCAGGGTCCCCAGGTGTGGG + Intronic
948746098 2:240095496-240095518 GGTGCAGGGGTCCCGGGTGCAGG + Intergenic
948746117 2:240095556-240095578 GGTGCAGGGGCCCCTGGTGCAGG + Intergenic
948746131 2:240095601-240095623 GGTTCAGGGGCCCCGGGTGCAGG + Intergenic
948746158 2:240095690-240095712 GGTTCAGGGGCCCCAGGTGCAGG + Intergenic
948746173 2:240095735-240095757 GGTGCAGGGGCCACGGGTGCAGG + Intergenic
948823107 2:240560372-240560394 GTGCCACAGGCCGCGGGGGCGGG + Exonic
948824617 2:240568334-240568356 GAGCCAGGGGCGCGGGGAGCCGG - Intronic
948858312 2:240740865-240740887 GTTCCAGGGCCCCAGGGTGGAGG - Intronic
949013756 2:241697661-241697683 TTGCCAGGGGCCTCGGGAGGGGG + Intergenic
949036678 2:241818686-241818708 CTGTCAGGGGCCCCGGATCCAGG - Intergenic
949044237 2:241863635-241863657 GTGAGATGGGCCCCGTGTGCTGG + Intergenic
1170571842 20:17637083-17637105 GTCCCAGGGGCCCTGGATGTTGG - Intronic
1171428411 20:25063254-25063276 GTGACAGGGGCCACTGGTTCTGG + Intergenic
1172278428 20:33693969-33693991 ATGCCAGGGGCCCAGTGGGCAGG + Intergenic
1172336781 20:34122998-34123020 ATGCCAGTGCCCCTGGGTGCAGG - Intergenic
1172869953 20:38129747-38129769 GTCCCAAGGGCCCCTGGAGCTGG + Exonic
1173338337 20:42131413-42131435 GTGCTATGGGCCCCAGGGGCAGG - Intronic
1173660753 20:44731842-44731864 GTGCCAAGGGCCCCAGGAACAGG - Intergenic
1173768919 20:45640760-45640782 ATGCCAGTGCCCCTGGGTGCAGG + Intergenic
1173795539 20:45857106-45857128 GAGCCAGGGGCCCCGGGCGGCGG + Intronic
1173972107 20:47161117-47161139 ATGCCAGTGCCCCTGGGTGCAGG + Intronic
1174204256 20:48827781-48827803 GCGCCAGGGGCCCGGGGGTCCGG + Exonic
1175100330 20:56574772-56574794 GTTCCAGGGCCCAAGGGTGCAGG + Intergenic
1175309658 20:58003001-58003023 TTGCCAGGAGCTCTGGGTGCTGG + Intergenic
1175404764 20:58718860-58718882 CTGTCAGGGGCCTCGGGTCCTGG - Intronic
1175419663 20:58823302-58823324 GTTCCAGTGGCCCCGTGTTCAGG - Intergenic
1175574675 20:60052101-60052123 TTGCCAGGGGCCCTGAGTGTCGG + Intergenic
1175813364 20:61870621-61870643 ATGCCGGGGGCCACGGGTGGAGG + Intronic
1175813576 20:61872136-61872158 GTGCCAGAAGCCCAGGGTGCGGG - Intronic
1175899645 20:62354944-62354966 GTGCGAGGAGGCCCGGGTGCCGG + Intronic
1175972606 20:62694309-62694331 GTCCGGGAGGCCCCGGGTGCAGG + Intergenic
1176292708 21:5054746-5054768 GTGCCAGTGGACACGGGTGCAGG + Intergenic
1176292715 21:5054778-5054800 GTGCCAGTGGACATGGGTGCAGG + Intergenic
1176384569 21:6132448-6132470 GTGCCAGCCGCCCCGGGGTCAGG + Intergenic
1176740474 21:10596769-10596791 GTGCCATGGGGCCAGGATGCTGG + Intronic
1179738903 21:43405804-43405826 GTGCCAGCCGCCCCGGGGTCAGG - Intergenic
1179864545 21:44208872-44208894 GTGCCAGTGGACATGGGTGCAGG - Intergenic
1179864552 21:44208904-44208926 GTGCCAGTGGACACGGGTGCAGG - Intergenic
1179873907 21:44257860-44257882 GTGCCAGCAGCCCCAGGAGCTGG - Intronic
1180043325 21:45291700-45291722 GTGCCATGGGTCCCCGGTGGGGG - Intergenic
1180132417 21:45835195-45835217 CTGCCCTGGGCCCCGGGGGCGGG + Intronic
1180161149 21:45999255-45999277 GTGCCTGGGACGCCGGATGCTGG + Intronic
1180534855 22:16387937-16387959 GTGCCAGGTGCCACAGGGGCAGG + Intergenic
1180800853 22:18631196-18631218 GTGCCAGGGGCAGCTGGAGCTGG + Intergenic
1180852086 22:19026753-19026775 GTGCCAGGGGCAGCTGGAGCTGG + Intergenic
1180929361 22:19578525-19578547 GTGCCTGGGGTCCCAGCTGCTGG + Intergenic
1181220864 22:21364066-21364088 GTGCCAGGGGCAGCTGGAGCTGG - Intergenic
1181311599 22:21947731-21947753 GTGGCAGGGGCCTGAGGTGCAGG + Intronic
1181681706 22:24499957-24499979 GTGCCAGGGCCCAAGGGAGCTGG - Intronic
1182445529 22:30387344-30387366 GGGCCAGGGGTCCCGGGCGCGGG + Exonic
1183201288 22:36387394-36387416 GTCCCAGGGGCCGCGGCTCCCGG + Intronic
1183301525 22:37061318-37061340 GGGCCAGGGGGCCTGGGTGGAGG - Intronic
1184380531 22:44142593-44142615 GTGGCAGGGGCTCCGGGGCCAGG - Intronic
1185171124 22:49295234-49295256 GTTCCAGGGCCCCCCGGAGCTGG - Intergenic
1185329682 22:50246595-50246617 GTGCCTGGGCCCCAGGGTGACGG - Intronic
1185351505 22:50342108-50342130 GGGCCAGGGGCACCAGATGCAGG - Intergenic
1185409587 22:50674781-50674803 GGGCCGGGGGTCCCGGGCGCCGG - Intergenic
950165106 3:10791391-10791413 GTGAAGGGGGCTCCGGGTGCTGG + Intergenic
950660154 3:14462106-14462128 CTGCCAGGGGCCTCTGGTGGTGG - Intronic
953173062 3:40525032-40525054 GTGCCAGGTCCGCCCGGTGCCGG + Exonic
953893813 3:46778200-46778222 TTGCCAGGGGCCGAGGGTGGGGG + Intronic
954083156 3:48224234-48224256 GTGCGACGGGCACTGGGTGCTGG - Intronic
954291962 3:49654522-49654544 GTGCCAGGGGTCCTGGGGCCTGG - Exonic
954306059 3:49726094-49726116 GTGGTATGGGCCCTGGGTGCAGG - Exonic
961281210 3:125766848-125766870 GTGCCAGGGGCGCGGGGTAGGGG + Intergenic
961459156 3:127039327-127039349 GTGCCACGGGCCACGGGCCCTGG - Intergenic
961661163 3:128469519-128469541 ATGCCAGGGGGGCTGGGTGCTGG - Intergenic
962342781 3:134599007-134599029 CTGCCAGGGGCTCCAGGGGCAGG + Intronic
968554029 4:1238287-1238309 CCACCAGGGGCCGCGGGTGCAGG + Exonic
968645690 4:1739601-1739623 GCTCCAGGGACCTCGGGTGCGGG + Intronic
968669503 4:1841466-1841488 GTCCCTGGGGCAGCGGGTGCTGG - Exonic
968815250 4:2818453-2818475 GGTCCAGGGGCTCGGGGTGCGGG - Intronic
968972308 4:3802417-3802439 GTCCCAGGAGCCCCAGGTGAAGG + Intergenic
969322928 4:6424023-6424045 CTGCCAGGGTCCCCGGCTGGAGG + Intronic
969471714 4:7392973-7392995 GGGCCAGGGAGCCAGGGTGCTGG - Intronic
969682229 4:8649754-8649776 CTGCCCGGGGCCCCCGGGGCCGG + Intergenic
969691234 4:8705340-8705362 GGCACTGGGGCCCCGGGTGCTGG + Intergenic
969714589 4:8862071-8862093 GCGCCAGGTGCCCTGGGTGGGGG + Intronic
971449673 4:26788161-26788183 ATCCCAGGGGCCCTGGGTTCAGG + Intergenic
972663382 4:41140583-41140605 GTACCAGGGGCCCCTGGTGTAGG - Intronic
972666745 4:41172215-41172237 GTGCCTGGGGCGGGGGGTGCTGG - Intronic
972879898 4:43410313-43410335 ATGCCAGTGCCCCTGGGTGCAGG + Intergenic
975372734 4:73607336-73607358 GTGAAAGGTGCCCAGGGTGCTGG - Intronic
976743341 4:88379123-88379145 GAGCGGGGGGCCCCAGGTGCAGG + Intronic
978503582 4:109433957-109433979 GCGCCCGCGGGCCCGGGTGCGGG + Exonic
981316923 4:143349546-143349568 ATGCCAGTGCCCCTGGGTGCAGG + Intronic
983334897 4:166379054-166379076 GAGCCTGGTGCCCCGGGAGCTGG + Intergenic
985511777 5:317734-317756 GGGCCAGGGGCCCCAGGTGAGGG - Intronic
985696660 5:1344848-1344870 GGGCCGGGGGCGCCGGGCGCGGG - Exonic
985782389 5:1878115-1878137 GTCCCAGAGGCCCGGGGTCCAGG + Exonic
985797491 5:1973822-1973844 ATCCCTGGGGCCCCAGGTGCTGG + Intergenic
985830210 5:2222466-2222488 GTGCCAGGTGCCCCGGGCCTGGG - Intergenic
986132486 5:4943781-4943803 CTGCCTGGGGCCCAGGCTGCCGG + Intergenic
986625901 5:9723630-9723652 GTGCCAGGGCACTTGGGTGCAGG + Intergenic
987132416 5:14871870-14871892 CCGCCAGCGGCCCCGGGGGCGGG + Intergenic
988942254 5:36158440-36158462 ATCCTAGGGGCCCCGGGTGGGGG - Intronic
989165630 5:38431188-38431210 GTGCCAGTTGCCCAGGGTGAGGG - Exonic
989229936 5:39074274-39074296 GTGCCAGGGGTGGCGGGCGCCGG + Intronic
991839970 5:70790549-70790571 GTGGCAGGGGCCCTGGGTTTTGG + Intergenic
997351846 5:133236579-133236601 ATGCCAGGGACCCCGGCTTCCGG + Intronic
997398353 5:133582277-133582299 GTGCCGGGGGTCTGGGGTGCAGG - Intronic
997419167 5:133752278-133752300 GAGCCAGGGGCCCATAGTGCTGG - Intergenic
997465799 5:134087347-134087369 GAGCCAGGAGGCCTGGGTGCTGG + Intergenic
999062845 5:148654245-148654267 GGGCCAGGGGCTGCGGGCGCAGG + Intronic
999693468 5:154168448-154168470 GTGCCAGGAGCCAGGGCTGCGGG - Intronic
999714121 5:154345453-154345475 TTTCCAGGGGCTCCGGGTGGGGG - Intronic
1000041203 5:157486456-157486478 CTGGCAGGAGTCCCGGGTGCAGG - Intronic
1002720932 5:181261218-181261240 GTGCCGGGGGCCGCGCGGGCCGG + Intergenic
1002991765 6:2245375-2245397 GTCCCCGGAGCCCCGGGCGCTGG + Exonic
1004071281 6:12300285-12300307 GGGTCAGGGGTCCCGGGTTCTGG - Intergenic
1004516885 6:16328137-16328159 GTGGCCGGGGCCACGGGGGCGGG - Exonic
1006030010 6:31171498-31171520 GTGCCAGGCACCCAGGCTGCGGG - Intronic
1006442922 6:34063255-34063277 CTGCCAGGGGCTCAGAGTGCCGG + Intronic
1006744227 6:36330279-36330301 CTTCCAGGGGCTCCGGATGCTGG + Exonic
1007406715 6:41639648-41639670 GGGCCAGGGGAACCGCGTGCAGG + Intronic
1007669372 6:43539093-43539115 ATGCCAGTGCCCCTGGGTGCAGG + Intronic
1008545136 6:52577148-52577170 GGGCCAGGCGCGCCGAGTGCGGG - Intergenic
1011640509 6:89412475-89412497 GTCCCGGGGGCCCCGTGTACGGG - Intergenic
1013514793 6:110875568-110875590 GCGGCAGGGGCCCCAGGTGGGGG + Intronic
1015926032 6:138311442-138311464 GTGGACGGGGCTCCGGGTGCTGG - Exonic
1017303634 6:152891396-152891418 GTGCCAGGGAACCCAGGAGCAGG + Intergenic
1018583977 6:165335534-165335556 GAGCCAGGGGCCCCTCTTGCAGG + Intronic
1018769364 6:166957472-166957494 GTGGGCGGGGCCGCGGGTGCAGG - Intergenic
1018810572 6:167295196-167295218 GTTCCCGGGGCCTGGGGTGCAGG - Intronic
1019173453 6:170147673-170147695 TTGCCAGGGGCTCCCTGTGCTGG - Intergenic
1019358030 7:591160-591182 CTGCCAGGGGCCCCCGGGGGAGG + Intronic
1019416915 7:932042-932064 CTGCCTGGGGGCCGGGGTGCAGG + Intronic
1019475423 7:1241825-1241847 GGGCGAGGGGCGCCGGGCGCGGG - Intergenic
1019475624 7:1242772-1242794 CGGCCTGGGGCCACGGGTGCCGG + Intergenic
1019606364 7:1912153-1912175 GCGGCAGGGGCCCTGCGTGCGGG + Intronic
1019616570 7:1965619-1965641 GAGGCAGGGGCCACGGGGGCCGG - Intronic
1019786117 7:2978611-2978633 GTGGCGCGGGCACCGGGTGCAGG + Intronic
1019812542 7:3175202-3175224 GAGGCAGGGGCCCCGGGAGGTGG - Intergenic
1022739665 7:33109158-33109180 AAGCCAGGGGCCCGGGGCGCGGG - Intronic
1023034154 7:36116138-36116160 TCTCCAGGGGCCCAGGGTGCCGG + Intergenic
1024520866 7:50303791-50303813 CGACCAGCGGCCCCGGGTGCAGG + Intergenic
1027227119 7:76250909-76250931 CTGCCAGGGGCCCTGGGTGGGGG - Intronic
1030278334 7:107743751-107743773 GTGCGCGGGGCCCCCGGAGCCGG - Exonic
1030566581 7:111165083-111165105 TTGCCAGGGGCCCCGGATGTGGG - Intronic
1031016385 7:116580820-116580842 GTGTCAGGGGCCCAGGGAGCAGG - Intergenic
1032090811 7:128910619-128910641 GCGCCAGGGCCCCGAGGTGCAGG + Exonic
1033654584 7:143363829-143363851 GGGCCAGGGGTCCCTGGTGTGGG + Intergenic
1033657122 7:143381713-143381735 GCGCGCTGGGCCCCGGGTGCCGG - Exonic
1034513334 7:151553697-151553719 GAGCTAGGGGGCCTGGGTGCAGG + Intergenic
1034838444 7:154373791-154373813 GTGCCAGGGGCTGCGGGAGGAGG - Intronic
1034942222 7:155237884-155237906 GTGCCTCAGGCCCCAGGTGCTGG - Intergenic
1034997080 7:155584342-155584364 CAGCCAGGGGCCCCTCGTGCAGG - Intergenic
1035373946 7:158395476-158395498 GGGCCAGGGGCGAGGGGTGCGGG + Intronic
1035637228 8:1156105-1156127 GTTTCAGGGGCCGCAGGTGCAGG + Intergenic
1036830156 8:12014779-12014801 GTGCCAGGGGCGCGGGGTAGGGG - Intronic
1037587595 8:20288686-20288708 GTGCCAGGGGCCCCAGTGGTGGG - Intronic
1037776662 8:21840217-21840239 GTGCCAGGGGCCCTAGGGGTAGG - Intergenic
1037838608 8:22228843-22228865 GTGCCAGGGCCCTCGGATTCAGG + Intronic
1038331056 8:26609766-26609788 GTGGCAGGGACCCTGGGGGCTGG - Intronic
1038421662 8:27437693-27437715 GAGCCAGGGGACCAGGGTGCTGG - Intronic
1038662159 8:29506677-29506699 GTCCCAGGGGCCTGGGGTGATGG + Intergenic
1039238171 8:35525685-35525707 GTGCCAGGAGCAGCGGCTGCAGG - Intronic
1040027683 8:42796706-42796728 GTGCCTGGGGCCAGTGGTGCTGG - Intergenic
1042948774 8:74179794-74179816 GGGCCAGCGGCTCCGAGTGCGGG + Intergenic
1043284394 8:78511618-78511640 GAGCCAGAGGCCCTGTGTGCTGG - Intergenic
1046046534 8:108972343-108972365 GTGCAAGGGGGCCCTGCTGCTGG + Intergenic
1049222286 8:141433586-141433608 CTGCCAGGGTCCCAGGGTCCTGG - Intergenic
1049253340 8:141601022-141601044 GGGCCAGGGGTCACTGGTGCAGG - Intergenic
1049253351 8:141601052-141601074 GGGCCAGGGGTCACTGGTGCAGG - Intergenic
1049253362 8:141601082-141601104 GGGCCAGGGGTCACTGGTGCAGG - Intergenic
1049253378 8:141601142-141601164 GGGCCAGAGGTCACGGGTGCAGG - Intergenic
1049353671 8:142177399-142177421 GGGACAGGGGCCCGGGGCGCTGG + Intergenic
1049412783 8:142480890-142480912 CAGGCAGGGGCCCAGGGTGCTGG + Intronic
1049419863 8:142511689-142511711 CTGGCAGGGGCCCTGGGTGCTGG + Intronic
1049424196 8:142530807-142530829 GAGGCAGGTGCCCGGGGTGCGGG - Intronic
1049530123 8:143149990-143150012 GTGCCAGGAGCCAAGGGTGACGG + Intergenic
1049591149 8:143463330-143463352 GTCCCAGAGCCGCCGGGTGCTGG + Intronic
1049761433 8:144333669-144333691 GGGCCAGGGGCCGCAGGTGCTGG - Exonic
1049762315 8:144336986-144337008 GGGACAGGGGCTCCGGGGGCGGG + Intergenic
1049820016 8:144627834-144627856 GGGCAAGGGGTCCAGGGTGCAGG - Intergenic
1049936610 9:505556-505578 GTTCCACGGGACCCGGGTGAAGG - Intronic
1050367333 9:4884637-4884659 GTGGCAGGGCCCACGGGTCCTGG - Intronic
1052898059 9:33766747-33766769 TTGCCAGGGGCTGGGGGTGCTGG + Intronic
1053075217 9:35127293-35127315 GTGTCAGGGGCTCAAGGTGCAGG - Intergenic
1056687422 9:88778111-88778133 GGGTCAGGGGCCCAGGCTGCAGG + Intergenic
1056799483 9:89681386-89681408 GTGCCGGGGGGCCGGGGGGCGGG - Intergenic
1058023585 9:100117023-100117045 ATGCCAGTGCCCCTGGGTGCAGG + Intronic
1059346929 9:113635396-113635418 GTGCCAGGTGCCCAGGCTGGGGG + Intergenic
1060406107 9:123373836-123373858 GTGACAGCGGCCACGGGCGCAGG - Exonic
1060539724 9:124421250-124421272 GTGCCAGGGGCCCTGGAGCCTGG - Intergenic
1061028966 9:128068290-128068312 GAGGCAGGGGCTCCGGGCGCGGG - Exonic
1061193651 9:129095965-129095987 GCCCCAGGTGCCCCGGGGGCTGG - Intronic
1061557787 9:131382574-131382596 GTGCAAGGGCCCCCTGCTGCTGG + Intergenic
1061933343 9:133844522-133844544 GTGCCAGGGACTGGGGGTGCAGG - Intronic
1062141805 9:134963280-134963302 GCTCCCGGGGCCCCGCGTGCTGG - Intergenic
1062333802 9:136056159-136056181 GTGCCAGGGCCTCAGGGAGCTGG + Intronic
1062414146 9:136439464-136439486 GCGCGAGGGGTCACGGGTGCCGG + Exonic
1062428004 9:136514895-136514917 CTCCCAGGGGCCCCAGGGGCAGG + Intronic
1185891799 X:3828555-3828577 GTGCCAGCGGCTCCGCGTGAGGG - Intronic
1185896908 X:3866969-3866991 GTGCCAGCGGCTCCGCGTGAGGG - Intergenic
1185902026 X:3905395-3905417 GTGCCAGCGGCTCCGCGTGAGGG - Intergenic
1186350215 X:8732261-8732283 GTGACAGGGGGGCCGGGCGCAGG + Intergenic
1186434024 X:9528149-9528171 GTGCCAGGGGCTGCGGGGGAAGG - Intronic
1187487211 X:19715914-19715936 GTGCCAGGGGCTCAGGGGGTGGG + Intronic
1189281080 X:39820669-39820691 GTGCCAGGAGGCCTGGGTGGGGG - Intergenic
1189303793 X:39971745-39971767 GTGTCAGGGCTCCCTGGTGCTGG - Intergenic
1189336347 X:40172835-40172857 GTGTCAGTGCTCCCGGGTGCCGG - Intronic
1189429625 X:40935253-40935275 ATGCCAGTGCCCCTGGGTGCAGG + Intergenic
1192207718 X:69107261-69107283 GTCCCAGGGGCCTGGGGTTCTGG - Intergenic
1192208302 X:69110392-69110414 CTCCCAGGGGCCCCAGGTGCCGG + Intergenic
1193295362 X:79826588-79826610 GTGTCAGGGGCTCAAGGTGCGGG + Intergenic
1197693026 X:129523066-129523088 GGGCTAGGGGCGGCGGGTGCGGG - Intronic
1200000078 X:153055912-153055934 AGGCCAGGGGCACCTGGTGCGGG - Intergenic
1200002997 X:153071867-153071889 AGGCCAGGGGCACCTGGTGCGGG - Intergenic
1200003444 X:153073310-153073332 GTTCCACGGGCCCCCAGTGCCGG - Exonic
1200004279 X:153076699-153076721 GTTCCACGGGCCCCCAGTGCCGG + Intergenic
1200004726 X:153078142-153078164 AGGCCAGGGGCACCTGGTGCGGG + Intergenic
1200182769 X:154160969-154160991 GTGCCAGGGGCTGGGGGTGGGGG + Intergenic
1200188423 X:154198083-154198105 GTGCCAGGGGCTGGGGGTGGGGG + Intergenic
1200194073 X:154235223-154235245 GTGCCAGGGGCTGGGGGTGGGGG + Intergenic
1200199828 X:154273027-154273049 GTGCCAGGGGCTGGGGGTGGGGG + Intronic
1201580917 Y:15511449-15511471 GTGCCAGGGGCTCGAGGTGTGGG + Intergenic