ID: 1077483630

View in Genome Browser
Species Human (GRCh38)
Location 11:2828178-2828200
Sequence GTGCTAGTCCCTGCCTGCTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 210
Summary {0: 1, 1: 1, 2: 2, 3: 25, 4: 181}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077483630_1077483636 25 Left 1077483630 11:2828178-2828200 CCTCAGCAGGCAGGGACTAGCAC 0: 1
1: 1
2: 2
3: 25
4: 181
Right 1077483636 11:2828226-2828248 GGACAGGAGATGGTGTCGTCAGG 0: 1
1: 0
2: 0
3: 5
4: 109
1077483630_1077483637 26 Left 1077483630 11:2828178-2828200 CCTCAGCAGGCAGGGACTAGCAC 0: 1
1: 1
2: 2
3: 25
4: 181
Right 1077483637 11:2828227-2828249 GACAGGAGATGGTGTCGTCAGGG 0: 1
1: 0
2: 0
3: 6
4: 119
1077483630_1077483638 27 Left 1077483630 11:2828178-2828200 CCTCAGCAGGCAGGGACTAGCAC 0: 1
1: 1
2: 2
3: 25
4: 181
Right 1077483638 11:2828228-2828250 ACAGGAGATGGTGTCGTCAGGGG 0: 1
1: 0
2: 2
3: 5
4: 136
1077483630_1077483639 28 Left 1077483630 11:2828178-2828200 CCTCAGCAGGCAGGGACTAGCAC 0: 1
1: 1
2: 2
3: 25
4: 181
Right 1077483639 11:2828229-2828251 CAGGAGATGGTGTCGTCAGGGGG 0: 1
1: 0
2: 0
3: 12
4: 155
1077483630_1077483633 4 Left 1077483630 11:2828178-2828200 CCTCAGCAGGCAGGGACTAGCAC 0: 1
1: 1
2: 2
3: 25
4: 181
Right 1077483633 11:2828205-2828227 GAAGAAAACTCTGAGAAGTCAGG 0: 1
1: 0
2: 5
3: 32
4: 355
1077483630_1077483635 15 Left 1077483630 11:2828178-2828200 CCTCAGCAGGCAGGGACTAGCAC 0: 1
1: 1
2: 2
3: 25
4: 181
Right 1077483635 11:2828216-2828238 TGAGAAGTCAGGACAGGAGATGG 0: 1
1: 1
2: 3
3: 72
4: 566
1077483630_1077483634 9 Left 1077483630 11:2828178-2828200 CCTCAGCAGGCAGGGACTAGCAC 0: 1
1: 1
2: 2
3: 25
4: 181
Right 1077483634 11:2828210-2828232 AAACTCTGAGAAGTCAGGACAGG 0: 1
1: 0
2: 3
3: 21
4: 319

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077483630 Original CRISPR GTGCTAGTCCCTGCCTGCTG AGG (reversed) Intronic
901647519 1:10724646-10724668 GTGCTAGGCCCTGCTTGCTTTGG - Intronic
903179682 1:21598855-21598877 GACCCAGGCCCTGCCTGCTGGGG - Intronic
903285012 1:22271368-22271390 GGCCTAGACCCTCCCTGCTGGGG + Intergenic
903646349 1:24898391-24898413 GTGCTGGTTCGTGCCTGCTAGGG + Intergenic
903967380 1:27099185-27099207 GTACCACACCCTGCCTGCTGTGG - Exonic
904239973 1:29137728-29137750 GTTCTAGTCTTTGCCTGGTGGGG - Intergenic
904602612 1:31681905-31681927 GGGCGAGTCCCTGCCTGCTTTGG + Intronic
905207635 1:36352001-36352023 GGGCCAGTCCCATCCTGCTGTGG - Intronic
905252002 1:36655391-36655413 GTGATAGCACCTGCCTGCTAGGG + Intergenic
906328830 1:44867496-44867518 GTGCTTGTCTCTGCCAGCAGTGG - Intronic
915007850 1:152656435-152656457 GTTCAAGTCTCTTCCTGCTGTGG + Intergenic
915862686 1:159463116-159463138 GTGCTGCTCCTTCCCTGCTGGGG - Intergenic
919821024 1:201472070-201472092 CTGCTCCTCCCTTCCTGCTGAGG + Intergenic
920276942 1:204813546-204813568 GTGCCAGGCCCTGCCTGCAGAGG - Intergenic
920994224 1:210972250-210972272 GTGCTAATACCTGCCTCATGGGG - Intronic
921850793 1:219929934-219929956 CTGCTGGTCTCTTCCTGCTGTGG + Intronic
922466104 1:225846329-225846351 GTCCTTGTCCCTGCCTGCTATGG + Exonic
922725848 1:227922673-227922695 GTGCCTGGCCCTCCCTGCTGAGG - Intronic
923012135 1:230096189-230096211 TTGCTAGCACCTGCCAGCTGAGG + Intronic
923870978 1:237993991-237994013 GGGCTATACCCTGCCTGGTGTGG - Intergenic
924496306 1:244593738-244593760 GTGATGGTCCCTGCATGTTGAGG + Intronic
924626595 1:245700843-245700865 GTGCTTATCCCTCCCCGCTGCGG + Intronic
924953841 1:248908848-248908870 GTGCTATTCCCTGCCTGCTGAGG + Intronic
1062973391 10:1665552-1665574 GTGCTAGGCCCTGCATGCCGGGG + Intronic
1064632103 10:17327111-17327133 CTGCTAGTCCCAGCCTTTTGTGG - Exonic
1067066111 10:43105194-43105216 GTGCTTGTCCGCGCGTGCTGTGG + Intronic
1067656715 10:48197925-48197947 ATGCTGGTACCTGCCTCCTGGGG + Intronic
1069720199 10:70544885-70544907 TTGCAACTCCATGCCTGCTGGGG + Intronic
1069934306 10:71904870-71904892 GGCCTCCTCCCTGCCTGCTGGGG - Intergenic
1074753532 10:116608778-116608800 GTGAGAGTCCCTGCCTTCGGAGG + Intronic
1074877998 10:117629479-117629501 GGGAAAGTCCCAGCCTGCTGGGG + Intergenic
1075343659 10:121666692-121666714 ATGTTGGTCCCTGCCTTCTGTGG + Intergenic
1075924895 10:126243419-126243441 ATGTTAGTCCCTGCCTCCTGGGG - Intronic
1076119693 10:127925648-127925670 CTGCTAGGCCCTTCCAGCTGTGG + Intronic
1076265783 10:129109067-129109089 GTGGGAGGCCCTGCCTGTTGGGG + Intergenic
1076679752 10:132165617-132165639 GTGCTGGTCCCGGCCTGAGGAGG + Intronic
1077034585 11:488509-488531 GTGCTGGCCCCTCCCTGCAGTGG + Exonic
1077042332 11:530289-530311 GTGCTGGTCACTGCCTGCTGGGG - Intergenic
1077408548 11:2393198-2393220 GAGATGGCCCCTGCCTGCTGAGG + Intronic
1077483630 11:2828178-2828200 GTGCTAGTCCCTGCCTGCTGAGG - Intronic
1078419834 11:11201246-11201268 GTGTCAGTCCGTGCCTACTGGGG + Intergenic
1078453222 11:11455633-11455655 GGGCTACCCCCAGCCTGCTGAGG - Intronic
1078742271 11:14078036-14078058 TTGGCAGACCCTGCCTGCTGTGG + Intronic
1080260850 11:30348250-30348272 CTGCTCATCCCTGCCTCCTGTGG + Intergenic
1080801708 11:35616529-35616551 GACATAGTCCCTGCCTGCTAGGG + Intergenic
1083658673 11:64242128-64242150 GGGCGGGTCCCTGGCTGCTGTGG + Exonic
1084174197 11:67415283-67415305 GTACCAGTCTCTGCCTGCTCCGG + Intronic
1085279172 11:75319212-75319234 GTGCTAATCCTTCCCTCCTGAGG - Intronic
1085759482 11:79229495-79229517 GTGCTAGGCTCTGACTTCTGAGG - Intronic
1092237594 12:6819724-6819746 GTGCAAGTTCCTGCCCTCTGTGG - Exonic
1092397677 12:8142621-8142643 CTGCTGGGCCCTGCCTGCAGAGG - Intronic
1092936320 12:13367345-13367367 GTGCTGGCCCGTCCCTGCTGAGG + Intergenic
1094259174 12:28472168-28472190 GTGCTTGTCTCTTCCTTCTGTGG - Intronic
1097321805 12:58233949-58233971 GTGCTAGGCCCTGCCCAGTGTGG + Intergenic
1100201864 12:92307182-92307204 GTTCTATTCTCTCCCTGCTGTGG + Intergenic
1100742415 12:97608617-97608639 GTGTCAGTCCGTGCCTACTGGGG + Intergenic
1102677331 12:114667660-114667682 GTGCTGGGCCCTGCAGGCTGCGG + Intergenic
1102806603 12:115786895-115786917 GAGATAGTCCCTGCCTTGTGGGG - Intergenic
1104044998 12:125155651-125155673 GTTCTTGACCCTGGCTGCTGGGG + Intergenic
1104584241 12:130035124-130035146 GTGGGCGTCCCTGCCTTCTGTGG + Intergenic
1104730535 12:131103135-131103157 GCGCAGGTCCTTGCCTGCTGAGG + Intronic
1104935976 12:132364697-132364719 GCCCCTGTCCCTGCCTGCTGCGG - Intergenic
1105546256 13:21352972-21352994 CTGCCAGGCCCTGCCTGCAGGGG + Intergenic
1105767805 13:23578912-23578934 CTGCGAGTCCCTGCCGGCTGAGG + Intronic
1106001270 13:25725555-25725577 GCGCTGGTCACTGCATGCTGTGG + Intronic
1107451578 13:40515021-40515043 GTGCTGGTCCCCTCTTGCTGTGG + Intergenic
1114152895 14:20064558-20064580 GTTTTAGTCCCTCCCAGCTGTGG + Intergenic
1118188266 14:63557301-63557323 CGGCTAGTCCCTGCTTGCTGAGG - Intergenic
1118430047 14:65708815-65708837 GTGATAATCAGTGCCTGCTGCGG + Intronic
1119555745 14:75550993-75551015 GTGCTAGTCCCTGCATTGTCGGG + Intergenic
1121946949 14:98132289-98132311 GTCCTAGTTCCTGCCTGTTGTGG + Intergenic
1122985642 14:105210453-105210475 GCGCTGGGGCCTGCCTGCTGCGG + Exonic
1123478654 15:20611597-20611619 CTGACAGCCCCTGCCTGCTGAGG - Intergenic
1123639359 15:22388788-22388810 CTGACAGCCCCTGCCTGCTGAGG + Intergenic
1124379908 15:29156524-29156546 GTGCTAGGCCCTCCCTGCAAAGG - Intronic
1125685140 15:41559373-41559395 GTGCCAGCCCCTACCTGCGGCGG - Exonic
1125845582 15:42849997-42850019 TTGCTTGGCCCTGCCTGATGTGG - Intronic
1129682210 15:77664322-77664344 GTGAAAGTCCCTGGATGCTGGGG + Intronic
1135481109 16:22821313-22821335 GTGCTATTACCTGCATGCTTTGG + Intronic
1136093190 16:27935301-27935323 GAGCTAGTCCCATCCTGATGGGG + Intronic
1136419223 16:30122132-30122154 ATGCTGGTTCCTTCCTGCTGTGG + Intronic
1137669934 16:50272946-50272968 GTGCTGGTCCCTGCCCCCAGGGG - Intronic
1139121038 16:64017320-64017342 ATCCCAGCCCCTGCCTGCTGGGG - Intergenic
1139514237 16:67443963-67443985 GTGCTAGTTCCTGCCTGCTTAGG - Intronic
1139960614 16:70715377-70715399 GAGCTAGTCCCTGCCCGCCAGGG - Intronic
1140127855 16:72132802-72132824 GTGCAAGGCCCTGCAGGCTGAGG - Exonic
1140477326 16:75245441-75245463 GTGCCTGGCCCTGCCTGATGGGG - Intronic
1140612108 16:76612518-76612540 CTGCTATTCTCTGCCTACTGAGG - Intronic
1141140815 16:81495746-81495768 CTGGAAGCCCCTGCCTGCTGTGG + Intronic
1141557091 16:84843351-84843373 CTGCTCAACCCTGCCTGCTGTGG + Intronic
1142236121 16:88923390-88923412 GTGCAAGTCCCTGGCAGCTCAGG - Intronic
1142502310 17:339924-339946 GTCCCAGCCCCTGCCTGCTCCGG - Intronic
1142805240 17:2367937-2367959 GTACCAGGCCCTGCCGGCTGGGG - Intronic
1144629940 17:16865956-16865978 GGGCAGGTCCCTGCCAGCTGAGG - Intergenic
1144651490 17:17010161-17010183 GGGCAGGTCCCTGCCAGCTGAGG + Intergenic
1144685755 17:17225156-17225178 GTGCTGCTCTCAGCCTGCTGAGG - Intronic
1145813463 17:27779004-27779026 GTGGTACGCCCTGCCTGCAGTGG - Exonic
1147239932 17:39083985-39084007 GACCTAGTCCCTGCCTTCTTAGG + Intronic
1147387622 17:40091399-40091421 GTGCCTGTCCCACCCTGCTGGGG + Intronic
1147503012 17:40984049-40984071 GTAATAGTCCCTGCTTGGTGGGG - Exonic
1149974085 17:61248586-61248608 CTGCTACTTCCTCCCTGCTGAGG - Intronic
1152021744 17:77783253-77783275 GTGCTAATACCTGCTTGCTTGGG + Intergenic
1152324797 17:79629325-79629347 CTTCAAGTCCCTGCATGCTGAGG - Intergenic
1156354981 18:36332929-36332951 GAGCCAGACTCTGCCTGCTGGGG + Intronic
1157364892 18:47055457-47055479 GTCCTAGGCCCTTCCTTCTGAGG - Intronic
1157990133 18:52485318-52485340 CTGCAAGTATCTGCCTGCTGAGG - Intronic
1158558264 18:58492840-58492862 GTGCTAGTCCCTCCATGGAGGGG + Intronic
1161668041 19:5588998-5589020 GCACGAGTGCCTGCCTGCTGTGG + Intronic
1161744063 19:6044179-6044201 GTGCTTGTCATTACCTGCTGGGG + Exonic
1163369143 19:16892390-16892412 CTGCTATCCCCTGACTGCTGGGG + Exonic
1163476385 19:17528514-17528536 CTGCTGGTCCCTGCCCGCTCAGG - Intronic
1164120751 19:22262657-22262679 GTGAGAGTCCCTCCCTGCTCTGG - Intergenic
1164145290 19:22509237-22509259 GGCCTAGTCCCAGCCTCCTGCGG - Intronic
1164179270 19:22805907-22805929 GTGAGAGTCCCTCCCTGCTCTGG + Intergenic
1165045215 19:33099449-33099471 GTCCTTGTCCCTCTCTGCTGTGG + Intronic
925165615 2:1713903-1713925 GAGCTCCTTCCTGCCTGCTGAGG - Intronic
927278918 2:21286654-21286676 ATGCTGGTTCCTGGCTGCTGGGG + Intergenic
928603862 2:32926455-32926477 GTGGCAGTCCCTGGCTGCTGAGG + Intergenic
932885886 2:75548866-75548888 GTCTTAGTTCCTGCCTTCTGGGG - Intronic
937250633 2:120521655-120521677 GGGCTGGGCCCTGGCTGCTGGGG + Intergenic
937913082 2:127085675-127085697 GTGCTGGGCCCTTCCTGCTGGGG - Intronic
939658280 2:144854380-144854402 CTGCTAGTTCCTGCCTGTTAAGG - Intergenic
939842738 2:147208139-147208161 ATGCTAGTCCATCCCTACTGTGG - Intergenic
940296784 2:152134567-152134589 GTGCTAGTCCTTGCCAGTTCAGG - Intronic
940360467 2:152790979-152791001 CTGCTTGTCTCTGCCTGCTAGGG - Intergenic
940954828 2:159715630-159715652 GTGTGAGTCACTGCATGCTGGGG + Intronic
941649576 2:168079310-168079332 GTGCCAGGCCTTGCATGCTGAGG - Intronic
941852931 2:170202102-170202124 GTGCTACTTCCTGGCTGCTTTGG - Intronic
948473564 2:238202732-238202754 GTGTTAATCCCTGCGTCCTGTGG - Intronic
948547919 2:238745806-238745828 GTGCCAGTCCCTTCCTCCTCGGG - Intergenic
1168956821 20:1840339-1840361 CTTCAAGTCCCTGCCTGCTCCGG - Intergenic
1169082433 20:2805566-2805588 GGGGTAGTCCCTGCCGGCGGTGG - Intergenic
1169881438 20:10351340-10351362 GCCCCAGTCCCTGCCTGCTGAGG - Intergenic
1172568290 20:35948341-35948363 GTTCCAGACCCTGCCTGCTTCGG - Exonic
1175852931 20:62103676-62103698 GTGCCCCTCCGTGCCTGCTGTGG + Intergenic
1177893339 21:26833337-26833359 GGGCAACTCCCTGCCTGCTGGGG - Intergenic
1179825079 21:43959873-43959895 GGGCCAGTCCCTGCCGCCTGGGG + Intronic
1179918287 21:44492345-44492367 GTGCTTGTCCCTCCAGGCTGCGG + Intergenic
1180796258 22:18607201-18607223 GAGCTTGTCCTTGCCTGCTGTGG + Exonic
1181225464 22:21388070-21388092 GAGCTTGTCCTTGCCTGCTGTGG - Exonic
1181253169 22:21546743-21546765 GAGCTTGTCCTTGCCTGCTGTGG + Exonic
1181976595 22:26735285-26735307 GTGATAGTCCCTGTCTGCTAAGG - Intergenic
1183040799 22:35176482-35176504 ATGCTAGTTCCTGGATGCTGTGG - Intergenic
1183326868 22:37199137-37199159 GTGGCAGAGCCTGCCTGCTGGGG + Intronic
1183332926 22:37231010-37231032 GTGATAGCTCCTGCCTCCTGGGG - Intronic
1183368393 22:37419034-37419056 GTGTGAGCCCCTGCCTGCGGGGG - Intronic
1183738189 22:39655344-39655366 CTGCAAGTCCCTGCCTGATGCGG - Intronic
1184468049 22:44680453-44680475 GGGCTGGTCCCTGCCTGGTGGGG + Intronic
1184604810 22:45566312-45566334 GTGGAACTCCCTGCCTCCTGAGG + Intronic
1184790533 22:46696881-46696903 CTCCCTGTCCCTGCCTGCTGGGG - Intronic
1184940547 22:47761739-47761761 GAGCCAGGCCCTGCCTGCTGAGG - Intergenic
1185216665 22:49603832-49603854 GTGCCACTCCATGCCTGCTTAGG + Intronic
1185306200 22:50118313-50118335 ATGATAGTCCCTGCCTCGTGTGG + Intronic
1185340646 22:50289438-50289460 TTGCGTGTCCCAGCCTGCTGGGG - Intronic
950187145 3:10952202-10952224 AAGCTAGTTCCTGCCTCCTGGGG + Intergenic
952252329 3:31666474-31666496 GTGCTAGGCCTTCCCTGCAGAGG - Intronic
961347652 3:126274468-126274490 GAGCTAGTCCCATCCTGCTGTGG - Intergenic
961477741 3:127159168-127159190 CAGCTAGTGCCTACCTGCTGTGG + Intergenic
961696668 3:128709901-128709923 ATGCTAGTCACTGCCCACTGGGG - Intergenic
961737026 3:129008792-129008814 GGCCCAGCCCCTGCCTGCTGAGG + Intronic
962084201 3:132173534-132173556 CTGGTGGTCCCTGCCTGGTGAGG - Intronic
962828264 3:139118621-139118643 GTGCTGGTCTCTGCCAGATGAGG - Intronic
967814570 3:193788087-193788109 GTTCAAATCCCAGCCTGCTGGGG + Intergenic
968490086 4:885418-885440 GTGCTTGCCGCTGCCTGCCGTGG - Intronic
971884289 4:32423585-32423607 GTGCAGGGCCCTGCCTACTGGGG - Intergenic
972788755 4:42350656-42350678 GTGCTAGTCCATGCTTTCTGGGG + Intergenic
981701867 4:147616421-147616443 CTGCTAGTACCTGCCACCTGGGG - Intergenic
986746713 5:10751140-10751162 TGGCTACTCCCTGCCTCCTGTGG + Intronic
988110493 5:26813151-26813173 GTGGGAGGCCCTGCCTGGTGAGG - Intergenic
992084143 5:73262902-73262924 GAGCTGCTCCATGCCTGCTGGGG - Intergenic
995632185 5:114145937-114145959 GTGCTAGTTGTTTCCTGCTGTGG + Intergenic
996015226 5:118526145-118526167 GTGCTAGTTTCCTCCTGCTGCGG - Intergenic
999449350 5:151666592-151666614 TGGCTAGTCTCTGCCTGCTCTGG - Intronic
1000746989 5:165046019-165046041 CTGCTAGGCCCTGCCCGCAGAGG + Intergenic
1002372387 5:178765664-178765686 GTTCTTGACCCTGGCTGCTGGGG - Intergenic
1003405377 6:5823460-5823482 CTGCCAGGCCCTGCCTGCAGGGG - Intergenic
1006944792 6:37778090-37778112 GTGCTCCTGCCTGCCTCCTGGGG - Intergenic
1010060591 6:71618050-71618072 GGGCTAGTCCTTCCCTGCAGAGG + Intergenic
1012730808 6:102877280-102877302 GTGCTGGACCCTTCCTGCTGTGG + Intergenic
1014337222 6:120151785-120151807 GTACTAGTACCTGCCTGTTTTGG - Intergenic
1015203749 6:130612103-130612125 ATACTAGTCCCTACCTGATGGGG + Intergenic
1017492241 6:154954951-154954973 GTGCCAGCCCCTTCCTGCCGAGG + Intronic
1017674405 6:156798207-156798229 GTGCTGGTCGCTCCCTCCTGGGG + Intronic
1019791185 7:3014893-3014915 TTGCTGGTCCCTCCCTGCTCTGG - Intronic
1021202434 7:17741641-17741663 GTGCTGGGCCCTGCCTGGCGAGG - Intergenic
1021661669 7:22924929-22924951 GTGTCAGTCCCCGCCTACTGGGG - Intergenic
1024056423 7:45662529-45662551 GTGCTAGGCCCTCCCTCCTTAGG + Intronic
1024511940 7:50211663-50211685 GTGCCAGTGCCTGCCTCCTGAGG - Intergenic
1026275243 7:68870659-68870681 GTGATATTCTCTGGCTGCTGAGG - Intergenic
1029287828 7:99478433-99478455 GTTCTGGTGCCTGCCTGCAGAGG + Intronic
1034472040 7:151260200-151260222 GTGCTAAAGCTTGCCTGCTGGGG + Intronic
1035250922 7:157596344-157596366 TTTCTGGTCCCTGCCTGGTGGGG - Intronic
1035516485 8:237972-237994 GTACTAGTCCCTGCTGGCAGGGG + Intronic
1037844180 8:22268091-22268113 GTCTTAGGCCCTGCCTTCTGAGG + Intergenic
1039369296 8:36968613-36968635 GTGTTGGGCCCTGCCTGCAGGGG - Intergenic
1041755014 8:61304302-61304324 ATGCCAGTCTCTGCCTGCTTGGG + Intronic
1049404046 8:142443763-142443785 GTGCTGGCCCCTCCCTGCTCCGG - Intergenic
1049406647 8:142454582-142454604 CTGCCAGTCTCTGCCTGCGGGGG - Intronic
1052342733 9:27379472-27379494 ATGGTAGTACCTGCCTCCTGTGG - Intronic
1055070000 9:72156469-72156491 GGGCTAATCCCTTCCTTCTGAGG + Intronic
1060954753 9:127630508-127630530 GAGCAAGACCCTGTCTGCTGTGG + Intronic
1061079285 9:128360575-128360597 GTGCCAGGCCCTGCTTGCTTTGG - Exonic
1061628473 9:131856408-131856430 GGGCCAGTCCCTTGCTGCTGAGG + Intergenic
1062316479 9:135969719-135969741 GGGCTAGTCCCTGCCATGTGGGG + Intergenic
1190136882 X:47806143-47806165 GTGCTGGTACCTGCCTGGGGGGG + Intergenic
1190533958 X:51407836-51407858 GTGCCAGGCCCTGCCCGCCGAGG + Exonic
1191667931 X:63722474-63722496 GAGCTAGACTCTGGCTGCTGGGG + Intronic
1191920079 X:66246392-66246414 GTGCTAAGCCCTGTCTGATGAGG + Intronic
1193995618 X:88363673-88363695 GGGCTGTTCCCTGCCTGCTGGGG - Intergenic
1199763856 X:150926416-150926438 GTGCAATGCCCTGCCTGCTCTGG + Intergenic