ID: 1077485309

View in Genome Browser
Species Human (GRCh38)
Location 11:2835795-2835817
Sequence CCTTCCTCATGGAGGCGGCG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 146
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 131}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077485302_1077485309 -1 Left 1077485302 11:2835773-2835795 CCTGGGGCTCACAGAGGAAAAGC 0: 1
1: 1
2: 4
3: 31
4: 331
Right 1077485309 11:2835795-2835817 CCTTCCTCATGGAGGCGGCGGGG 0: 1
1: 0
2: 0
3: 14
4: 131

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077485309 Original CRISPR CCTTCCTCATGGAGGCGGCG GGG Intronic
900360020 1:2283927-2283949 CCTTCCTGCAGGAGGCGGGGAGG + Intronic
900670073 1:3846775-3846797 CATTCCTCTTGGAGGGGGCAGGG + Intronic
902697523 1:18150339-18150361 CCTTCCTTACGGAGGCTGGGAGG + Intronic
902877435 1:19349383-19349405 CCGTCCACATGGAGCCGGGGAGG - Intronic
904267774 1:29327401-29327423 TCTACCCCATGGAGGCGGCTGGG - Intergenic
904478587 1:30779986-30780008 CCGTCCTGATGGAGGTGGAGTGG - Intergenic
904500147 1:30908577-30908599 CCGGCTTCATGGCGGCGGCGCGG + Exonic
907074930 1:51569412-51569434 CCTGCCACATGGAGGCGGGGTGG + Intergenic
907414507 1:54304930-54304952 GCTTCCTCATGGTGTCGGTGGGG - Intronic
910487459 1:87731333-87731355 CCTACCTCATGGGGGTGGGGCGG - Intergenic
919858642 1:201723126-201723148 CCATCCTGATGGAGGCGAAGTGG + Intronic
920630583 1:207647664-207647686 CCTTCCTCTTGGAGGCAGGAGGG - Intronic
921295054 1:213693604-213693626 CCTTCCTCAGGCAGGCAGGGTGG - Intergenic
921355505 1:214281242-214281264 CGGCCCTCATGGTGGCGGCGGGG - Exonic
922228946 1:223668872-223668894 CCTTCCTCATCGAGGCTGGCAGG + Intergenic
1067688228 10:48480719-48480741 CCTTCCTCATGGAGTCACTGTGG - Intronic
1070357506 10:75655013-75655035 TCTTCCCCACGGAGGCAGCGAGG + Intronic
1072304125 10:94090527-94090549 CCTTCCTTATGGAAGGTGCGGGG + Intronic
1073136542 10:101223555-101223577 CATTGCGCAGGGAGGCGGCGAGG - Intergenic
1073325574 10:102642673-102642695 CCTTCCTCGCGGCGGCGGCGAGG + Intergenic
1073360088 10:102891283-102891305 CATTCCTGGTGGAGTCGGCGCGG + Intronic
1073374482 10:103021233-103021255 CCTTCGTCAGGGAGGCTGTGGGG - Intronic
1077195400 11:1277341-1277363 CCTTCCTCAGGGAGGCCGGTGGG - Intronic
1077485309 11:2835795-2835817 CCTTCCTCATGGAGGCGGCGGGG + Intronic
1079375507 11:19888318-19888340 CCTGCCTCACTGAGGCAGCGTGG - Intronic
1088388988 11:109292316-109292338 CCTTCCTCATGGCAGCAGGGTGG - Intergenic
1090064575 11:123491915-123491937 TCTTCCTCAGGGAGGAGACGTGG - Intergenic
1090326162 11:125887930-125887952 CGTTCCTGAGGGAGGCGGCCGGG + Intronic
1091283347 11:134394610-134394632 CCTTGCTCATGGAGGAAGAGTGG + Intronic
1091383557 12:78050-78072 CCTTCCTCAGCGGGGCGGCGGGG - Intronic
1095210886 12:39493241-39493263 GTTTCCTCATGGAGGCTGAGAGG + Intergenic
1096241406 12:49962005-49962027 CCTTCTTCATGGTGGCCGCGGGG - Exonic
1096460716 12:51820389-51820411 CCTCCCACGCGGAGGCGGCGGGG + Intergenic
1096716837 12:53496461-53496483 CCTTACCCATGGAGGCCTCGGGG + Intronic
1098022365 12:66169670-66169692 CCCTCCTCAGGGAGTCGGGGAGG - Intronic
1100981400 12:100165597-100165619 CCTTCCTCTTGGAGGTGCTGAGG - Intergenic
1107666970 13:42700415-42700437 CCTTCCTCATGCTGGGGGTGGGG - Intergenic
1108020797 13:46125995-46126017 CTTTCTTCCTGGAGGCGGAGGGG + Exonic
1115754629 14:36519136-36519158 CCTACCACATGACGGCGGCGGGG - Exonic
1123124561 14:105937297-105937319 CCTTCCTCATGGGGAGGGTGTGG - Intergenic
1123998111 15:25733184-25733206 GCTGCCTCATGGAGGCTGCAAGG + Intronic
1125300927 15:38252759-38252781 CTTCCCTCAGGGATGCGGCGAGG - Exonic
1128776990 15:70328164-70328186 CCTGCCTCATGGGGGTGGTGGGG - Intergenic
1129391382 15:75222721-75222743 TCTTCCCCATGGAGGCGAGGGGG - Intergenic
1131137990 15:89953022-89953044 CCATCCACATGGGGGCGGGGAGG + Intergenic
1132801691 16:1757826-1757848 CCTGCATCATGGGGGCTGCGGGG + Intronic
1135972312 16:27081459-27081481 CCTTCCCCATGGAGGAGTCAGGG + Intergenic
1137709427 16:50555957-50555979 CCTTCCTCAGGGAGAGGGTGGGG - Intronic
1139698404 16:68691940-68691962 CCATCCTCAGGGAGGGGGTGGGG - Intronic
1141814420 16:86400050-86400072 CTTTCCTCATGGAGGTGGAATGG + Intergenic
1141958878 16:87391816-87391838 CCTGCCTCCCGGAGACGGCGCGG + Exonic
1142217011 16:88834778-88834800 CCATCTTCATGGAGGCAGCCCGG + Intronic
1142260272 16:89039572-89039594 CCTTGCTGAAGGAGGCGGCCAGG - Intergenic
1144731683 17:17529722-17529744 CCGTCATAATGGAGGAGGCGGGG - Intronic
1147358653 17:39917583-39917605 CCTTCTTAAGGGCGGCGGCGGGG - Intronic
1148245381 17:46026686-46026708 CCTTCCTCAGGCAGGCAGCTTGG - Exonic
1151471132 17:74318489-74318511 CCTTTCTCATGGAGGCCTCCTGG - Intergenic
1151515881 17:74595243-74595265 CCTTCCTGATGGTGGCGGAAAGG + Intergenic
1151552819 17:74831811-74831833 CCCACCTCGTGGAGGCTGCGTGG - Intronic
1152108257 17:78342888-78342910 CCATCCTCTTGTAGGAGGCGGGG - Intergenic
1152797412 17:82315070-82315092 GCTTCCTCCCGGTGGCGGCGTGG + Exonic
1153238726 18:3012737-3012759 CCATCCCCAGGGCGGCGGCGAGG + Intronic
1153552047 18:6272321-6272343 CCTACCTCATGAAGGAGGTGAGG - Intronic
1155026607 18:21946312-21946334 CCTTCCTTCTGGAGGCTGCAGGG + Intergenic
1160739582 19:679805-679827 CCTTCCCCCAGGAGGCGTCGGGG - Intronic
1161043457 19:2122094-2122116 CCTTCCTGAGGGAGCCGGCATGG - Intronic
1162175855 19:8829638-8829660 CCTGACTCATGGAGGCGACCTGG + Intronic
1164759670 19:30719595-30719617 CCTTCCTCTTGGAGCCCGTGCGG + Intergenic
1164949727 19:32327046-32327068 TCCTCCTCATGGAGGGGGCTGGG - Intergenic
1166102973 19:40582297-40582319 CCTGCCTCATGGAGGAGGAGAGG - Intronic
1167001173 19:46746421-46746443 CCTCCATCATGGAGGCCCCGGGG + Exonic
926197174 2:10771117-10771139 CCCTCCTCAGGGAGCCTGCGTGG - Intronic
931514823 2:63044052-63044074 CCTTCCTAATGAGGGAGGCGGGG + Intronic
933967828 2:87444487-87444509 CCTCACTCATGGAGGCTGCCGGG + Intergenic
936325970 2:111506012-111506034 CCTCACTCATGGAGGCTGCCGGG - Intergenic
937326011 2:120989895-120989917 CCTGGCTCATGGAGGCTGCCAGG - Exonic
946391319 2:219418450-219418472 CCTGGCTCATGGTGACGGCGCGG - Exonic
947159480 2:227197804-227197826 CCTACCTCATGGAGGTGTGGGGG - Intronic
1173388341 20:42609028-42609050 TCTTCCTCATAGAGACGGGGTGG - Intronic
1173815578 20:45985701-45985723 CCTTCCTCTGGGAGGCAGCTTGG - Intergenic
1175482961 20:59324427-59324449 CCTTCCTGAAAGAGGCAGCGGGG - Exonic
1179485548 21:41708097-41708119 TCTTCCTCATGGAGGCTTCCTGG + Intergenic
1179586057 21:42375028-42375050 CCTTTCTCATGTGGGCGCCGGGG - Intronic
1179655940 21:42844849-42844871 CCAGCCTCATGGTGGGGGCGGGG - Intronic
1180731717 22:17987363-17987385 CCTTCCTCCTGGAGGCAGCAGGG + Intronic
1181466141 22:23111733-23111755 CCTTCCTCAGGGAGCCAGCAGGG + Intronic
1182413290 22:30204966-30204988 GCTTCCTCCTGGAGCCGGCCCGG + Intergenic
1182425672 22:30270818-30270840 CCTTCCTCTTGCAGGCTGCATGG - Intergenic
1183270241 22:36857578-36857600 CCTTCCTCATGCAGGTGCTGGGG - Intergenic
1184658664 22:45955258-45955280 CCTTCCACATGGAGGCGAGGGGG + Intronic
1184788808 22:46686499-46686521 CCTGCCTCATCACGGCGGCGAGG - Exonic
1185001057 22:48246173-48246195 TCTTCCTCTTGGAGGAAGCGGGG + Intergenic
1185419168 22:50725845-50725867 CCTTCCTCATGGTGTCGGTCAGG - Intergenic
950132145 3:10554573-10554595 CATTCCTTCTGGAGGCTGCGGGG - Intronic
950675975 3:14554661-14554683 TCTTCCTTAGGGAGGTGGCGGGG - Intergenic
954334913 3:49910616-49910638 GCTTCCTGATGGGGGCGGCACGG - Exonic
968609609 4:1551082-1551104 CCTTCCCCCTGGAGACGGGGTGG - Intergenic
968642495 4:1721590-1721612 CCTTCCTGGCGGCGGCGGCGCGG + Exonic
969443840 4:7233101-7233123 CCTTCCTGATGGAGGAGGCTGGG + Intronic
969517108 4:7653950-7653972 GGTTCCTCCTGGAGGCGGTGGGG + Intronic
969604434 4:8195454-8195476 CCTTCCTCTAGGAGGCTGCTGGG + Intronic
975594867 4:76040524-76040546 CCTGACACATGGAGGGGGCGGGG - Intronic
981713691 4:147732623-147732645 CATTCCTCCTCGAGGCAGCGCGG + Intronic
984924499 4:184794776-184794798 CCTTCATCCTTGAGGAGGCGGGG + Intronic
985129642 4:186726713-186726735 CCTCCCCCTTGGAGGCGGTGGGG + Intronic
985965626 5:3337145-3337167 CCTTCCTGATGCAGTCGACGGGG + Intergenic
987072974 5:14355132-14355154 CCTTCCACATGCAGGTGGTGGGG - Intronic
989421214 5:41241195-41241217 CCTTGCTGCTGGAGGCGGGGTGG + Intronic
991977766 5:72199741-72199763 CTTTCCTCCTGGAGGCGGTGGGG - Exonic
999664400 5:153897817-153897839 CCTTTCACATGGAGGAGGTGGGG + Intergenic
1001600564 5:172925635-172925657 CCTTCCTCCTGGGGGCCACGTGG + Intronic
1001798619 5:174523907-174523929 CATTCCTCCTGGAGGCTGTGGGG + Intergenic
1004418505 6:15446842-15446864 CCTGCCACGTGGAGGTGGCGTGG + Intronic
1006273351 6:32981123-32981145 CCCTCCCCATGGAGGCTGAGGGG - Exonic
1008276735 6:49551137-49551159 CCTTCCTCATGCGGGTGGAGAGG + Exonic
1019613753 7:1949550-1949572 CCTGCCAAGTGGAGGCGGCGGGG + Intronic
1022247596 7:28575571-28575593 CCTTCCTGCTGGAGACAGCGGGG + Intronic
1022363479 7:29685452-29685474 CCTTCCTGCTGGAGACAGCGAGG - Intergenic
1022427809 7:30285073-30285095 CCTTCCTGCTGGAGCCAGCGAGG + Exonic
1022697895 7:32728286-32728308 CCTTCCTGCTGGAGCCAGCGAGG + Intergenic
1023127094 7:36965238-36965260 CTGTCCTCAGGGAGGCAGCGGGG - Intronic
1025015662 7:55437108-55437130 CATTCCTAATGGAGGTGGCAGGG + Intronic
1026933757 7:74239872-74239894 CCTTCCCCATGGAAGGGGCATGG + Intronic
1029577605 7:101413740-101413762 CCATCCTGATGGAGGCTGCCGGG + Intronic
1035239437 7:157520272-157520294 GCTTCCTCCTGGAGGCGCCTGGG - Intergenic
1035819034 8:2571865-2571887 CCTCCCCGATGGAGGCGGCGCGG - Intergenic
1035832730 8:2715022-2715044 CCTTCCTAATGGAGGGGGCCCGG + Intergenic
1037748315 8:21663554-21663576 CCTTCTTCATGGAGTCGGTAGGG - Intergenic
1038331857 8:26615384-26615406 CCCTCCTAATGGATGCGGAGGGG - Intronic
1038587642 8:28804464-28804486 CCTTCCTCATGCAGGGGGGCGGG - Intronic
1038625637 8:29190441-29190463 CTGTCCTCATGGAGGTGGCGCGG - Intronic
1038779468 8:30557743-30557765 CCTTTCACATGGAGGCGGCATGG - Intronic
1040930836 8:52733557-52733579 CCTTCCACATGGAGGAGAAGAGG + Intronic
1045038817 8:98201194-98201216 GCTTTCTCATGGAGGCAGAGAGG + Intronic
1047437597 8:124847706-124847728 CTTTCATCGTGGAGGAGGCGTGG + Intergenic
1053214733 9:36260987-36261009 CCTTCCTACTGGAGGCTGCCAGG + Intronic
1056722418 9:89083119-89083141 CCTTCCCCATGGAGGCAGGGTGG - Intronic
1057128563 9:92637967-92637989 CCTTCCCCAGGTAGGCGGTGGGG - Intronic
1058529205 9:105889236-105889258 CCATCCCCATGGAGGCTGGGAGG + Intergenic
1060109240 9:120894693-120894715 CGTTCCATATGGCGGCGGCGCGG + Intronic
1061302733 9:129714982-129715004 TCTTCCTCATCGAGGTGGTGGGG + Intronic
1185501478 X:599960-599982 GATTCCTCCTGGAGGCGTCGAGG + Intergenic
1192175767 X:68884324-68884346 CCGTCTTCATGGAGGTGGAGGGG - Intergenic
1193152520 X:78139823-78139845 CCTTCCCCATGGAGCCTGCTGGG + Intergenic
1198127415 X:133659617-133659639 CCTCCCTCAAGGAGGCTGTGAGG + Intronic
1199971623 X:152865913-152865935 CCATCCTCATCGAGGCAGCCAGG + Exonic