ID: 1077486694

View in Genome Browser
Species Human (GRCh38)
Location 11:2841956-2841978
Sequence GTGTTGGGGTGGAGCTGACC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 231
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 213}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077486679_1077486694 28 Left 1077486679 11:2841905-2841927 CCTGGGGGGTGGTCAGTGAGGGC 0: 1
1: 0
2: 2
3: 20
4: 308
Right 1077486694 11:2841956-2841978 GTGTTGGGGTGGAGCTGACCAGG 0: 1
1: 0
2: 0
3: 17
4: 213
1077486682_1077486694 6 Left 1077486682 11:2841927-2841949 CCAGCCAGGCAGCGGCAGCCCCA 0: 1
1: 1
2: 8
3: 48
4: 434
Right 1077486694 11:2841956-2841978 GTGTTGGGGTGGAGCTGACCAGG 0: 1
1: 0
2: 0
3: 17
4: 213
1077486684_1077486694 2 Left 1077486684 11:2841931-2841953 CCAGGCAGCGGCAGCCCCAGGAA 0: 1
1: 0
2: 6
3: 46
4: 410
Right 1077486694 11:2841956-2841978 GTGTTGGGGTGGAGCTGACCAGG 0: 1
1: 0
2: 0
3: 17
4: 213

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077486694 Original CRISPR GTGTTGGGGTGGAGCTGACC AGG Intronic
900640436 1:3685728-3685750 GAGTGGGGCTGGAGCTGAACTGG + Intronic
900719325 1:4165138-4165160 GTGCAGGGGTGGAGCTGTGCAGG - Intergenic
900927876 1:5717531-5717553 GTGCTGGGGAGGGGCAGACCCGG - Intergenic
901000459 1:6146532-6146554 GAGTTGGGGTGGTGCTGAGCGGG - Intronic
901005789 1:6170955-6170977 GTGTGGGGGTGGCTCTGCCCAGG - Intronic
901241899 1:7699279-7699301 GTGGTGGGGGGGAGCTGAGGAGG - Intronic
901656663 1:10773405-10773427 GGGCGGGGGTGGAGCTGGCCTGG + Intronic
903713972 1:25349150-25349172 GTGTTGGGGTGTAGCTGTTCTGG - Intronic
904275788 1:29383371-29383393 GTGGTGGAGTGGAGCGGAGCGGG + Intergenic
906109171 1:43312048-43312070 GTGTTCGTGTGCAGCTGAGCCGG + Exonic
907461474 1:54608096-54608118 GTGTTGGGGTGGAGCCAGGCTGG - Intronic
909395486 1:75166960-75166982 GTGTCGAAGTGGAGCTGAGCTGG + Intergenic
912804258 1:112743407-112743429 GTGTTGGGCGGAAGCTGGCCTGG - Intergenic
918185255 1:182121128-182121150 GTCTAGGGGAGGAGCTGCCCTGG + Intergenic
921391411 1:214618192-214618214 GTGGTGGGGTGGTGGGGACCCGG - Intronic
921445609 1:215243527-215243549 GTGTTGGGGTGGGACTGAAGCGG - Intergenic
922116415 1:222618171-222618193 GTGCTGGGGTCCAGCTGGCCCGG - Exonic
922216953 1:223527437-223527459 GTGATGGGGGGGAGGTAACCAGG + Intergenic
922555099 1:226527014-226527036 GTGTTTGGACGGTGCTGACCAGG - Intergenic
1063119457 10:3094540-3094562 GTGTTGGTGGGGAGGTGAGCAGG + Intronic
1063143278 10:3274571-3274593 GTGATGGGGTGGGGGTGACCAGG + Intergenic
1065999467 10:31090923-31090945 AAGTTTGGGTGCAGCTGACCTGG + Intergenic
1066114493 10:32227518-32227540 GAGTTGGGGTGGAAAGGACCAGG + Intergenic
1067038860 10:42937929-42937951 GTAAAGGGGTGGAGCTGCCCTGG + Intergenic
1067058221 10:43064612-43064634 GTGTGGGGGTGGGGGTCACCGGG + Intergenic
1068523473 10:58103059-58103081 GTGGTCGGGGGGAGGTGACCAGG - Intergenic
1069635568 10:69922815-69922837 GTGTTGGGGAGGTGCTTACCTGG + Intronic
1069797298 10:71061643-71061665 GGGGTGGGGTGGACCTGACCTGG - Intergenic
1069886233 10:71625480-71625502 GTGATGGGGTGGAGGTGAGAAGG + Intronic
1070836822 10:79452707-79452729 GTGTTGTAGGTGAGCTGACCAGG + Intergenic
1071551392 10:86568867-86568889 GTGCTTGGGTAGAGCTGACCTGG + Intergenic
1071569765 10:86690518-86690540 GAGGTTGGGTGGAGCTGCCCTGG - Intronic
1072443245 10:95476119-95476141 GAGTGGGGGTGGGGCTGATCTGG - Intronic
1076166192 10:128284659-128284681 GTGTTGGGGTGGTTCTGAATGGG + Intergenic
1076546502 10:131248976-131248998 AGGATGGGATGGAGCTGACCTGG + Intronic
1076663277 10:132069398-132069420 GTGGTGGGGTGGGTCTGAGCAGG + Intergenic
1077036680 11:498781-498803 GAGCTGGGGTGGAGCAGCCCTGG + Exonic
1077327593 11:1970446-1970468 GGGCTGGGCTGGAGCAGACCCGG - Intronic
1077470466 11:2756573-2756595 CAGTTGGGGTGGAGCTGTCAGGG + Intronic
1077486694 11:2841956-2841978 GTGTTGGGGTGGAGCTGACCAGG + Intronic
1078067213 11:8086341-8086363 GTGCTGGGGTGGAGATGAGGAGG + Intronic
1081991933 11:47342717-47342739 AGGACGGGGTGGAGCTGACCCGG - Exonic
1082085691 11:48047826-48047848 GGGGTGGGGTGGGGCTGACGTGG + Intronic
1083281022 11:61627435-61627457 GAGTTGGTCTGGAGCTGACGGGG - Intergenic
1084695010 11:70747599-70747621 CTGTTTGGGTGGGGCTGACCTGG + Intronic
1085465793 11:76722406-76722428 ATTTTGGAGTGGAGCTGACGGGG - Intergenic
1089050263 11:115539525-115539547 GTGTTTGGATGGAACAGACCCGG - Intergenic
1090657000 11:128853997-128854019 GTGTTTGGGTGAAGCAGTCCAGG + Intronic
1202810575 11_KI270721v1_random:25626-25648 GGGCTGGGCTGGAGCAGACCCGG - Intergenic
1091593383 12:1858623-1858645 GTTTGGGGGTGGTGCTGTCCCGG - Exonic
1092344774 12:7706130-7706152 GCGTTGGGGTGGGGCTGCCGGGG + Intergenic
1100972711 12:100088266-100088288 GTGTTGGGGTTGAGTTCAGCAGG - Intronic
1101473823 12:105024811-105024833 GTTTTGGTTTGAAGCTGACCAGG - Intronic
1102350793 12:112190731-112190753 GGGTGGGGGTGGAGCTGGCATGG - Intronic
1102577073 12:113862636-113862658 GTGTTGGGGCGAAGCTGCGCAGG + Intronic
1102578119 12:113869974-113869996 GTGTTGACGTGGAGCAGCCCTGG - Intronic
1103845415 12:123898831-123898853 GTGTTGGGGATGGGCTGCCCTGG - Intronic
1104728523 12:131092621-131092643 GCCTTGGGGTGGCTCTGACCTGG + Intronic
1104728875 12:131094283-131094305 GGGGTGGGGTGGAGCAGGCCTGG + Intronic
1106699441 13:32213270-32213292 GGGCTGGCGTGGAGATGACCTGG + Intronic
1113772029 13:112916582-112916604 GTGCAGGGGTGGAGCTCAACAGG - Intronic
1113923119 13:113925523-113925545 GTGCTTGGCTGGAGCTCACCAGG - Intergenic
1115912517 14:38272210-38272232 GTGTTGGGATTGAGCAGAGCAGG - Intergenic
1121743486 14:96269792-96269814 TTGCTGGGGTGGCGCTGTCCTGG - Intergenic
1122052111 14:99067381-99067403 GGGTTGGGGCTGAGCTGATCTGG - Intergenic
1122745337 14:103894331-103894353 GTGCAGGGCTGGAGGTGACCAGG + Intergenic
1122842493 14:104473253-104473275 GGGCTGGGGTGGAGCTGGCTGGG - Intergenic
1122900004 14:104778512-104778534 GGGTTGGGGTGGGGTTTACCAGG - Intronic
1125733311 15:41906599-41906621 GTGGTGGGGTCGAGCTGGACCGG + Intronic
1126255071 15:46615906-46615928 GTGTGGTGGTGGACTTGACCTGG + Intergenic
1128814907 15:70601334-70601356 GTGTGGGGGTGGAGGTTATCTGG + Intergenic
1131069473 15:89456703-89456725 CTGTTGGGATGGGGCTGTCCAGG + Intergenic
1133422142 16:5654935-5654957 TTGCTGGGGGGGAGCTGTCCTGG - Intergenic
1135474629 16:22763295-22763317 TTTTGGGGCTGGAGCTGACCAGG + Intergenic
1140942768 16:79737286-79737308 GGGTTGGGGAGGAGTTGTCCAGG - Intergenic
1141227237 16:82129531-82129553 GTGTTGGGATGGACCTTTCCTGG - Intergenic
1142282304 16:89154913-89154935 GGGCTGGTGTGGAGATGACCTGG - Exonic
1143029865 17:3961920-3961942 CTGCTGGGGTGGAGCTGATGAGG - Intronic
1143918872 17:10315101-10315123 GTGATGGGGAGGAGGTGCCCTGG + Intronic
1143977991 17:10844436-10844458 GGGTTGGGGTGGAGGAGACGAGG + Intergenic
1144676837 17:17167452-17167474 GTGTGGTGGAGCAGCTGACCAGG + Intronic
1145017001 17:19405769-19405791 ATGTTGGGGGAGGGCTGACCAGG + Intergenic
1147245270 17:39116160-39116182 GTCTTTGAGTGGAACTGACCTGG - Intronic
1147656653 17:42094975-42094997 GTGTCAGGGTGGGTCTGACCTGG + Intergenic
1147738859 17:42659164-42659186 GTGTTGGGGAGGAGAGGAACGGG - Intergenic
1148588717 17:48799487-48799509 AGGTGGAGGTGGAGCTGACCTGG - Intronic
1149573817 17:57697094-57697116 TTGATGGGGTGGGTCTGACCAGG - Intergenic
1149720648 17:58840786-58840808 GTGGTGGGTTGCAGCTGATCTGG + Intronic
1150292066 17:63987845-63987867 GTGTTGGGGTGGTTCTGAAAAGG - Intergenic
1151990742 17:77572454-77572476 TTTTGGGTGTGGAGCTGACCAGG - Intergenic
1153882553 18:9434039-9434061 GGGGTGGGGTGGAGCCGAGCTGG - Intergenic
1154492248 18:14931426-14931448 GAGGAGGGGTGGAGGTGACCAGG - Intergenic
1155841500 18:30650173-30650195 GTGTTGGCCTGAAGCTGAGCTGG + Intergenic
1156460278 18:37317874-37317896 GTGTGTGGGTGGATGTGACCGGG + Intronic
1157420725 18:47545709-47545731 GAGATGGGGTGGAGCTGATTAGG + Intergenic
1160393875 18:78558225-78558247 GTGTATGGGCTGAGCTGACCGGG - Intergenic
1160719930 19:592566-592588 GTGTTGAAGTGGAACTGAGCAGG + Intronic
1160779839 19:872823-872845 GTGTAGGGGTGGGGCTGAGAAGG + Intronic
1161017666 19:1991257-1991279 GTCTTGGGATGGAGCTGCCGGGG - Intronic
1161088071 19:2344196-2344218 GTGATGGGGTGGAGGTGAGCGGG - Intronic
1161165997 19:2787837-2787859 TTTCTGGGGTGGAGCTGTCCTGG - Intronic
1162046233 19:8002240-8002262 GCGGTGGGGAGGAGCTAACCAGG - Intronic
1162403742 19:10461387-10461409 GGGCTGGGGTAGAGCTGACTGGG + Intronic
1162524217 19:11197856-11197878 GGGAGGGGGTGGAGCTGGCCGGG + Intergenic
1162718768 19:12649432-12649454 GGGTTGGGGGTGAGCTGATCAGG + Intronic
1164995943 19:32720403-32720425 GTGTGGGGGTGGAGCTGGGTGGG - Intronic
1165105187 19:33464980-33465002 GGGAAGGGGTGGAGCTGAACTGG - Intronic
1165586728 19:36923305-36923327 GTGTTGGGGTGGAGATGAAACGG - Intronic
1166303256 19:41923810-41923832 GTGTTGGGAGGGAGCTGTGCTGG + Intronic
1166556671 19:43704623-43704645 GGGATGGGGTGGGGCTAACCTGG + Intergenic
1167357174 19:49011122-49011144 GTGGTGGGGTGGAGGTGGGCCGG + Intronic
1167612190 19:50512908-50512930 TGGTTGGGGTGGGGCTTACCAGG + Exonic
925907404 2:8547650-8547672 GACTTGGGGTGGGGCAGACCTGG - Intergenic
926118719 2:10229356-10229378 GGATTGGGGTGGAGCAAACCAGG + Intergenic
926245516 2:11120178-11120200 GTGATGGTGTTGACCTGACCAGG - Intergenic
926309167 2:11662108-11662130 GGCTGGGGGTGGAGCTGCCCGGG + Exonic
926931643 2:18046970-18046992 GCGATGGGGTGGAGCTGAGGAGG + Intronic
928171987 2:29010053-29010075 GTGTTGGGGGGGCGCAGAGCGGG + Intronic
930318334 2:49824237-49824259 GTTTTGGGGTTGAGATGACAGGG + Intergenic
930535585 2:52642468-52642490 GTGTTAGCGTGGAGCTCAGCTGG + Intergenic
931152662 2:59592241-59592263 GTGTTGGGGTGGGGTGGACATGG - Intergenic
932330100 2:70893949-70893971 GTGTTGGTGGGGAGGTTACCAGG + Intergenic
932572508 2:72945470-72945492 GAGTTGAGGTGGAGCAGCCCTGG - Intronic
933803327 2:85980336-85980358 AGGTTAGGGTGGAGGTGACCAGG - Intergenic
933832446 2:86221922-86221944 CTGCTGGGGTGGAGCTGGCCAGG - Intronic
935419471 2:102852630-102852652 ATGGTGCTGTGGAGCTGACCTGG + Intergenic
936373511 2:111922101-111922123 GGGGTGGGGTGGAACTGAACAGG + Intronic
937240026 2:120454016-120454038 GTGCAGCAGTGGAGCTGACCTGG - Intergenic
944620875 2:201514982-201515004 GTTTAGGGGTGCATCTGACCTGG - Intronic
945150159 2:206782244-206782266 GCTTTGGGGAGGGGCTGACCTGG + Intronic
946014274 2:216591520-216591542 GCATTGGGGTGGAGCTGGCATGG - Intergenic
948813566 2:240498473-240498495 CTGTGGGGGTGGAGCTGAGGGGG + Intronic
948813578 2:240498508-240498530 CTGTGGGGGTGGAGCTGAGGGGG + Intronic
948813754 2:240499395-240499417 ATGTGGGGGTGGGGGTGACCAGG + Intronic
948828960 2:240588198-240588220 GTCTTCAGGTGGAGCTGTCCTGG + Intronic
1169023777 20:2350038-2350060 GTTTTGAGATGGGGCTGACCTGG - Intergenic
1170624668 20:18021981-18022003 GTGATGGGGTGTAGATGACTGGG + Intronic
1170624711 20:18022185-18022207 GTGGTGGGGTGTAGATGATCGGG + Intronic
1170624951 20:18023319-18023341 GTGATGGGCTGTTGCTGACCAGG + Intronic
1172885303 20:38227094-38227116 TTGTTGGGCTCGAGCTGAGCTGG - Intronic
1173750054 20:45469679-45469701 GGGTAGGGGTGGAGCCGAGCGGG - Intergenic
1175954002 20:62598952-62598974 GTGTTGGGCTGGATGTGACTGGG + Intergenic
1179276232 21:39894084-39894106 GTGTCGGGCTGGAGATGATCAGG + Intronic
1180910937 22:19449465-19449487 GTGTTGGAGGGGCCCTGACCAGG + Intergenic
1182648523 22:31830367-31830389 ATGTTGGGTTGGAGCAGAGCTGG + Intronic
1183496222 22:38145749-38145771 GAGTCGGGCTGGAGCTGGCCAGG - Intronic
1183773935 22:39950243-39950265 ATGTTGGGGAGGAGCTGAAGAGG - Intronic
1184889352 22:47369967-47369989 GGGTTGGGGTGGAGAGGCCCTGG - Intergenic
950137600 3:10592693-10592715 GTGTTTGGGTTGAGCAGACAGGG - Intronic
950672732 3:14536913-14536935 GTGCTGGAGTGGAGCTGGCCAGG - Intronic
951906790 3:27714600-27714622 GTGTGGGGAAGGCGCTGACCAGG + Intergenic
951941952 3:28088974-28088996 GTGTTGGGGTGGGGCCTCCCCGG - Intergenic
953742223 3:45547702-45547724 GTGCTGGGGTGAAGGTGAGCTGG + Exonic
954798375 3:53172914-53172936 GGGGTGGGGTGGAGGGGACCAGG + Intronic
957254128 3:77814551-77814573 GTGCTGGCATGGAGCTGACCAGG - Intergenic
960672449 3:120166445-120166467 GTGTAGGGGTGGCTCTGAGCTGG + Exonic
961677843 3:128578430-128578452 GTGGTGGGGTGGAGGTGCCCTGG - Intergenic
962391456 3:134976114-134976136 GTGTGTGTGTGGATCTGACCTGG - Intronic
967856162 3:194119089-194119111 GTGTTGGGGTGGTGGTTGCCTGG + Intergenic
969625356 4:8302157-8302179 GGGTTGGGTTGGAGCTCAGCTGG + Intronic
970789711 4:19842680-19842702 GTGATTGAGTGGTGCTGACCTGG - Intergenic
976146999 4:82051780-82051802 GGGATGGGGTGGATCTGATCTGG - Intergenic
976154543 4:82128553-82128575 GAGTTGGGCTGGGGGTGACCCGG - Intergenic
978218854 4:106244687-106244709 GTGTTTGGCTGGAGGTGACTTGG - Exonic
979224696 4:118271552-118271574 GTGCTGGTATGGAGCTGACAGGG - Intergenic
980213063 4:129814521-129814543 GTGTGGAGGTGGAACTGATCAGG - Intergenic
984743771 4:183193628-183193650 GTGTTGGGGATGAGCTGCCGTGG + Exonic
985083825 4:186293077-186293099 GAGTTGGGGTGGGGCTCACAGGG - Intergenic
985683861 5:1271536-1271558 GGGTGGGGGTGGAGGTGGCCTGG - Intronic
986293126 5:6416306-6416328 GTGAGGGCATGGAGCTGACCTGG + Intergenic
986846538 5:11762981-11763003 GTGTTGGGGTGGATCTGAGTAGG + Intronic
987182290 5:15380538-15380560 GTGTAGCAGTGGAGGTGACCTGG + Intergenic
990867758 5:60398889-60398911 GTGTTGGGGTTGGACAGACCTGG - Intronic
990963124 5:61415639-61415661 GTGTTGGGATGGATATGACATGG + Intronic
996447152 5:123568122-123568144 GTGTTGTGGTGGAGATGAATTGG + Intronic
999933431 5:156458456-156458478 GTGTTGGGGATGAGCTGCCATGG - Intronic
1002377850 5:178801075-178801097 GATGTGGGGAGGAGCTGACCGGG + Intergenic
1002441167 5:179265284-179265306 GTTCAGGGGTGGAGCCGACCAGG - Intronic
1003806459 6:9730498-9730520 GTGTTGGGGTGGAGTTGGGATGG + Intronic
1011515482 6:88148181-88148203 GTGATGGGGAGGAGTTGACCAGG - Intronic
1019276891 7:180394-180416 CTGTTGGAGCGGACCTGACCTGG + Intergenic
1019347244 7:537222-537244 GTGCTGGGGTGGGGCTTCCCAGG - Intergenic
1021068225 7:16203315-16203337 AAGTTTGGGTGGAGCTGACCTGG + Intronic
1022440269 7:30427439-30427461 GGGTTGTGGTTGAGCTGGCCGGG - Intronic
1024987341 7:55206752-55206774 GGGTTTGGGGGCAGCTGACCTGG - Exonic
1025239085 7:57256676-57256698 CTGTGGGCGTGGAGCTGTCCCGG + Intergenic
1026489573 7:70851113-70851135 GTTTAGGTCTGGAGCTGACCAGG - Intergenic
1026630523 7:72033851-72033873 TTGGTGGGGTAGAGCTGACTGGG + Intronic
1026635156 7:72075669-72075691 GTGCAGGGATGGAGCTGAGCAGG - Intronic
1027188584 7:75985544-75985566 GTGTGGCGGTGGAGCTCACACGG + Intronic
1027199437 7:76053905-76053927 GTGATGGGGTGAAAGTGACCCGG - Intronic
1029590251 7:101502602-101502624 GAGTTGGGCTGGAGCTGGGCTGG + Intronic
1033114577 7:138613948-138613970 GTGGTGTGCTGGAGCTGGCCTGG - Intronic
1036910360 8:12754024-12754046 GGCTTGGGGCGGAGCTGCCCAGG - Intronic
1038295375 8:26287458-26287480 GTGTTGGGGTGGGGGTGGCGGGG + Intergenic
1038411320 8:27361833-27361855 GTGTGGGTGTGGAGCGGAGCAGG - Intronic
1040573219 8:48627504-48627526 GGGTTGGGGTGGAGAGGCCCAGG + Intergenic
1045304960 8:100951158-100951180 GTTTTGGGGTGGGGCTCGCCTGG - Intronic
1047335786 8:123934757-123934779 GTGTTGGGGGGGAGGGGTCCTGG + Intronic
1049180768 8:141220895-141220917 GTGTGGGGGTGCGGCTGCCCTGG - Intronic
1049234776 8:141507051-141507073 CTGCTGGGGTTGAGCTGACCTGG + Intergenic
1049271049 8:141696457-141696479 GTGTTGGGGTGGAGCATGTCGGG + Intergenic
1049674075 8:143882122-143882144 GTGTTGGGGTGGGGCAGAGAGGG - Intergenic
1049724986 8:144141708-144141730 GTCATGGGGTGGTGCTCACCTGG + Intergenic
1051149033 9:14060772-14060794 GTGTTGGGGTGGGGGTTACGTGG + Intergenic
1053270665 9:36747256-36747278 GCTTTGGGGTCCAGCTGACCTGG + Intergenic
1053477527 9:38393019-38393041 GTGTTGAGGTCGAGCTAACGTGG - Intronic
1055504079 9:76930510-76930532 GTATTGGTGTGGAGCTGTCAGGG + Intergenic
1057884203 9:98817290-98817312 GTGTTGAGTTGTAGCTCACCAGG - Intronic
1058503683 9:105647822-105647844 GTGTTGGGGTGGGCAGGACCAGG - Intergenic
1058888507 9:109341483-109341505 TTGTTGGGGTGGGACTGATCAGG - Intergenic
1059264328 9:113011959-113011981 GTGGAGGGGTGGTGGTGACCTGG - Intergenic
1060265411 9:122109036-122109058 GTGGTGGGTTGTTGCTGACCTGG - Intergenic
1060268749 9:122127070-122127092 GTGCTGGGGTGGAGGGGGCCCGG + Intergenic
1060663020 9:125415541-125415563 GTGCTGGGGTGGCCCTGACTCGG - Intergenic
1060849402 9:126861320-126861342 GGGCTGGGCTGGGGCTGACCGGG + Intronic
1061366001 9:130172695-130172717 AAGTTGTGGAGGAGCTGACCAGG + Exonic
1061667359 9:132168371-132168393 GGTTTGTGGTGGGGCTGACCCGG + Intronic
1062341019 9:136094115-136094137 GTGTGGCGGGGGTGCTGACCCGG - Intronic
1062446943 9:136599068-136599090 ATGTTGGGGTGGGGCTCACAAGG + Intergenic
1062599127 9:137312212-137312234 GGGGTGGGGTGGAGGTGCCCAGG - Intronic
1186507025 X:10101585-10101607 CAGTTGGCCTGGAGCTGACCTGG - Intronic
1186566669 X:10670526-10670548 GTTGTTGGGTGGAGCTGCCCTGG - Intronic
1189929059 X:45988640-45988662 ATGTTGTGGTAGAGCTGCCCAGG - Intergenic
1190109099 X:47578567-47578589 GTGTTGGGGTGGGAGTGCCCAGG - Intronic
1190137251 X:47808064-47808086 CTGCTGGGGTCCAGCTGACCTGG + Intergenic
1190218188 X:48493773-48493795 TTTTTGGGGTGAAGCTGATCAGG - Intergenic
1190290403 X:48988650-48988672 GAGTTTGGGTGGATCTCACCTGG - Intronic
1199767988 X:150954300-150954322 GTGTTGGGGCGGATCTGTCTAGG + Intergenic
1200241471 X:154496902-154496924 GTGCTGGGATGGACCTGTCCTGG + Intergenic
1201621944 Y:15968943-15968965 GTGTTGGGAAAGAGCTGAACAGG + Intergenic