ID: 1077487971

View in Genome Browser
Species Human (GRCh38)
Location 11:2847846-2847868
Sequence TCTGGGGGGGCCGCCGCTGC CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 212
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 198}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077487971_1077487983 9 Left 1077487971 11:2847846-2847868 CCGGCAGCGGCGGCCCCCCCAGA 0: 1
1: 0
2: 0
3: 13
4: 198
Right 1077487983 11:2847878-2847900 GCCCACATCACCCAGCCCTGCGG 0: 1
1: 0
2: 3
3: 39
4: 385
1077487971_1077487986 15 Left 1077487971 11:2847846-2847868 CCGGCAGCGGCGGCCCCCCCAGA 0: 1
1: 0
2: 0
3: 13
4: 198
Right 1077487986 11:2847884-2847906 ATCACCCAGCCCTGCGGCAGTGG 0: 1
1: 0
2: 0
3: 20
4: 253
1077487971_1077487987 18 Left 1077487971 11:2847846-2847868 CCGGCAGCGGCGGCCCCCCCAGA 0: 1
1: 0
2: 0
3: 13
4: 198
Right 1077487987 11:2847887-2847909 ACCCAGCCCTGCGGCAGTGGCGG 0: 1
1: 0
2: 1
3: 34
4: 356

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077487971 Original CRISPR TCTGGGGGGGCCGCCGCTGC CGG (reversed) Exonic
902081022 1:13820748-13820770 TCTGGGGAGGCCACAGCAGCAGG - Intronic
902972427 1:20063480-20063502 TCTGGAGGGGCAGCCTCTCCTGG - Intronic
904006594 1:27366327-27366349 GCTGCGGGGGCGGCCGCGGCCGG + Exonic
904482686 1:30804063-30804085 TCTGGGGGGCCCTCTGCTTCTGG - Intergenic
905276111 1:36819318-36819340 TCTGGGTGGGAGGCCACTGCAGG - Intronic
905358894 1:37404698-37404720 TCTGGGGGGGCCCCCAGTGATGG - Intergenic
906295181 1:44645214-44645236 GCTGGGAGGGCCGCCACTGGAGG - Exonic
909622461 1:77683343-77683365 GCTCGGGTGGCCACCGCTGCAGG + Intronic
909988743 1:82195275-82195297 TTTGGGGGGGCCGAGGCTGGAGG - Intergenic
913267510 1:117059806-117059828 CCAGGGGAAGCCGCCGCTGCAGG - Intergenic
914758377 1:150579441-150579463 GCGGGTGGCGCCGCCGCTGCCGG + Exonic
915578439 1:156797299-156797321 TCTGGTGTTTCCGCCGCTGCTGG - Exonic
917655287 1:177119878-177119900 ACTGAGGGGGCAGCCTCTGCTGG - Intronic
918066548 1:181105452-181105474 TGTGGGGAGGCGGCCGCGGCGGG + Intergenic
922977850 1:229799856-229799878 TCTGGGGTGGCCCCTGCAGCTGG - Intergenic
924159776 1:241218902-241218924 TCTGGGGATGCTGCTGCTGCTGG + Intronic
1070162236 10:73873722-73873744 TCTGGGGGGGCGGGCGGGGCGGG + Intronic
1071499471 10:86193216-86193238 GCTGGGGGGACCCCAGCTGCAGG - Intronic
1073331525 10:102673040-102673062 GCTGGGGGGGCTGAGGCTGCTGG + Intergenic
1074995525 10:118754585-118754607 TCCGGGGGGGCAGCTGCTGGCGG - Exonic
1075119135 10:119651592-119651614 TCTGGCCGGGCCGCCGCCGTGGG - Exonic
1075697598 10:124448049-124448071 TCCGAGGAGGCCGCGGCTGCGGG - Exonic
1076769400 10:132654838-132654860 TGTGGGGGGGACGCGGCTGAGGG + Intronic
1076828835 10:132983984-132984006 TCTGGGGGGCTCCCCGCTGCTGG + Intergenic
1076848911 10:133083523-133083545 TTTGGAGGGGCCGTGGCTGCCGG - Intronic
1077158260 11:1101114-1101136 TCTGTGGGGACCTCCGCTGTGGG + Intergenic
1077234240 11:1472257-1472279 CCTGCGGGGGCGGCCGCTGTGGG - Intronic
1077487971 11:2847846-2847868 TCTGGGGGGGCCGCCGCTGCCGG - Exonic
1081528564 11:43943033-43943055 ACTGGCGCGGCCGCCGCAGCCGG - Exonic
1083189034 11:61036349-61036371 TCTGGGAGGGCAGCCTCTCCTGG - Intergenic
1083202767 11:61130489-61130511 TCTGGTGGGCCCGGGGCTGCTGG - Exonic
1083888647 11:65584979-65585001 TCTGGGCGTGTCGCGGCTGCTGG + Exonic
1083997150 11:66278254-66278276 TCGGGGGGCGCGTCCGCTGCCGG - Exonic
1084086524 11:66857556-66857578 TCTGGGGGGCCTGGCCCTGCAGG + Exonic
1084654161 11:70505577-70505599 TCTGGGCGGGCCCCCAGTGCCGG + Intronic
1084706844 11:70820629-70820651 TGTTGGGGGGCCGCCGCCGGCGG + Intronic
1087404803 11:97717559-97717581 CCTGAGCGGGCTGCCGCTGCTGG + Intergenic
1088920199 11:114254941-114254963 CCCGGGGAGGCCGCAGCTGCTGG - Intergenic
1095603148 12:44037448-44037470 TCTGGAGGGGCCGAGGCGGCAGG - Intronic
1096995068 12:55833249-55833271 GCTGGTGGGGCTGGCGCTGCTGG + Intergenic
1097186062 12:57197127-57197149 GCTGTGGGGGTCGCCGCCGCGGG - Exonic
1101970453 12:109309130-109309152 CCTCGCGGGGCCGCCGCTGCCGG + Exonic
1102122077 12:110449795-110449817 TCCGGGATGGCCGCCGCTGCCGG + Intronic
1102576312 12:113858290-113858312 TCTGTGAGGGCAGCCCCTGCAGG - Intronic
1105767924 13:23579345-23579367 TCTGGGGTGGCGGCCGTTGCCGG + Exonic
1110573065 13:77026937-77026959 GCGCGGGGGGCCGCGGCTGCGGG - Exonic
1111940496 13:94601927-94601949 CATGGGGGGGCTGCGGCTGCTGG + Exonic
1113856108 13:113446235-113446257 TCTGGGGGGTTTGCAGCTGCAGG - Intronic
1119225610 14:72942650-72942672 TCTGGAGGGCACTCCGCTGCTGG - Intronic
1119602509 14:75986000-75986022 ACTGTGGGCTCCGCCGCTGCTGG + Intronic
1123033497 14:105462114-105462136 TCTCGGGGGGCTGCGGCTGCGGG + Intronic
1124256525 15:28147022-28147044 TCTGGGGGGGCCGCAGGAGGTGG + Intronic
1124328676 15:28788950-28788972 TCAGGGGGGCCCGCCACTTCAGG + Intergenic
1124567705 15:30832071-30832093 TCTGGGGGGGCCGCAGGAGGTGG - Intergenic
1125601665 15:40918887-40918909 TCTGGGGGGGAGGGTGCTGCAGG - Intergenic
1129108176 15:73323040-73323062 TCTGGGGGGGCTTCCCCTGTAGG - Exonic
1129261835 15:74373075-74373097 CCTTGGGAGGCCCCCGCTGCGGG + Intergenic
1132170667 15:99650799-99650821 TCTGGGGCTGCTGCTGCTGCTGG - Intronic
1132252139 15:100341905-100341927 TCCGGGGGGGCTGCCGGTCCCGG - Exonic
1132518267 16:375975-375997 TGTTGGGGGGCCTCCCCTGCTGG - Intronic
1132888775 16:2194303-2194325 TCTGGGGGAGATGCCGGTGCAGG - Intronic
1134163923 16:11915422-11915444 ACTGGGGGTGGCGGCGCTGCCGG + Exonic
1135672217 16:24385114-24385136 GCTGGGAGGCCCGCCACTGCGGG + Intergenic
1136517329 16:30775847-30775869 TTAAGCGGGGCCGCCGCTGCTGG + Exonic
1139825600 16:69754794-69754816 TCTGGGCTGGCCGCCCCTCCCGG - Intronic
1142125665 16:88409082-88409104 TCTGGGGGCCCCTCTGCTGCAGG + Intergenic
1142132484 16:88437366-88437388 CCTGGGGGGGCCCGGGCTGCCGG - Exonic
1142178950 16:88657930-88657952 TGTGGGGCAGCCGCGGCTGCAGG - Exonic
1142248076 16:88978877-88978899 TCTGTGGGGGGCGCAGGTGCAGG - Intergenic
1142553077 17:752634-752656 TCTGGAGGGGGCGGCGCGGCAGG - Intronic
1143119218 17:4596819-4596841 GCTGGAGGGGCCCCCGCAGCAGG + Intronic
1145034837 17:19533799-19533821 TCTGGGCGGGCGGCCGGGGCGGG + Intronic
1146183256 17:30710020-30710042 TCCGTGGGGGCCGCCCCTCCCGG - Intergenic
1146570255 17:33946317-33946339 TCTGGGGGGCCCGAGGCTGGAGG + Intronic
1147058082 17:37849823-37849845 TCTGGGTGGGGCGCCGAGGCAGG - Intergenic
1148238233 17:45983395-45983417 CCAGGAGGGGCCGCCGCTGAAGG + Exonic
1149654457 17:58302924-58302946 CCTGGGGGGGCCACATCTGCTGG - Intronic
1150337727 17:64342593-64342615 TCTGGGGGGGTCCCTGGTGCTGG + Intronic
1152037050 17:77880056-77880078 GCTGGGGGGCCCAGCGCTGCCGG + Intergenic
1152128414 17:78461274-78461296 TCTGGTGAGGCTGCCGCTGTAGG + Intronic
1152811495 17:82384816-82384838 TCAAGGCGGCCCGCCGCTGCAGG + Intergenic
1152883426 17:82833618-82833640 TCTGGACGGGCAGGCGCTGCTGG - Intronic
1160798226 19:955374-955396 CCTGCGGGGGCCCCAGCTGCTGG - Intronic
1160912664 19:1482032-1482054 CCTCGGGGAGCCGCCGCGGCAGG + Exonic
1161482158 19:4516663-4516685 TCTGGGTGGGCAGCCACTGTGGG + Exonic
1161574285 19:5047336-5047358 CCTGGGGGGGCCGCAGATACTGG + Intronic
1162739083 19:12763726-12763748 TCTGGAGGTGCCCCCGCAGCTGG + Exonic
1163152621 19:15424229-15424251 TCTGGGGGGGCCGGGGCACCAGG + Exonic
1167266557 19:48485652-48485674 TCTGGGGAGGCCCCCGAGGCTGG - Exonic
1167314021 19:48753394-48753416 TCAGCGGGGGCCGTGGCTGCCGG + Exonic
1168283767 19:55320512-55320534 TTTGGGGGGATCGCCGCTGCAGG - Intronic
925310771 2:2880009-2880031 TCTGGGGAGTCCCCCACTGCGGG + Intergenic
927448421 2:23185944-23185966 TGTGGGGAGGCCGTCTCTGCAGG - Intergenic
927937970 2:27086129-27086151 TCTGGGCGCGGTGCCGCTGCGGG - Exonic
932323631 2:70839644-70839666 TCTGGGGCAGCCTCCTCTGCCGG - Intergenic
941905965 2:170716343-170716365 TCCGGGGGCGCCGCCGCGCCCGG - Exonic
943222844 2:185132774-185132796 GCTGGGGGGGCCGGCACTGCTGG - Intergenic
944506657 2:200419336-200419358 TCTGTGGTGGCTGCGGCTGCAGG - Exonic
946228722 2:218278764-218278786 TCTGGGGAGGCTGCAGCTGACGG + Intronic
946395083 2:219439654-219439676 TCTGGGTGGGCCTCCCCAGCTGG - Intronic
948785684 2:240351488-240351510 TCTGGGCGGGCTCCCACTGCTGG - Intergenic
949010388 2:241675006-241675028 TCTGTGGGGGCAGCAGCTGTGGG - Intergenic
1168750743 20:279402-279424 TCTGGCGGGGCCGGGGCGGCGGG - Intronic
1168773431 20:430363-430385 CCAGCGGGGGCTGCCGCTGCAGG + Exonic
1171247773 20:23626519-23626541 TCTGGTGGTGCTGCTGCTGCTGG + Intergenic
1171464005 20:25315277-25315299 TCTGGGGCGGCCTCCTCTGGAGG + Intronic
1173652057 20:44672703-44672725 TCTGTGCGGGCCCCCGCTGGAGG + Intergenic
1173939135 20:46894995-46895017 CCTGGGGTGGGCGCCGCTGGCGG - Intronic
1175466523 20:59193741-59193763 TCTGCGGGGGCTGGGGCTGCAGG - Exonic
1175894301 20:62329294-62329316 TCTGGGGGCCTCCCCGCTGCAGG - Intronic
1179616363 21:42585987-42586009 TCTGGAGGGGCAGCCTCTCCGGG + Intergenic
1180025818 21:45161494-45161516 TCTGGGGGTGCCGAGGCAGCAGG - Intronic
1180191650 21:46168264-46168286 CCTGGGGGGGCCCCCAGTGCAGG - Intronic
1180823640 22:18848412-18848434 TCTGGGGGAGCCACCCCTGGGGG - Intronic
1181037969 22:20179031-20179053 TCTGGGGAGGCGGCCGCTCAGGG + Intergenic
1181155403 22:20917201-20917223 GCTGGGGGCGCTGCGGCTGCCGG - Intergenic
1181189099 22:21126134-21126156 TCTGGGGGAGCCACCCCTGGGGG + Exonic
1181210101 22:21284361-21284383 TCTGGGGGAGCCACCCCTGGGGG - Intergenic
1181649995 22:24253484-24253506 TCTGGGGGAGCCACCCCTGGAGG - Intergenic
1181707382 22:24657262-24657284 TCTGGGGGAGCCACCCCTGGGGG + Intergenic
1182008949 22:26984428-26984450 TCTGGGGGGGCAGCCGGTGGTGG + Intergenic
1183838727 22:40479399-40479421 TCTGGGGCATCCGCTGCTGCTGG + Intronic
1184651235 22:45920312-45920334 ACCGGTGGGGCCGCAGCTGCAGG + Intergenic
1184850438 22:47116637-47116659 TCTGTGGGAGCCCCAGCTGCTGG + Intronic
1203273783 22_KI270734v1_random:74318-74340 TCTGGGGGAGCCACCCCTGGGGG - Intergenic
953901405 3:46846022-46846044 TCTGCGGAGGCCTCCCCTGCAGG + Intergenic
956684533 3:71812559-71812581 TCTGGGGCAACCGCTGCTGCTGG + Intergenic
956747272 3:72319924-72319946 TGTGGGTGGGCAGCCACTGCAGG + Intergenic
958788397 3:98623730-98623752 TCTGGGGAGGCAGCAGCTCCAGG - Intergenic
961662865 3:128479655-128479677 TATGGGCGGGCAGTCGCTGCAGG - Exonic
966646166 3:182248184-182248206 TCTGGGTGGGCCGAAGCTGATGG - Intergenic
967889391 3:194354317-194354339 TCTGGGGGTGCCACAGCTGCTGG - Intergenic
968585673 4:1414897-1414919 TCTGGGGGGAGGGCAGCTGCGGG - Intergenic
969609032 4:8216837-8216859 ACTGGGGGGGCCGCTCCTGTGGG + Intronic
969716279 4:8869816-8869838 TAAGGGGGAGCCGCCTCTGCAGG + Intronic
970191435 4:13522847-13522869 TCTGGGGGCGCCAGGGCTGCCGG + Intergenic
974047269 4:56908350-56908372 CCCGGCGGGGCCGCCGCCGCCGG - Intronic
975779093 4:77820043-77820065 GCTGGGGCTGCCGCCGCTGCGGG + Intergenic
980920914 4:139084467-139084489 GCTGTGGCGGCCGCCGCAGCTGG + Intronic
983238709 4:165207708-165207730 GCCGCGGGGGCCGCCGCCGCAGG + Intronic
985064192 4:186105167-186105189 TCGGGAGGTGCTGCCGCTGCAGG + Intronic
985279448 4:188270817-188270839 GCTGGTGGGGCTGCTGCTGCTGG - Intergenic
985670600 5:1204660-1204682 GCTGGGGGGGCAGCCCCTGAGGG - Intronic
987708226 5:21481813-21481835 TCTGGGGGAGCCACCCCTGGGGG + Intergenic
987708403 5:21482629-21482651 TCTGGGGGAGCCACCCCTGGGGG + Intergenic
988751006 5:34190583-34190605 TCTGGGGGAGCCACCCCTGGGGG - Intergenic
988751210 5:34191519-34191541 TCTGGGGGAGCCACCCCTGGGGG - Intergenic
988751380 5:34192326-34192348 TCTGGGGGAGCCACCCCTGGGGG - Intergenic
988751552 5:34193142-34193164 TCTGGGGGAGCCACCCCTGGGGG - Intergenic
990039083 5:51357552-51357574 TCTCGGGGGGTCCACGCTGCTGG - Intergenic
991371690 5:65925992-65926014 TCTCGGGGAGCCACCGCCGCTGG + Intergenic
991736347 5:69633440-69633462 TCTGGGGGAGCCACCCCTGGGGG - Intergenic
991736519 5:69634253-69634275 TCTGGGGGAGCCTCCCCTGGGGG - Intergenic
991736696 5:69635069-69635091 TCTGGGGGAGCCACCCCTGGGGG - Intergenic
991736869 5:69635888-69635910 TCTGGGGGAGCCACCCCTGGGGG - Intergenic
991758546 5:69900890-69900912 TCTGGGGGAGCCTCCCCTGGGGG + Intergenic
991758717 5:69901703-69901725 TCTGGGGGAGCCACCCCTGGGGG + Intergenic
991812843 5:70489079-70489101 TCTGGGGGAGCCACCCCTGGGGG - Intergenic
991813021 5:70489898-70489920 TCTGGGGGAGCCACCCCTGGGGG - Intergenic
991813194 5:70490717-70490739 TCTGGGGGAGCCACCCCTGGGGG - Intergenic
991815801 5:70509556-70509578 TCTGGGGGAGCCACCCCTGGGGG - Intergenic
991815973 5:70510369-70510391 TCTGGGGGAGCCTCCCCTGGGGG - Intergenic
991816149 5:70511179-70511201 TCTGGGGGAGCCACCCCTGGGGG - Intergenic
991816326 5:70511998-70512020 TCTGGGGGAGCCACCCCTGGGGG - Intergenic
991837775 5:70775956-70775978 TCTGGGGGAGCCTCCCCTGGGGG + Intergenic
991837946 5:70776769-70776791 TCTGGGGGAGCCACCCCTGGGGG + Intergenic
992399932 5:76403099-76403121 TGTGCGGGGGCCCCAGCTGCAGG + Intergenic
994420300 5:99522824-99522846 TCTGGGGGAGCCACCCCTGGGGG + Intergenic
994486572 5:100390671-100390693 TCTGGGGGAGCCACCCCTGGGGG - Intergenic
994486740 5:100391490-100391512 TCTGGGGGAGCCACCCCTGGGGG - Intergenic
994608839 5:102009383-102009405 TCAGGGAGGGCTGCTGCTGCTGG + Intergenic
1001354287 5:171004756-171004778 TCTGTGTGGGCCCCCGCTGGAGG - Intronic
1002204505 5:177553778-177553800 GCTGAGGGGGCCGCGGCTGCAGG + Intronic
1003567158 6:7231082-7231104 TCCGGGGTGGCCGCCGGAGCAGG - Exonic
1004424151 6:15496488-15496510 GGTGGGGGGGCGGCAGCTGCGGG + Exonic
1005882432 6:30071516-30071538 TCGGGGCCGGCCGCCACTGCTGG - Exonic
1006759707 6:36449119-36449141 TCTGAGCGGGCTGCTGCTGCTGG + Intronic
1006846555 6:37066019-37066041 TCTAGATGGGCTGCCGCTGCAGG - Intergenic
1007927656 6:45663282-45663304 CCTGGGGGCGCCGAGGCTGCGGG - Intronic
1008598403 6:53065548-53065570 GCTGGGGTGGCGGCGGCTGCCGG - Intronic
1009486672 6:64232632-64232654 TCTGGGGGGGCCGAGGCTGGTGG - Intronic
1011806211 6:91075326-91075348 TCTGGGGGTGCTGATGCTGCTGG + Intergenic
1018618108 6:165707219-165707241 ACTGGGGGAGCCGCAGCAGCTGG - Intronic
1018619346 6:165715077-165715099 TCTCGGGCGGCCGTCCCTGCAGG - Intronic
1018719744 6:166563470-166563492 TCTGGGGGAGCCGCAGCCCCTGG - Intronic
1019159912 6:170062866-170062888 GCTGGGAGGGAAGCCGCTGCAGG - Intergenic
1023638419 7:42236481-42236503 GCCGCGGGGGCCGCCGCCGCTGG - Intronic
1024084933 7:45885025-45885047 TCTGAGGGGGCAGCCGCAGGAGG + Intergenic
1033017406 7:137685696-137685718 TCAGAGGGGGCAGCTGCTGCAGG + Intronic
1033551672 7:142453003-142453025 TCTACGGGGGCCACCCCTGCAGG + Intergenic
1033553959 7:142471847-142471869 TCTATGGGGGCCACCCCTGCAGG + Intergenic
1034818788 7:154197917-154197939 CCTGGGTGGGCCGCTCCTGCTGG - Intronic
1035813687 8:2515230-2515252 CCTGGGGGAGCCCCCACTGCAGG - Intergenic
1037585325 8:20271901-20271923 CCTGGTGGGGCAGCCGCAGCTGG + Intronic
1039621086 8:38997276-38997298 TCGGGGGGCGCGGCCGCTCCAGG + Intronic
1049211259 8:141387412-141387434 TCTAGGGGGGCTCCCGCTGCAGG + Intergenic
1049405437 8:142450077-142450099 GCCGGCGGGGCCGCTGCTGCTGG + Exonic
1049414291 8:142488290-142488312 TGTGGCGGGGCCTCAGCTGCGGG - Intronic
1049514887 8:143049006-143049028 ACTGAGGTGGCCCCCGCTGCTGG - Intronic
1049694743 8:143977663-143977685 TCTGCGGGCGCCCCCTCTGCGGG - Exonic
1052318176 9:27138230-27138252 TCTGAGCGGGTTGCCGCTGCTGG + Intronic
1052362128 9:27573107-27573129 GCTGGGAGCGCTGCCGCTGCGGG - Intronic
1053135878 9:35650030-35650052 CCTGAGGAGGCCGCAGCTGCAGG + Exonic
1057314604 9:93960387-93960409 TCTGCGGGAGCCGCCGGGGCTGG - Intergenic
1057910388 9:99015682-99015704 TCTGGGTGGGCAGCTGCTGGAGG + Intronic
1058635953 9:107038848-107038870 TATGGGGAGGCAGCCACTGCTGG - Intergenic
1061501978 9:131009232-131009254 TCTGCTGGGGCTGGCGCTGCTGG + Exonic
1061853310 9:133428660-133428682 GCTGGGGCCGCAGCCGCTGCCGG - Exonic
1062491715 9:136808094-136808116 TCCGGGGGGGCCGGGGCCGCCGG + Exonic
1062592082 9:137278717-137278739 GCTCGGGGGGCCGCGGCAGCAGG - Exonic
1203778671 EBV:88445-88467 CCTGGGGGGGCGGCGGCTCCTGG - Intergenic
1199500410 X:148500793-148500815 GCTGCGGCGGCAGCCGCTGCGGG - Exonic