ID: 1077489652

View in Genome Browser
Species Human (GRCh38)
Location 11:2854990-2855012
Sequence TCTCCCAGAACAGCCGAGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077489646_1077489652 -6 Left 1077489646 11:2854973-2854995 CCCAAATGCCATCCAGTTCTCCC No data
Right 1077489652 11:2854990-2855012 TCTCCCAGAACAGCCGAGGGAGG No data
1077489647_1077489652 -7 Left 1077489647 11:2854974-2854996 CCAAATGCCATCCAGTTCTCCCA No data
Right 1077489652 11:2854990-2855012 TCTCCCAGAACAGCCGAGGGAGG No data
1077489645_1077489652 -5 Left 1077489645 11:2854972-2854994 CCCCAAATGCCATCCAGTTCTCC No data
Right 1077489652 11:2854990-2855012 TCTCCCAGAACAGCCGAGGGAGG No data
1077489639_1077489652 29 Left 1077489639 11:2854938-2854960 CCTGAGTCAGCACAGGTGACCAG No data
Right 1077489652 11:2854990-2855012 TCTCCCAGAACAGCCGAGGGAGG No data
1077489644_1077489652 10 Left 1077489644 11:2854957-2854979 CCAGAGAGGGAAGGGCCCCAAAT No data
Right 1077489652 11:2854990-2855012 TCTCCCAGAACAGCCGAGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077489652 Original CRISPR TCTCCCAGAACAGCCGAGGG AGG Intergenic
No off target data available for this crispr