ID: 1077491078

View in Genome Browser
Species Human (GRCh38)
Location 11:2861367-2861389
Sequence GTTATGAGGAGGTTTCCTGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077491078_1077491086 -4 Left 1077491078 11:2861367-2861389 CCTTCAGGAAACCTCCTCATAAC No data
Right 1077491086 11:2861386-2861408 TAACCCTCAGGCTGGGTCCGGGG No data
1077491078_1077491085 -5 Left 1077491078 11:2861367-2861389 CCTTCAGGAAACCTCCTCATAAC No data
Right 1077491085 11:2861385-2861407 ATAACCCTCAGGCTGGGTCCGGG No data
1077491078_1077491089 2 Left 1077491078 11:2861367-2861389 CCTTCAGGAAACCTCCTCATAAC No data
Right 1077491089 11:2861392-2861414 TCAGGCTGGGTCCGGGGCCCAGG No data
1077491078_1077491092 19 Left 1077491078 11:2861367-2861389 CCTTCAGGAAACCTCCTCATAAC No data
Right 1077491092 11:2861409-2861431 CCCAGGCCCTACAGATGTGCTGG No data
1077491078_1077491094 20 Left 1077491078 11:2861367-2861389 CCTTCAGGAAACCTCCTCATAAC No data
Right 1077491094 11:2861410-2861432 CCAGGCCCTACAGATGTGCTGGG No data
1077491078_1077491097 26 Left 1077491078 11:2861367-2861389 CCTTCAGGAAACCTCCTCATAAC No data
Right 1077491097 11:2861416-2861438 CCTACAGATGTGCTGGGTGCTGG No data
1077491078_1077491084 -6 Left 1077491078 11:2861367-2861389 CCTTCAGGAAACCTCCTCATAAC No data
Right 1077491084 11:2861384-2861406 CATAACCCTCAGGCTGGGTCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077491078 Original CRISPR GTTATGAGGAGGTTTCCTGA AGG (reversed) Intergenic
No off target data available for this crispr