ID: 1077491087

View in Genome Browser
Species Human (GRCh38)
Location 11:2861389-2861411
Sequence GGGCCCCGGACCCAGCCTGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077491087_1077491097 4 Left 1077491087 11:2861389-2861411 CCCTCAGGCTGGGTCCGGGGCCC No data
Right 1077491097 11:2861416-2861438 CCTACAGATGTGCTGGGTGCTGG No data
1077491087_1077491094 -2 Left 1077491087 11:2861389-2861411 CCCTCAGGCTGGGTCCGGGGCCC No data
Right 1077491094 11:2861410-2861432 CCAGGCCCTACAGATGTGCTGGG No data
1077491087_1077491098 18 Left 1077491087 11:2861389-2861411 CCCTCAGGCTGGGTCCGGGGCCC No data
Right 1077491098 11:2861430-2861452 GGGTGCTGGTGCTGACAGACAGG No data
1077491087_1077491092 -3 Left 1077491087 11:2861389-2861411 CCCTCAGGCTGGGTCCGGGGCCC No data
Right 1077491092 11:2861409-2861431 CCCAGGCCCTACAGATGTGCTGG No data
1077491087_1077491099 22 Left 1077491087 11:2861389-2861411 CCCTCAGGCTGGGTCCGGGGCCC No data
Right 1077491099 11:2861434-2861456 GCTGGTGCTGACAGACAGGACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077491087 Original CRISPR GGGCCCCGGACCCAGCCTGA GGG (reversed) Intergenic
No off target data available for this crispr