ID: 1077491090

View in Genome Browser
Species Human (GRCh38)
Location 11:2861403-2861425
Sequence CATCTGTAGGGCCTGGGCCC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077491090_1077491098 4 Left 1077491090 11:2861403-2861425 CCGGGGCCCAGGCCCTACAGATG No data
Right 1077491098 11:2861430-2861452 GGGTGCTGGTGCTGACAGACAGG No data
1077491090_1077491100 21 Left 1077491090 11:2861403-2861425 CCGGGGCCCAGGCCCTACAGATG No data
Right 1077491100 11:2861447-2861469 GACAGGACGGCAACCGTAGCTGG No data
1077491090_1077491097 -10 Left 1077491090 11:2861403-2861425 CCGGGGCCCAGGCCCTACAGATG No data
Right 1077491097 11:2861416-2861438 CCTACAGATGTGCTGGGTGCTGG No data
1077491090_1077491099 8 Left 1077491090 11:2861403-2861425 CCGGGGCCCAGGCCCTACAGATG No data
Right 1077491099 11:2861434-2861456 GCTGGTGCTGACAGACAGGACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077491090 Original CRISPR CATCTGTAGGGCCTGGGCCC CGG (reversed) Intergenic
No off target data available for this crispr