ID: 1077491094

View in Genome Browser
Species Human (GRCh38)
Location 11:2861410-2861432
Sequence CCAGGCCCTACAGATGTGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077491078_1077491094 20 Left 1077491078 11:2861367-2861389 CCTTCAGGAAACCTCCTCATAAC No data
Right 1077491094 11:2861410-2861432 CCAGGCCCTACAGATGTGCTGGG No data
1077491087_1077491094 -2 Left 1077491087 11:2861389-2861411 CCCTCAGGCTGGGTCCGGGGCCC No data
Right 1077491094 11:2861410-2861432 CCAGGCCCTACAGATGTGCTGGG No data
1077491083_1077491094 6 Left 1077491083 11:2861381-2861403 CCTCATAACCCTCAGGCTGGGTC No data
Right 1077491094 11:2861410-2861432 CCAGGCCCTACAGATGTGCTGGG No data
1077491080_1077491094 9 Left 1077491080 11:2861378-2861400 CCTCCTCATAACCCTCAGGCTGG No data
Right 1077491094 11:2861410-2861432 CCAGGCCCTACAGATGTGCTGGG No data
1077491088_1077491094 -3 Left 1077491088 11:2861390-2861412 CCTCAGGCTGGGTCCGGGGCCCA No data
Right 1077491094 11:2861410-2861432 CCAGGCCCTACAGATGTGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077491094 Original CRISPR CCAGGCCCTACAGATGTGCT GGG Intergenic
No off target data available for this crispr