ID: 1077491098

View in Genome Browser
Species Human (GRCh38)
Location 11:2861430-2861452
Sequence GGGTGCTGGTGCTGACAGAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077491083_1077491098 26 Left 1077491083 11:2861381-2861403 CCTCATAACCCTCAGGCTGGGTC No data
Right 1077491098 11:2861430-2861452 GGGTGCTGGTGCTGACAGACAGG No data
1077491087_1077491098 18 Left 1077491087 11:2861389-2861411 CCCTCAGGCTGGGTCCGGGGCCC No data
Right 1077491098 11:2861430-2861452 GGGTGCTGGTGCTGACAGACAGG No data
1077491088_1077491098 17 Left 1077491088 11:2861390-2861412 CCTCAGGCTGGGTCCGGGGCCCA No data
Right 1077491098 11:2861430-2861452 GGGTGCTGGTGCTGACAGACAGG No data
1077491095_1077491098 -8 Left 1077491095 11:2861415-2861437 CCCTACAGATGTGCTGGGTGCTG No data
Right 1077491098 11:2861430-2861452 GGGTGCTGGTGCTGACAGACAGG No data
1077491091_1077491098 -2 Left 1077491091 11:2861409-2861431 CCCAGGCCCTACAGATGTGCTGG No data
Right 1077491098 11:2861430-2861452 GGGTGCTGGTGCTGACAGACAGG No data
1077491093_1077491098 -3 Left 1077491093 11:2861410-2861432 CCAGGCCCTACAGATGTGCTGGG No data
Right 1077491098 11:2861430-2861452 GGGTGCTGGTGCTGACAGACAGG No data
1077491090_1077491098 4 Left 1077491090 11:2861403-2861425 CCGGGGCCCAGGCCCTACAGATG No data
Right 1077491098 11:2861430-2861452 GGGTGCTGGTGCTGACAGACAGG No data
1077491080_1077491098 29 Left 1077491080 11:2861378-2861400 CCTCCTCATAACCCTCAGGCTGG No data
Right 1077491098 11:2861430-2861452 GGGTGCTGGTGCTGACAGACAGG No data
1077491096_1077491098 -9 Left 1077491096 11:2861416-2861438 CCTACAGATGTGCTGGGTGCTGG No data
Right 1077491098 11:2861430-2861452 GGGTGCTGGTGCTGACAGACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077491098 Original CRISPR GGGTGCTGGTGCTGACAGAC AGG Intergenic
No off target data available for this crispr