ID: 1077491809

View in Genome Browser
Species Human (GRCh38)
Location 11:2864431-2864453
Sequence CACCCTGAGGGGAAGGTGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077491809_1077491826 26 Left 1077491809 11:2864431-2864453 CCATCCACCTTCCCCTCAGGGTG No data
Right 1077491826 11:2864480-2864502 GCTGGTACTCAAGGCCCACCTGG No data
1077491809_1077491818 8 Left 1077491809 11:2864431-2864453 CCATCCACCTTCCCCTCAGGGTG No data
Right 1077491818 11:2864462-2864484 GGCCTGGCCCACACCCCTGCTGG No data
1077491809_1077491822 17 Left 1077491809 11:2864431-2864453 CCATCCACCTTCCCCTCAGGGTG No data
Right 1077491822 11:2864471-2864493 CACACCCCTGCTGGTACTCAAGG No data
1077491809_1077491828 28 Left 1077491809 11:2864431-2864453 CCATCCACCTTCCCCTCAGGGTG No data
Right 1077491828 11:2864482-2864504 TGGTACTCAAGGCCCACCTGGGG No data
1077491809_1077491817 -8 Left 1077491809 11:2864431-2864453 CCATCCACCTTCCCCTCAGGGTG No data
Right 1077491817 11:2864446-2864468 TCAGGGTGAAGCTCAGGGCCTGG No data
1077491809_1077491827 27 Left 1077491809 11:2864431-2864453 CCATCCACCTTCCCCTCAGGGTG No data
Right 1077491827 11:2864481-2864503 CTGGTACTCAAGGCCCACCTGGG No data
1077491809_1077491829 29 Left 1077491809 11:2864431-2864453 CCATCCACCTTCCCCTCAGGGTG No data
Right 1077491829 11:2864483-2864505 GGTACTCAAGGCCCACCTGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077491809 Original CRISPR CACCCTGAGGGGAAGGTGGA TGG (reversed) Intergenic
No off target data available for this crispr