ID: 1077495320

View in Genome Browser
Species Human (GRCh38)
Location 11:2884371-2884393
Sequence GCGGCCGGGCGCCGTGAGCA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 135
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 122}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077495320_1077495336 6 Left 1077495320 11:2884371-2884393 CCGTGCTCACGGCGCCCGGCCGC 0: 1
1: 0
2: 0
3: 12
4: 122
Right 1077495336 11:2884400-2884422 GGAGGGGCTCCCGCGGCCGGGGG 0: 1
1: 0
2: 2
3: 23
4: 296
1077495320_1077495330 -1 Left 1077495320 11:2884371-2884393 CCGTGCTCACGGCGCCCGGCCGC 0: 1
1: 0
2: 0
3: 12
4: 122
Right 1077495330 11:2884393-2884415 CGCCCGGGGAGGGGCTCCCGCGG 0: 1
1: 0
2: 3
3: 36
4: 313
1077495320_1077495340 24 Left 1077495320 11:2884371-2884393 CCGTGCTCACGGCGCCCGGCCGC 0: 1
1: 0
2: 0
3: 12
4: 122
Right 1077495340 11:2884418-2884440 GGGGGCGAAAACTGCGCTCCCGG 0: 1
1: 0
2: 0
3: 4
4: 62
1077495320_1077495334 4 Left 1077495320 11:2884371-2884393 CCGTGCTCACGGCGCCCGGCCGC 0: 1
1: 0
2: 0
3: 12
4: 122
Right 1077495334 11:2884398-2884420 GGGGAGGGGCTCCCGCGGCCGGG 0: 1
1: 0
2: 8
3: 56
4: 472
1077495320_1077495341 25 Left 1077495320 11:2884371-2884393 CCGTGCTCACGGCGCCCGGCCGC 0: 1
1: 0
2: 0
3: 12
4: 122
Right 1077495341 11:2884419-2884441 GGGGCGAAAACTGCGCTCCCGGG 0: 1
1: 0
2: 0
3: 5
4: 47
1077495320_1077495326 -10 Left 1077495320 11:2884371-2884393 CCGTGCTCACGGCGCCCGGCCGC 0: 1
1: 0
2: 0
3: 12
4: 122
Right 1077495326 11:2884384-2884406 GCCCGGCCGCGCCCGGGGAGGGG 0: 1
1: 0
2: 7
3: 56
4: 449
1077495320_1077495342 26 Left 1077495320 11:2884371-2884393 CCGTGCTCACGGCGCCCGGCCGC 0: 1
1: 0
2: 0
3: 12
4: 122
Right 1077495342 11:2884420-2884442 GGGCGAAAACTGCGCTCCCGGGG 0: 1
1: 0
2: 0
3: 1
4: 21
1077495320_1077495335 5 Left 1077495320 11:2884371-2884393 CCGTGCTCACGGCGCCCGGCCGC 0: 1
1: 0
2: 0
3: 12
4: 122
Right 1077495335 11:2884399-2884421 GGGAGGGGCTCCCGCGGCCGGGG 0: 1
1: 0
2: 3
3: 52
4: 380
1077495320_1077495333 3 Left 1077495320 11:2884371-2884393 CCGTGCTCACGGCGCCCGGCCGC 0: 1
1: 0
2: 0
3: 12
4: 122
Right 1077495333 11:2884397-2884419 CGGGGAGGGGCTCCCGCGGCCGG 0: 1
1: 0
2: 1
3: 48
4: 357
1077495320_1077495344 28 Left 1077495320 11:2884371-2884393 CCGTGCTCACGGCGCCCGGCCGC 0: 1
1: 0
2: 0
3: 12
4: 122
Right 1077495344 11:2884422-2884444 GCGAAAACTGCGCTCCCGGGGGG 0: 1
1: 0
2: 0
3: 2
4: 44
1077495320_1077495343 27 Left 1077495320 11:2884371-2884393 CCGTGCTCACGGCGCCCGGCCGC 0: 1
1: 0
2: 0
3: 12
4: 122
Right 1077495343 11:2884421-2884443 GGCGAAAACTGCGCTCCCGGGGG 0: 1
1: 0
2: 0
3: 1
4: 27

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077495320 Original CRISPR GCGGCCGGGCGCCGTGAGCA CGG (reversed) Intronic