ID: 1077495328

View in Genome Browser
Species Human (GRCh38)
Location 11:2884386-2884408
Sequence AGCCCCTCCCCGGGCGCGGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 315
Summary {0: 1, 1: 0, 2: 2, 3: 39, 4: 273}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077495328_1077495335 -10 Left 1077495328 11:2884386-2884408 CCGGCCGCGCCCGGGGAGGGGCT 0: 1
1: 0
2: 2
3: 39
4: 273
Right 1077495335 11:2884399-2884421 GGGAGGGGCTCCCGCGGCCGGGG 0: 1
1: 0
2: 3
3: 52
4: 380
1077495328_1077495340 9 Left 1077495328 11:2884386-2884408 CCGGCCGCGCCCGGGGAGGGGCT 0: 1
1: 0
2: 2
3: 39
4: 273
Right 1077495340 11:2884418-2884440 GGGGGCGAAAACTGCGCTCCCGG 0: 1
1: 0
2: 0
3: 4
4: 62
1077495328_1077495341 10 Left 1077495328 11:2884386-2884408 CCGGCCGCGCCCGGGGAGGGGCT 0: 1
1: 0
2: 2
3: 39
4: 273
Right 1077495341 11:2884419-2884441 GGGGCGAAAACTGCGCTCCCGGG 0: 1
1: 0
2: 0
3: 5
4: 47
1077495328_1077495345 19 Left 1077495328 11:2884386-2884408 CCGGCCGCGCCCGGGGAGGGGCT 0: 1
1: 0
2: 2
3: 39
4: 273
Right 1077495345 11:2884428-2884450 ACTGCGCTCCCGGGGGGTCGCGG 0: 1
1: 0
2: 0
3: 4
4: 89
1077495328_1077495343 12 Left 1077495328 11:2884386-2884408 CCGGCCGCGCCCGGGGAGGGGCT 0: 1
1: 0
2: 2
3: 39
4: 273
Right 1077495343 11:2884421-2884443 GGCGAAAACTGCGCTCCCGGGGG 0: 1
1: 0
2: 0
3: 1
4: 27
1077495328_1077495342 11 Left 1077495328 11:2884386-2884408 CCGGCCGCGCCCGGGGAGGGGCT 0: 1
1: 0
2: 2
3: 39
4: 273
Right 1077495342 11:2884420-2884442 GGGCGAAAACTGCGCTCCCGGGG 0: 1
1: 0
2: 0
3: 1
4: 21
1077495328_1077495347 24 Left 1077495328 11:2884386-2884408 CCGGCCGCGCCCGGGGAGGGGCT 0: 1
1: 0
2: 2
3: 39
4: 273
Right 1077495347 11:2884433-2884455 GCTCCCGGGGGGTCGCGGCCGGG 0: 1
1: 0
2: 0
3: 19
4: 196
1077495328_1077495344 13 Left 1077495328 11:2884386-2884408 CCGGCCGCGCCCGGGGAGGGGCT 0: 1
1: 0
2: 2
3: 39
4: 273
Right 1077495344 11:2884422-2884444 GCGAAAACTGCGCTCCCGGGGGG 0: 1
1: 0
2: 0
3: 2
4: 44
1077495328_1077495336 -9 Left 1077495328 11:2884386-2884408 CCGGCCGCGCCCGGGGAGGGGCT 0: 1
1: 0
2: 2
3: 39
4: 273
Right 1077495336 11:2884400-2884422 GGAGGGGCTCCCGCGGCCGGGGG 0: 1
1: 0
2: 2
3: 23
4: 296
1077495328_1077495346 23 Left 1077495328 11:2884386-2884408 CCGGCCGCGCCCGGGGAGGGGCT 0: 1
1: 0
2: 2
3: 39
4: 273
Right 1077495346 11:2884432-2884454 CGCTCCCGGGGGGTCGCGGCCGG 0: 1
1: 0
2: 0
3: 15
4: 131

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077495328 Original CRISPR AGCCCCTCCCCGGGCGCGGC CGG (reversed) Intronic