ID: 1077495331

View in Genome Browser
Species Human (GRCh38)
Location 11:2884395-2884417
Sequence GGCCGCGGGAGCCCCTCCCC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 371
Summary {0: 1, 1: 0, 2: 5, 3: 35, 4: 330}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077495331_1077495341 1 Left 1077495331 11:2884395-2884417 CCCGGGGAGGGGCTCCCGCGGCC 0: 1
1: 0
2: 5
3: 35
4: 330
Right 1077495341 11:2884419-2884441 GGGGCGAAAACTGCGCTCCCGGG 0: 1
1: 0
2: 0
3: 5
4: 47
1077495331_1077495347 15 Left 1077495331 11:2884395-2884417 CCCGGGGAGGGGCTCCCGCGGCC 0: 1
1: 0
2: 5
3: 35
4: 330
Right 1077495347 11:2884433-2884455 GCTCCCGGGGGGTCGCGGCCGGG 0: 1
1: 0
2: 0
3: 19
4: 196
1077495331_1077495340 0 Left 1077495331 11:2884395-2884417 CCCGGGGAGGGGCTCCCGCGGCC 0: 1
1: 0
2: 5
3: 35
4: 330
Right 1077495340 11:2884418-2884440 GGGGGCGAAAACTGCGCTCCCGG 0: 1
1: 0
2: 0
3: 4
4: 62
1077495331_1077495343 3 Left 1077495331 11:2884395-2884417 CCCGGGGAGGGGCTCCCGCGGCC 0: 1
1: 0
2: 5
3: 35
4: 330
Right 1077495343 11:2884421-2884443 GGCGAAAACTGCGCTCCCGGGGG 0: 1
1: 0
2: 0
3: 1
4: 27
1077495331_1077495346 14 Left 1077495331 11:2884395-2884417 CCCGGGGAGGGGCTCCCGCGGCC 0: 1
1: 0
2: 5
3: 35
4: 330
Right 1077495346 11:2884432-2884454 CGCTCCCGGGGGGTCGCGGCCGG 0: 1
1: 0
2: 0
3: 15
4: 131
1077495331_1077495345 10 Left 1077495331 11:2884395-2884417 CCCGGGGAGGGGCTCCCGCGGCC 0: 1
1: 0
2: 5
3: 35
4: 330
Right 1077495345 11:2884428-2884450 ACTGCGCTCCCGGGGGGTCGCGG 0: 1
1: 0
2: 0
3: 4
4: 89
1077495331_1077495342 2 Left 1077495331 11:2884395-2884417 CCCGGGGAGGGGCTCCCGCGGCC 0: 1
1: 0
2: 5
3: 35
4: 330
Right 1077495342 11:2884420-2884442 GGGCGAAAACTGCGCTCCCGGGG 0: 1
1: 0
2: 0
3: 1
4: 21
1077495331_1077495344 4 Left 1077495331 11:2884395-2884417 CCCGGGGAGGGGCTCCCGCGGCC 0: 1
1: 0
2: 5
3: 35
4: 330
Right 1077495344 11:2884422-2884444 GCGAAAACTGCGCTCCCGGGGGG 0: 1
1: 0
2: 0
3: 2
4: 44

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077495331 Original CRISPR GGCCGCGGGAGCCCCTCCCC GGG (reversed) Intronic