ID: 1077495337

View in Genome Browser
Species Human (GRCh38)
Location 11:2884409-2884431
Sequence CAGTTTTCGCCCCCGGCCGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 46
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 41}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077495337_1077495347 1 Left 1077495337 11:2884409-2884431 CCCGCGGCCGGGGGCGAAAACTG 0: 1
1: 0
2: 0
3: 4
4: 41
Right 1077495347 11:2884433-2884455 GCTCCCGGGGGGTCGCGGCCGGG 0: 1
1: 0
2: 0
3: 19
4: 196
1077495337_1077495345 -4 Left 1077495337 11:2884409-2884431 CCCGCGGCCGGGGGCGAAAACTG 0: 1
1: 0
2: 0
3: 4
4: 41
Right 1077495345 11:2884428-2884450 ACTGCGCTCCCGGGGGGTCGCGG 0: 1
1: 0
2: 0
3: 4
4: 89
1077495337_1077495344 -10 Left 1077495337 11:2884409-2884431 CCCGCGGCCGGGGGCGAAAACTG 0: 1
1: 0
2: 0
3: 4
4: 41
Right 1077495344 11:2884422-2884444 GCGAAAACTGCGCTCCCGGGGGG 0: 1
1: 0
2: 0
3: 2
4: 44
1077495337_1077495346 0 Left 1077495337 11:2884409-2884431 CCCGCGGCCGGGGGCGAAAACTG 0: 1
1: 0
2: 0
3: 4
4: 41
Right 1077495346 11:2884432-2884454 CGCTCCCGGGGGGTCGCGGCCGG 0: 1
1: 0
2: 0
3: 15
4: 131

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077495337 Original CRISPR CAGTTTTCGCCCCCGGCCGC GGG (reversed) Intronic