ID: 1077495344

View in Genome Browser
Species Human (GRCh38)
Location 11:2884422-2884444
Sequence GCGAAAACTGCGCTCCCGGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 47
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 44}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077495337_1077495344 -10 Left 1077495337 11:2884409-2884431 CCCGCGGCCGGGGGCGAAAACTG 0: 1
1: 0
2: 0
3: 4
4: 41
Right 1077495344 11:2884422-2884444 GCGAAAACTGCGCTCCCGGGGGG 0: 1
1: 0
2: 0
3: 2
4: 44
1077495329_1077495344 9 Left 1077495329 11:2884390-2884412 CCGCGCCCGGGGAGGGGCTCCCG 0: 1
1: 0
2: 0
3: 26
4: 348
Right 1077495344 11:2884422-2884444 GCGAAAACTGCGCTCCCGGGGGG 0: 1
1: 0
2: 0
3: 2
4: 44
1077495328_1077495344 13 Left 1077495328 11:2884386-2884408 CCGGCCGCGCCCGGGGAGGGGCT 0: 1
1: 0
2: 2
3: 39
4: 273
Right 1077495344 11:2884422-2884444 GCGAAAACTGCGCTCCCGGGGGG 0: 1
1: 0
2: 0
3: 2
4: 44
1077495332_1077495344 3 Left 1077495332 11:2884396-2884418 CCGGGGAGGGGCTCCCGCGGCCG 0: 1
1: 0
2: 1
3: 29
4: 275
Right 1077495344 11:2884422-2884444 GCGAAAACTGCGCTCCCGGGGGG 0: 1
1: 0
2: 0
3: 2
4: 44
1077495327_1077495344 14 Left 1077495327 11:2884385-2884407 CCCGGCCGCGCCCGGGGAGGGGC 0: 1
1: 1
2: 2
3: 70
4: 498
Right 1077495344 11:2884422-2884444 GCGAAAACTGCGCTCCCGGGGGG 0: 1
1: 0
2: 0
3: 2
4: 44
1077495320_1077495344 28 Left 1077495320 11:2884371-2884393 CCGTGCTCACGGCGCCCGGCCGC 0: 1
1: 0
2: 0
3: 12
4: 122
Right 1077495344 11:2884422-2884444 GCGAAAACTGCGCTCCCGGGGGG 0: 1
1: 0
2: 0
3: 2
4: 44
1077495331_1077495344 4 Left 1077495331 11:2884395-2884417 CCCGGGGAGGGGCTCCCGCGGCC 0: 1
1: 0
2: 5
3: 35
4: 330
Right 1077495344 11:2884422-2884444 GCGAAAACTGCGCTCCCGGGGGG 0: 1
1: 0
2: 0
3: 2
4: 44

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077495344 Original CRISPR GCGAAAACTGCGCTCCCGGG GGG Intronic
903279748 1:22243821-22243843 GTGAAAACTGAGCCCCCGGGAGG - Intergenic
907902628 1:58754998-58755020 GAGGAAACTGAGCTTCCGGGAGG - Intergenic
915816595 1:158973658-158973680 GCGATGACTGTGCTCCTGGGTGG - Exonic
1077495344 11:2884422-2884444 GCGAAAACTGCGCTCCCGGGGGG + Intronic
1087076244 11:94129210-94129232 GCGAAAGCCGCGCGCCCGGCCGG + Exonic
1100304918 12:93341608-93341630 GAGGAAACTGAGCTCCAGGGAGG + Intergenic
1101282472 12:103272766-103272788 GAGAAAACTGGGGTCCAGGGAGG + Intronic
1104375180 12:128259668-128259690 GAGTAAACAGCGCTCCCTGGTGG - Intergenic
1113337132 13:109387525-109387547 GGGAAAACTGTCCTCCTGGGTGG + Intergenic
1132462201 16:61248-61270 GCGAAAACTTGGCGCCCAGGTGG + Exonic
1142973786 17:3631021-3631043 GGGAAGACAGCACTCCCGGGAGG - Intronic
1148651042 17:49250190-49250212 GAGAAAACTGAGCCCCAGGGAGG - Intergenic
1148852375 17:50561322-50561344 GCGCAAGCTGAGCCCCCGGGAGG - Intronic
1152921599 17:83068777-83068799 GCGACAACGGGGGTCCCGGGAGG + Intergenic
1159798321 18:72868540-72868562 GCGAAACCTGCGCCCCAGGGAGG - Intergenic
1160256500 18:77251780-77251802 GGGCAAACTGCGCACCCCGGGGG - Intronic
1161063545 19:2226925-2226947 GCGCGAACTGCGGTCCCGGCGGG - Exonic
1161894467 19:7069818-7069840 GCGGAAACCCGGCTCCCGGGAGG - Intronic
1165424975 19:35740570-35740592 GGGAAAGCTGCGCTCCAGTGCGG + Intronic
1166087026 19:40483131-40483153 GTGAAAACTGGGGTCCCGAGAGG + Intronic
940592563 2:155748417-155748439 AAGAAAACTGAGCTCCCTGGGGG + Intergenic
1178709447 21:34901802-34901824 CTGAAAATTGCGCTCCAGGGAGG + Intronic
1184141826 22:42582006-42582028 GCGACCCCCGCGCTCCCGGGTGG - Intergenic
1184230827 22:43157457-43157479 GAGAAAACTGAGGTCCAGGGAGG + Intronic
1185337810 22:50278551-50278573 GCGAGAACTGGGCACCCTGGGGG - Intronic
950679302 3:14573988-14574010 GCGAAAACTTGGCACCCAGGTGG + Intergenic
952572270 3:34731753-34731775 AAGAAAACTGAGCTCCCTGGGGG + Intergenic
962779160 3:138694862-138694884 GCCTAAACTGCCCCCCCGGGAGG - Exonic
969406492 4:6996574-6996596 GCGAAAACAGGGCTGCAGGGTGG + Intronic
983989971 4:174106756-174106778 GTGAAGACTGCCCTCCCAGGTGG - Intergenic
983991097 4:174120936-174120958 GAGGAAACTGAGCTCCAGGGTGG - Intergenic
996639034 5:125730445-125730467 AAGAAAACTGAGCTCCCTGGAGG + Intergenic
999238773 5:150115496-150115518 GGGAAAACTGAGTTCCCTGGGGG + Exonic
1006679769 6:35788371-35788393 GTGTAAACTGGGCTTCCGGGGGG - Intronic
1007600173 6:43076424-43076446 GCGCAGACTGCGCTCCGCGGCGG - Intronic
1011798406 6:90982775-90982797 GAGAGAACTGCTCTCGCGGGTGG - Intergenic
1014910413 6:127085911-127085933 GAGAAAACTGAGCTCCTTGGGGG - Intergenic
1015496931 6:133891821-133891843 GGGAAAGGCGCGCTCCCGGGGGG + Exonic
1019340751 7:507750-507772 GCAGAAACTGCGCCCCAGGGAGG + Intronic
1040293921 8:46139502-46139524 GCGAAAACAGTGCTGCAGGGTGG - Intergenic
1040305769 8:46211017-46211039 GCGAAAACAGGGCTGCAGGGTGG + Intergenic
1040310801 8:46235857-46235879 GCGAAAACTGGGCCGCAGGGTGG + Intergenic
1040311438 8:46238867-46238889 GCGAAAACGGGGCTGCAGGGTGG + Intergenic
1040331180 8:46386548-46386570 GCGAAAACGGGGCTGCAGGGTGG + Intergenic
1048141530 8:131799554-131799576 GAGGAAACTGAGCTCCTGGGAGG - Intergenic
1057600086 9:96450251-96450273 GCGACCACTGCGGGCCCGGGAGG - Exonic
1200216769 X:154371525-154371547 GCGAAACCCGGGCTCCAGGGTGG + Intronic