ID: 1077495688

View in Genome Browser
Species Human (GRCh38)
Location 11:2885590-2885612
Sequence CACGCAGAGTCGGGCGGCGC GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 75
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 68}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077495688_1077495697 2 Left 1077495688 11:2885590-2885612 CCCGCGCCGCCCGACTCTGCGTG 0: 1
1: 0
2: 0
3: 6
4: 68
Right 1077495697 11:2885615-2885637 CGAGGGACGCGGCGGCTACCTGG 0: 1
1: 0
2: 0
3: 9
4: 61
1077495688_1077495696 -6 Left 1077495688 11:2885590-2885612 CCCGCGCCGCCCGACTCTGCGTG 0: 1
1: 0
2: 0
3: 6
4: 68
Right 1077495696 11:2885607-2885629 TGCGTGTGCGAGGGACGCGGCGG 0: 1
1: 0
2: 0
3: 12
4: 174
1077495688_1077495699 13 Left 1077495688 11:2885590-2885612 CCCGCGCCGCCCGACTCTGCGTG 0: 1
1: 0
2: 0
3: 6
4: 68
Right 1077495699 11:2885626-2885648 GCGGCTACCTGGCTGTCCGGTGG 0: 1
1: 0
2: 0
3: 6
4: 81
1077495688_1077495695 -9 Left 1077495688 11:2885590-2885612 CCCGCGCCGCCCGACTCTGCGTG 0: 1
1: 0
2: 0
3: 6
4: 68
Right 1077495695 11:2885604-2885626 CTCTGCGTGTGCGAGGGACGCGG 0: 1
1: 0
2: 0
3: 3
4: 120
1077495688_1077495698 10 Left 1077495688 11:2885590-2885612 CCCGCGCCGCCCGACTCTGCGTG 0: 1
1: 0
2: 0
3: 6
4: 68
Right 1077495698 11:2885623-2885645 GCGGCGGCTACCTGGCTGTCCGG 0: 1
1: 0
2: 0
3: 4
4: 85
1077495688_1077495700 16 Left 1077495688 11:2885590-2885612 CCCGCGCCGCCCGACTCTGCGTG 0: 1
1: 0
2: 0
3: 6
4: 68
Right 1077495700 11:2885629-2885651 GCTACCTGGCTGTCCGGTGGTGG 0: 1
1: 0
2: 0
3: 6
4: 85

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077495688 Original CRISPR CACGCAGAGTCGGGCGGCGC GGG (reversed) Exonic
900155238 1:1201223-1201245 CGCGGAGGGTCGGGCGGGGCCGG - Intergenic
904820581 1:33241088-33241110 AACTCAGAGTGGGGCGGGGCGGG - Intergenic
905210299 1:36369545-36369567 CAGGGAGAGTTGGGCGGGGCAGG - Intronic
905393225 1:37651258-37651280 CCCACAGAGTCGGGTGGGGCTGG + Intergenic
911664643 1:100539270-100539292 CCCGCAGACTGGGACGGCGCTGG + Exonic
912486709 1:110034843-110034865 CGCACCGGGTCGGGCGGCGCCGG + Intronic
915238262 1:154501803-154501825 AACTCGGAGGCGGGCGGCGCTGG - Exonic
915321420 1:155058396-155058418 CAGGCAGAGTCAGGAGGGGCTGG - Exonic
921167053 1:212514927-212514949 CCAGCACAGTCCGGCGGCGCTGG - Intergenic
922791834 1:228315158-228315180 CAGGCAGTGTCCGGTGGCGCTGG + Intronic
1071532574 10:86401020-86401042 CACCCTGGGGCGGGCGGCGCGGG - Intergenic
1075473820 10:122715763-122715785 CAAGCACAGTCGGGAGCCGCAGG + Intergenic
1077495688 11:2885590-2885612 CACGCAGAGTCGGGCGGCGCGGG - Exonic
1083933383 11:65857951-65857973 CACGAAGGGGCGGGCGGTGCCGG - Intronic
1085254317 11:75163921-75163943 CAGGCAGAGGTGGGCGGTGCAGG - Intronic
1102528051 12:113525929-113525951 CACGCAGAGTTGAGAGGCACTGG + Intergenic
1102924930 12:116819384-116819406 CGCGCAGAGCGGGGCGGCCCGGG + Intronic
1103901902 12:124307662-124307684 CACGGAGGGCTGGGCGGCGCAGG + Intronic
1114586339 14:23817377-23817399 CATGCAGAGTGGGGTGGCGTGGG - Intergenic
1114676258 14:24442295-24442317 AGGGCAGAGTTGGGCGGCGCAGG - Intronic
1115642100 14:35341519-35341541 CAGGCAGAGACGGGATGCGCTGG - Intergenic
1117920543 14:60722788-60722810 CCCGCAGAGACTGCCGGCGCCGG - Intronic
1122660175 14:103289899-103289921 CCCGCAGAGTGGGGTGGGGCCGG - Intergenic
1125508845 15:40282237-40282259 CCCGCAGAGTCGGCCGCCTCGGG + Exonic
1131888644 15:96948011-96948033 CGCGGGGAGGCGGGCGGCGCGGG - Intergenic
1132870688 16:2114509-2114531 CACGTAGAGGCGGCCGTCGCGGG + Exonic
1133242821 16:4425839-4425861 CACCTAGAGCCGGGCGGCGCAGG + Exonic
1134521843 16:14922395-14922417 CACGTAGAGGCGGCCGTCGCGGG - Intronic
1134709513 16:16321046-16321068 CACGTAGAGGCGGCCGTCGCGGG - Intergenic
1134716726 16:16361075-16361097 CACGTAGAGGCGGCCGTCGCGGG - Intergenic
1134950090 16:18347599-18347621 CACGTAGAGGCGGCCGTCGCGGG + Intergenic
1134958024 16:18391084-18391106 CACGTAGAGGCGGCCGTCGCGGG + Intergenic
1135382673 16:22007948-22007970 AACGTAGAGGCGGGCGGTGCGGG + Intronic
1138651666 16:58464400-58464422 CACCCAGAGCCGGGCCGCGCCGG + Exonic
1143773814 17:9185122-9185144 CCCCCAGAGTAGGGCAGCGCAGG - Intronic
1144438444 17:15261384-15261406 CGCGCAGACTCTGGCGGCTCCGG + Intronic
1147150358 17:38510517-38510539 GACGCCGAGCCGGGCGGCTCCGG - Exonic
1151828816 17:76537991-76538013 CACGCGGCGCTGGGCGGCGCGGG + Intronic
1152883351 17:82833050-82833072 CAAGCAGAGTCGGGCAGCCCTGG - Intronic
1160862153 19:1241985-1242007 CACGCAGGTTCGGGCGCTGCGGG + Exonic
1164575106 19:29401333-29401355 CACACAGAGTCCGGGGGGGCAGG + Intergenic
1165242806 19:34481556-34481578 GACGCAGGGGCGGGCGGCGGAGG - Intergenic
1167466099 19:49651737-49651759 CATGCGGAGTCGGACGGCGAGGG + Exonic
927645724 2:24875598-24875620 CACGCAGCGACGGGAGGCGAGGG + Intronic
928085270 2:28342253-28342275 GACGCAGAGTTGGGAGGAGCAGG + Intergenic
944273141 2:197805130-197805152 CCCGCCGCGTCGGGCGGCGCCGG - Exonic
945435110 2:209809545-209809567 CACCAAGAGTCGGGCTGCTCAGG + Intronic
947539319 2:230964301-230964323 CACGGAGGCTCGGGCGGAGCAGG + Intergenic
1181037004 22:20174561-20174583 CACGCAGAGGAGGGCTGTGCTGG + Intergenic
1185051676 22:48557354-48557376 CAGGCTGAGGAGGGCGGCGCCGG + Intronic
954733587 3:52685937-52685959 CACGCAGTGTCGCGCGGAGCAGG - Exonic
968927192 4:3555753-3555775 CAGGCAGAGTCAGGCCGCACTGG - Intergenic
969613174 4:8238192-8238214 CAGGCAGGGTGGGGCGGGGCCGG + Intronic
973552634 4:52051330-52051352 CACCCAGGGCGGGGCGGCGCGGG + Exonic
985996708 5:3600910-3600932 GACGCAGCGCCGGGCGACGCCGG - Intronic
986847992 5:11778295-11778317 CAAGCAGAGCTGGGCGGGGCAGG + Intronic
1013272871 6:108559632-108559654 CCCGCGGAGCCGGGCCGCGCAGG + Intergenic
1017731723 6:157323259-157323281 CCCGCGGAGTCTGGCGGCCCAGG - Intronic
1019474549 7:1237606-1237628 CACGCCGGGGCGCGCGGCGCGGG + Intergenic
1021351859 7:19603189-19603211 CACGAAGAGTGGGGTGGCTCAGG + Intergenic
1033724226 7:144095823-144095845 CACGCAGAGGTGGGAGGAGCAGG - Exonic
1033736976 7:144232106-144232128 CACGCAGAGGTGGGAGGAGCAGG + Exonic
1033746081 7:144318840-144318862 CACGCAGAGGTGGGAGGAGCAGG - Exonic
1034670766 7:152856507-152856529 CATGCTGAATCGGGCGGGGCAGG - Intergenic
1036125396 8:6057484-6057506 CAGGCAGAGCAGGGCGGGGCTGG - Intergenic
1037821884 8:22139046-22139068 CTCGCAGAGTCAGGGGGCGCTGG - Exonic
1048345550 8:133572113-133572135 GGCGCAGAGTCGGGAGGGGCGGG - Intergenic
1053802115 9:41771163-41771185 CAGGCAGAGTCAGGCCGCACTGG - Intergenic
1054647971 9:67605268-67605290 CAGGCAGAGTCAGGCCGCACTGG + Intergenic
1057758107 9:97853170-97853192 CACGAAGCGTGGGGCGGCACCGG - Intergenic
1059314139 9:113410072-113410094 CACGAAGACGCTGGCGGCGCGGG + Exonic
1060114326 9:120928760-120928782 CCTGCAGAGCCGGGCGGCGGGGG - Exonic
1060221575 9:121766751-121766773 CAGGCAGAGTTGGGCAGGGCTGG + Intronic
1062597983 9:137307614-137307636 CACCCAGAGCCAGGCGGTGCAGG - Exonic
1190225194 X:48539774-48539796 CACCCTGAGACGGGCGGCGGCGG + Exonic