ID: 1077497304

View in Genome Browser
Species Human (GRCh38)
Location 11:2892455-2892477
Sequence GGTGTCACTCGCACCTCAGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 58
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 50}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077497299_1077497304 0 Left 1077497299 11:2892432-2892454 CCCCTCGGATCTGGGGGTGGGGC 0: 1
1: 0
2: 1
3: 25
4: 204
Right 1077497304 11:2892455-2892477 GGTGTCACTCGCACCTCAGTGGG 0: 1
1: 0
2: 0
3: 7
4: 50
1077497300_1077497304 -1 Left 1077497300 11:2892433-2892455 CCCTCGGATCTGGGGGTGGGGCG 0: 1
1: 0
2: 0
3: 20
4: 164
Right 1077497304 11:2892455-2892477 GGTGTCACTCGCACCTCAGTGGG 0: 1
1: 0
2: 0
3: 7
4: 50
1077497290_1077497304 8 Left 1077497290 11:2892424-2892446 CCCCAACACCCCTCGGATCTGGG 0: 1
1: 0
2: 1
3: 9
4: 183
Right 1077497304 11:2892455-2892477 GGTGTCACTCGCACCTCAGTGGG 0: 1
1: 0
2: 0
3: 7
4: 50
1077497294_1077497304 6 Left 1077497294 11:2892426-2892448 CCAACACCCCTCGGATCTGGGGG 0: 1
1: 0
2: 0
3: 9
4: 157
Right 1077497304 11:2892455-2892477 GGTGTCACTCGCACCTCAGTGGG 0: 1
1: 0
2: 0
3: 7
4: 50
1077497301_1077497304 -2 Left 1077497301 11:2892434-2892456 CCTCGGATCTGGGGGTGGGGCGG 0: 1
1: 0
2: 3
3: 57
4: 340
Right 1077497304 11:2892455-2892477 GGTGTCACTCGCACCTCAGTGGG 0: 1
1: 0
2: 0
3: 7
4: 50
1077497292_1077497304 7 Left 1077497292 11:2892425-2892447 CCCAACACCCCTCGGATCTGGGG 0: 1
1: 0
2: 1
3: 8
4: 71
Right 1077497304 11:2892455-2892477 GGTGTCACTCGCACCTCAGTGGG 0: 1
1: 0
2: 0
3: 7
4: 50

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077497304 Original CRISPR GGTGTCACTCGCACCTCAGT GGG Intronic
909875563 1:80798265-80798287 AGTTTCACTCCCACCTCAGAGGG + Intergenic
912786141 1:112605750-112605772 GGTGACACTGCCACCCCAGTAGG - Intronic
1062895586 10:1100916-1100938 GGTGGCACGTGCAGCTCAGTCGG - Intronic
1071792932 10:88975113-88975135 GGTTTCACTTTCACTTCAGTGGG - Intronic
1072122611 10:92417648-92417670 CCCGTCACTGGCACCTCAGTGGG - Intergenic
1077036051 11:495026-495048 GCTGTCACTCACATCGCAGTCGG + Exonic
1077497304 11:2892455-2892477 GGTGTCACTCGCACCTCAGTGGG + Intronic
1085523033 11:77149334-77149356 GATGTCACTCCCAGCTCAGAGGG + Intronic
1089133997 11:116234914-116234936 GGTGCCAAAGGCACCTCAGTGGG - Intergenic
1096647894 12:53048172-53048194 TGTGGCACTCGCACCTCGGAAGG - Intronic
1100085266 12:90902687-90902709 GGTGTGACTATAACCTCAGTCGG + Intergenic
1102143750 12:110638287-110638309 GGTGTCACACAGACCTAAGTTGG - Intronic
1104401123 12:128477221-128477243 GGACTCACTCACACGTCAGTTGG + Intronic
1104963799 12:132500175-132500197 GGTGTCCCTCTGGCCTCAGTGGG - Intronic
1108425964 13:50300591-50300613 GGTGTCACTGGAATCTCAGAAGG + Intronic
1108747536 13:53410075-53410097 CATGTCACTTGCAACTCAGTGGG + Intergenic
1126903262 15:53336551-53336573 GGTGGCACTGCCACCCCAGTGGG - Intergenic
1132899776 16:2246854-2246876 GGTGTCATTCTGACCTCGGTAGG - Exonic
1143697348 17:8630418-8630440 GGGGGCACTGGGACCTCAGTGGG - Intronic
1148700797 17:49585626-49585648 GGTGTTTCTCTCACCCCAGTGGG + Intergenic
1155885810 18:31206897-31206919 GGTGTCACTCGCTCCTCAAGTGG + Intergenic
1161734206 19:5980794-5980816 GATGTCACTAGCACCAGAGTTGG + Intergenic
1164670424 19:30069218-30069240 GGTGGCACTCATACCTCAGCTGG + Intergenic
1165489091 19:36113090-36113112 GATGTCTCTCGGACCCCAGTGGG + Intronic
925092851 2:1169041-1169063 GGTGTCAGACGCACATCAGGAGG + Intronic
932600068 2:73117772-73117794 GGTGATCCTCCCACCTCAGTAGG - Intronic
945188049 2:207159711-207159733 GAAGTCACTCGCACCTCATTTGG + Intronic
947739204 2:232477324-232477346 GGTCTCACTCGCACCCAAGCTGG + Intergenic
948167637 2:235875351-235875373 GGTGAGACTCGCACCTCGGTGGG - Intronic
1180762852 22:18222523-18222545 GGTGACACTCGCACGTCACAGGG + Intergenic
1180772794 22:18402024-18402046 GGTGACACTCGCACGTCACAGGG - Intergenic
1180804173 22:18651640-18651662 GGTGACACTCGCACGTCACAGGG - Intergenic
1180806601 22:18717837-18717859 GGTGACACTCGCACGTCACAGGG + Intergenic
1181217547 22:21343619-21343641 GGTGACACTCGCACGTCACAGGG + Intergenic
1183003858 22:34883924-34883946 GGTGTCCCATGCACCCCAGTGGG + Intergenic
1184583996 22:45435464-45435486 GCTGTCACTCGCCCATCACTGGG - Intergenic
1184886805 22:47351552-47351574 GATGAAACTCGTACCTCAGTTGG + Intergenic
1185219555 22:49622606-49622628 GCTTTCACTCCCACCTCTGTGGG - Intronic
1203234629 22_KI270731v1_random:143012-143034 GGTGACACTCGCACGTCACAGGG - Intergenic
966774401 3:183531288-183531310 GGTGACACTGCCACCTCAGTGGG + Intronic
970631797 4:17954802-17954824 GGTATCACTCGTGACTCAGTTGG - Intronic
970854480 4:20636516-20636538 GGTGTCACTCGCCCCTCTGCGGG - Intergenic
973112499 4:46413122-46413144 GGTGCCACTTGAACTTCAGTAGG - Intronic
986528181 5:8703600-8703622 GCTGTCACTGGCATCTCAGTTGG + Intergenic
987078737 5:14407317-14407339 GCTGACACTCGCACCTCATGTGG - Intronic
991612925 5:68467176-68467198 GGTGTTTCTCACACCTCTGTGGG + Intergenic
1007595735 6:43050187-43050209 GATGTCACTAGCAACTCAGCAGG + Intronic
1008369298 6:50714851-50714873 GGTGTCACCCGCACCTATATAGG + Intronic
1019970080 7:4533760-4533782 GGTGAAACGCGCACCTCAGACGG - Intergenic
1036696429 8:10978108-10978130 AGTGTCACTAGGACCTCAGTGGG - Intronic
1049567000 8:143345505-143345527 GGTGTCACTCACACCCCACGTGG + Intronic
1057137846 9:92706645-92706667 GGTGGCACTATCACCTTAGTGGG - Intergenic
1062623173 9:137431644-137431666 CTGGTCACTCGCACCCCAGTGGG - Intronic
1186453670 X:9693758-9693780 TGTGCCACTCACCCCTCAGTGGG - Intronic
1187090385 X:16089906-16089928 AGTGTCATTAGCACCTAAGTAGG - Intergenic
1189880508 X:45486830-45486852 GGTCTCACTTGCACCACAGCAGG - Intergenic
1193199626 X:78673279-78673301 GAAGTCACTGGCACTTCAGTGGG + Intergenic
1195788014 X:108548146-108548168 GGTGAACCTGGCACCTCAGTTGG + Intronic